Snps associated with pneumonia resistance in sheep and use thereof

By identifying and utilizing T/C polymorphic SNP sites in the sheep ADGRD1 gene as molecular markers, primers were designed for PCR amplification and sequencing to identify anti-pneumonia performance. This solved the breeding problem of sheep mycoplasma pneumonia, improved sheep disease resistance, and reduced pneumonia incidence and copy number.

CN119410790BActive Publication Date: 2025-11-18INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411742320.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-29
Publication Date
2025-11-18
Estimated Expiration
2044-11-29

AI Technical Summary

Technical Problem

The lack of molecular markers for selecting disease-resistant traits in local sheep breeds in the current technology leads to a high incidence of mycoplasma pneumonia in sheep, which affects growth rate and survival rate.

Method used

The T/C polymorphism SNP site at position 352 of the sheep ADDRD1 gene was discovered and used as a molecular marker. Specific primers were designed for PCR amplification and sequencing to identify anti-pneumonia performance. The TC genotype sheep were amplified and verified by primer pair SEQ ID NO:2-3 to have higher anti-pneumonia ability.

Benefits of technology

Molecular marker-assisted breeding to combat mycoplasma pneumonia traits has been achieved, improving the disease resistance of sheep populations and reducing the incidence and copy number of mycoplasma pneumonia.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The application discloses a SNP molecular marker related to a sheep anti-pneumonia trait and application thereof, and belongs to the field of molecular biology. ADGRD1 It is found for the first time that a SNP site on a gene is significantly related to a sheep anti-mycoplasmal pneumonia trait, and can be used as a sheep anti-mycoplasmal pneumonia trait molecular marker, and the site is used as a target point for breeding sheep to improve disease resistance. The sheep individual identified by the method has relatively strong anti-mycoplasmal pneumonia ability, and can be used for breeding a new sheep strain with the anti-mycoplasmal pneumonia performance.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology, and particularly relates to a SNP molecular marker related to the anti-pneumonia trait of sheep and application thereof. BACKGROUND

[0002] Sheep is one of the important sources of human animal protein. In the sheep breeding industry, mycoplasma pneumonia is a common chronic disease in sheep groups, the growth rate of sick sheep is affected, and severe cases can cause sheep death, which has great harm to sheep breeding. Therefore, improving the disease resistance of sheep has great significance for sheep breeding. Cultivating sheep strains resistant to mycoplasma pneumonia of sheep can improve the disease resistance of sheep groups. In sheep breeding, individuals with good disease resistance can be identified for breeding by using molecular markers with disease resistance, but there are few molecular markers suitable for selecting disease resistance traits of domestic local sheep breeds.

[0003] As an important branch of the GPCR superfamily, the adhesion G protein-coupled receptor of the B2 family has a low homology with the transmembrane region sequence of the B1 subfamily receptor, and its N-terminal extracellular region has multiple adhesion factor domains. The 33 receptors of the B2 family are independently grouped into a new subfamily, named adhesion G protein-coupled receptor (aGPCR / ADGR), to highlight the dual role of this class of receptors in cell adhesion and signal transduction. aGPCR can be subdivided into ADGRL, ADGRE, ADGRA, ADGRC, ADGRD, ADGRF, ADGRB, ADGRG and ADGRV 9 groups according to the conservation of the transmembrane region amino acid sequence. Like most G protein-coupled receptor family members, ADGRD1 protein is composed of a typical extracellular long N-terminal domain (containing a signal peptide and a perforin / lectin A domain) and an intracellular C-terminal (containing 7 transmembrane regions). Knockout of ADGRD1 will cause changes in bone density in mice. ADGRD1 is found to be an oncogene for various cancers, but its activation and regulation at the molecular level and the related mechanism are still unclear. ADGRD1 The gene may be related to the disease resistance of animals, but the direct effect of the gene on sheep and its mechanism have not been reported. SUMMARY

[0004] The purpose of the present application is to provide a SNP molecular marker related to the anti-pneumonia trait of sheep and application thereof.

[0005] In order to achieve the purpose of the present application, in the first aspect, the present application provides a SNP molecular marker related to the anti-pneumonia trait of sheep, which contains a SNP marker of sheep ADGRD1The nucleotide sequence of the polymorphism of the gene at position 352 of the sequence shown in SEQ ID NO: 1 is T / C.

[0006] Further, the sheep individual with the genotype of TC at the site with the polymorphism has higher anti-pneumonia (such as anti-mycoplasma pneumonia) performance than the sheep individual with the genotype of CC.

[0007] In the present application, the sheep ADGRD1 The reference sequence number of the gene in NCBI is NC_056070.1, ARS-UI_Ramb_v2.0.

[0008] In the second aspect, the present application provides primers for amplifying the molecular marker, including the upstream primer shown in SEQ ID NO: 2 and the downstream primer shown in SEQ ID NO: 3.

[0009] In the third aspect, the present application provides a detection reagent or kit containing the primers.

[0010] In the fourth aspect, the present application provides a method for identifying and breeding an anti-pneumonia (such as anti-mycoplasma pneumonia) sheep strain, comprising:

[0011] 1) extracting total DNA of the sheep to be tested;

[0012] 2) using the primers shown in SEQ ID NO: 2-3 to perform PCR amplification with the DNA as a template;

[0013] 3) analyzing the PCR amplification product.

[0014] Preferably, the PCR reaction system is: 2 × Phanta Max Master Mix 12.5 μL, DNA template 50-100 ng, 10 μM of each of the upstream and downstream primers 1 μL, and ddH2O supplemented to 25 μL.

[0015] Preferably, the PCR reaction program is: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles; and 72℃ final extension for 5 min.

[0016] Further, step 3) comprises: performing sanger sequencing on the amplification product to obtain the genotype of the site with the polymorphism, and the sheep individual with the genotype of TC has higher anti-pneumonia performance than the sheep individual with the genotype of CC.

[0017] In the fifth aspect, the present application provides any of the following applications of the molecular marker or the detection reagent thereof:

[0018] (1) for early prediction of anti-pneumonia (such as anti-mycoplasma pneumonia) sheep;

[0019] (2) Sheep molecular marker assisted breeding.

[0020] By the above technical solution, the present application has at least the following advantages and beneficial effects:

[0021] The present application first finds that ADGRD1 a SNP site on the gene is significantly related to the sheep resistance to mycoplasma pneumonia, which can be used as a molecular marker for the sheep resistance to mycoplasma pneumonia, and the site is used as a target for breeding sheep with improved disease resistance. The sheep individuals identified by the method have relatively strong resistance to mycoplasma pneumonia, and can be used for breeding new sheep strains with resistance to mycoplasma pneumonia. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 The figure is a PCR amplification result of the target SNP site in the preferred embodiment of the present application. The leftmost band is DNA Marker, and the remaining bands are PCR amplification bands of sheep DNA.

[0023] Figure 2 The figure is a PCR amplification result of the target SNP site in the preferred embodiment of the present application. The leftmost band is DNA Marker, and the remaining bands are PCR amplification bands of sheep DNA. DETAILED DESCRIPTION

[0024] The present application aims to provide a major gene site for screening Chinese local sheep resistance to mycoplasma pneumonia and a corresponding detection method.

[0025] The present application also provides a sheep ADGRD1 Gene SNP molecular marker and its application in sheep breeding.

[0026] The present application adopts the following technical solution:

[0027] The present application provides a method for breeding sheep with high resistance to mycoplasma pneumonia, which detects the genotype of the gene at position 46115517 of sheep chromosome 17, and the reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1. The individual with genotype TC has higher resistance to mycoplasma pneumonia than the individual with genotype CC.

[0028] The present application also provides the application of the substance for detecting the genotype of the SNP site in sheep resistance to mycoplasma pneumonia, and the SNP site is located at position 46115517 of sheep chromosome 17, and is located at position 352 of the nucleotide sequence described in SEQ ID NO: 1, and has T / C polymorphism (n=t or c).

[0029] Furthermore, the substance is a primer pair, the nucleotide sequence of which is shown in SEQ ID NO:2-3.

[0030] The present invention also provides a primer pair, the nucleotide sequence of which is shown in SEQ ID NO:2-3.

[0031] The present invention also provides a kit containing the primer pair described above.

[0032] This invention was first discovered in ADGRD1 A gene SNP is found that is significantly associated with the trait of resistance to mycoplasma pneumonia in sheep. This SNP is located at position 46115517 on chromosome 17 of sheep and has T / C polymorphism. When the genotype of this SNP locus is TC, it has better resistance to mycoplasma pneumonia than CC and can be used as a molecular marker for the trait of resistance to mycoplasma pneumonia in sheep.

[0033] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0034] Example 1 ADGRD1 Discovery of gene SNP molecular markers

[0035] By resequencing 538 Hu sheep individuals tested positive for mycoplasma pneumoniae pneumonia, and combining this with data on the viral load of Mycoplasma pneumoniae in sheep nasal swabs, genome-wide association studies were used to locate the pathogens in sheep. ADGRD1 Gene( Figure 1 ).exist ADGRD1 A gene SNP is found that is significantly associated with the trait of resistance to mycoplasma pneumoniae in sheep. This SNP is located at position 46115517 on chromosome 17 of sheep (reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1) and has T / C polymorphism. When the genotype of this SNP locus is TC, it has better resistance to mycoplasma pneumoniae than CC and can be used as a molecular marker for the trait of resistance to mycoplasma pneumoniae in sheep.

[0036] Example 2 Detection of SNP molecular markers

[0037] The SNP molecular marker detection method provided in this embodiment includes:

[0038] (1) The SNP is located at position 352 of the nucleotide sequence shown in SEQ ID NO:1. Based on the upstream and downstream sequences of this SNP site, specific primers for amplifying this fragment were designed:

[0039] Upstream primer ADGRD1F1: 5'- GAAGTCCTGCCAACACAGGAAT -3' (SEQ ID NO: 2)

[0040] Downstream primer ADGRD1R1: 5'- AGGTGACAGAGAGCCACTTGT -3' (SEQ ID NO: 3)

[0041] (2) PCR amplification was performed on the sheep DNA sample using the specific primers of (1) to obtain an amplified product containing the mutation, and the amplified product was 563 bp (T>C mutation) Figure 2 The sequence is as follows (the 352nd base is a mutation sequence), which is a T>C mutation: 5'- GAAGTCCTGCCAACACAGGAATCACCGTTTTACTTACTTCTTACTTGTTCCATAACTGTCCATGGCAAAGACTATTGAAATGATACAGATCAGAAGAGGAAAACCTGCAGAAAATGAGAGCAGAGAACCATATTAGCGCCAGTCTCTTTTGATGCATTTATTCATTTCATACCTGATGGATACAAAAATCTGTGCTGAGTGCTGAGGGCACAGAACAGCCTCTAGGCTCCAAGGACTTCGAGTCTAAACAAAGAGATAACACACGGGTGCATTTTAGGGCAGATCCGTTATGAATCTATTTTATATCTGAAAACAATCGCTTCTGGCTGCTCAGAAAGCAGCCGTGCATCCNCCGGGCCTCTTAACTGATCAGTGCTCTGAACACGGGGTCTCCCTCTGCTCCCTTGCAAGGAAGGGACGGTGGGGGGGTGCGGAGACAGCAAGGGGTCCCTTCCACCCACTGACCCTCCCCTCCAGAAGAAAGGGCTCCCCACCAGGAAACTGCACTTGGCAGATTCTGACGGGAAAAGGGTCGGGGGAATACAAGTGGCTCTCTGTCACCT-3' (SEQ ID NO: 1).

[0042] The amplification system is shown in Table 1:

[0043] Table 1 ADGRD1 amplification system

[0044]

[0045] 2 x Phanta® Max Master Mix was performed with high-fidelity PCR enzyme from Nanjing NorgenBiotek Co., Ltd., item number P525-02.

[0046] The amplification conditions were as follows: amplification was performed using a PCR amplifier, the first stage: 95 °C pre-denaturation for 5 min; the second stage: 95 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 30 s, 34 cycles; the third stage: 72 °C terminal extension for 5 min, 4 °C storage. The gel electrophoresis diagram of the amplification product is shown in FIG. 2. Figure 2

[0047] (3) The amplification product was subjected to sanger sequencing to obtain the genotype of the SNP site.

[0048] Example 3 Verification of SNP molecular marker

[0049] The genomes of 127 sheep (variety: Hu sheep) were amplified, and the amplification primer, amplification condition, and amplification system were the same as in Example 2. The results after sequencing of the PCR product are shown in Table 2. Five sheep were heterozygous individuals (genotype: TC) containing the SNP site, and 122 were homozygous mutant individuals (genotype: CC). No wild-type individual with genotype TT was found.

[0050] Table 2 Genotyping results of different genotypes

[0051]

[0052] The CT values of all individuals in the detection of mycoplasma pneumoniae were compared (wherein the CT value exceeding 32 was negative). The CT value size reflected the copy number of mycoplasma pneumoniae genome in sheep.

[0053] The comparison results are shown in Table 3. The CT value of the heterozygous individual containing the molecular marker was higher than that of the homozygous individual, i.e., the copy number of mycoplasma pneumoniae genome was lower, which had a significant difference, indicating that the mycoplasma pneumoniae load in the individual with genotype TC was low, and the individual had stronger resistance to mycoplasma pneumoniae.

[0054] Statistical analysis was performed on the mycoplasma quantification results of Hu sheep with different genotypes, and the results are shown in Table 3.

[0055] Table 3 Quantification results of sheep mycoplasma of different genotypes and statistical analysis

[0056]

[0057] Note: The same group of different shoulder marks in small letters indicates a significant difference (P < 0.05).

[0058] ​From the above experimental results, it can be seen that the 46115517 locus of sheep chromosome 17 (reference genome version ARS-UI_Ramb_v2.0, GCF_016772045.1) has a T / C polymorphism, and there are two genotypes of CC and TC in sheep. When the genotype of the SNP site is TC, the copy number of mycoplasma in sheep is significantly reduced, and sheep with genotype TC have better resistance to mycoplasma pneumonia than sheep with genotype CC, which can be used as a molecular marker for sheep resistance to mycoplasma pneumonia.

[0059] Although the present application has been described in detail with general description and specific embodiments above, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of protection required by the present application.

Claims

1. SNP molecular markers associated with pneumonia resistance in Hu sheep, characterized in that, The sequence of the molecular marker is shown in SEQ ID NO:1, wherein the polymorphism of the base at position 352 is T / C; The pneumonia in question is mycoplasma pneumonia.

2. The molecular marker according to claim 1, characterized in that, Hu sheep individuals with the genotype TC at the aforementioned polymorphic site exhibit higher resistance to pneumonia than Hu sheep individuals with the genotype CC.

3. A method for identifying and breeding pneumonia-resistant Hu sheep breeds, characterized in that, include: 1) Extract total DNA from the sheep to be tested; 2) Using DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO:2-3; 3) Analyze the PCR amplification products. The Hu sheep individuals with the genotype TC at the polymorphic site of the SNP molecular marker described in claim 1 have higher anti-pneumonia performance than the Hu sheep individuals with the genotype CC. The pneumonia in question is mycoplasma pneumonia.

4. The method according to claim 3, characterized in that, The PCR reaction system consisted of: 12.5 μL of 2 × Phanta Max MasterMix, 50-100 ng of DNA template, 1 μL each of 10 μM upstream and downstream primers, and ddH2O to a final volume of 25 μL.

5. The method according to claim 3, characterized in that, The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles; 72℃ final extension for 5 min.

6. The method according to claim 3 or 4, characterized in that, Step 3) includes: performing Sanger sequencing on the amplified products to obtain the genotype of the polymorphic site.

7. Any of the following applications of the molecular marker or its detection reagent as described in claim 1 or 2: (1) Used for early prediction of pneumonia resistance in Hu sheep; (2) Used for marker-assisted breeding of pneumonia resistance in Hu sheep; The pneumonia in question is mycoplasma pneumonia.

Citation Information

Patent Citations

  • A method for screening genotypes of resistance to Mycoplasma pneumoniae in sheep.

    CN102277425A

  • Molecular marker-assisted breeding method for Tibetan sheep with high disease resistance

    CN118813813A