A strain of **Phlebiopsis pilatii** and its applications
By providing Pilat HE39 and optimizing its culture conditions, the problem of low degradation rate of combustibles in forest land in the prior art is solved, efficient degradation of lignin and cellulose is achieved, and forest fire prevention capabilities are improved.
Patent Information
- Application Number
- CN202411792677.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-07
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-12-07
AI Technical Summary
The prior art has differences in the degradation of lignin or cellulose, and there has been little research in the field of forest fire prevention, making it difficult to find suitable strains to improve the degradation rate of combustibles in forest land.
A strain of Phlebiopsis pilatii HE39 is provided. By optimizing the culture medium components and fermentation conditions, the laccase, lignin peroxidase and manganese peroxidase activities of the strain are improved, thereby improving the degradation ability of lignin and cellulose.
This strain significantly improved the weight loss rate and lignin degradation rate of forest combustibles, and has good application prospects in reducing the load of ground-covered combustibles and improving forest fire protection capabilities.
Smart Images

Figure CN119432622B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a strain of **Pseudoschizophyllum piratii** and its application. Background Art
[0002] Surface litter is the main combustible forest ground cover, and lignin is the main component of forest ground cover combustibles. The degradation process of forest ground cover combustibles depends on the catalysis of the complex lignin-degrading enzyme system composed of extracellular redox enzymes secreted by lignin-degrading fungi, such as laccase (Lac), lignin peroxidase (LiP), and manganese peroxidase (MnP). Among them, basidiomycetes such as white rot fungi have a relatively strong ability to degrade lignin. There are significant differences in the lignin degradation ability among different strains, which is also closely related to the growth conditions of the strains.
[0003] Kang Yue et al. screened a strain of **Aspergillus nidulans** from garden waste. Through solid-state fermentation experiments, it had a good lignin degradation effect on the common garden waste Euonymus japonicus, Sabina chinensis, and Forsythia suspensa branches and leaves in Beijing, and the lignin degradation rate increased by 15.77%-29.90% compared with the control (Kang Yue, Li Suyan, Sun Xiangyang, et al. Screening, identification and ability research of lignin-degrading fungi in garden waste [J]. Forest Research, 2019, 32(3): 80-87.). Zhang Fangfang et al. screened 1 strain of **Trametes suaveolens** and 1 strain of **Piptoporus subfuscus** from 16 strains of white rot fungi, and the lignin degradation rates for corn straw reached 13.60% and 21.87% respectively (Zhang Fangfang, Zhang Tong, Dai Dan, et al. Screening of highly efficient lignin-degrading bacteria and their degradation effect on corn straw [J]. Mycosystema, 2021, 40(7): 1869-1880.). Yang Li et al. determined the optimal culture time, temperature, dissolved oxygen, inoculum amount, and pH and other culture conditions for the enzyme production activity of the **Trichoderma atroviride** Z-1 strain with significant lignin-degrading enzyme activity through liquid fermentation research (Yang Li, Sun Xiaodong, Li Linlin, et al. Screening of lignin-degrading enzyme-producing Trichoderma strains and their enzyme production characteristics [J / OL]. Mycosystema, 1-9 [2024-08-02]. https: / / doi.org / 10.13346 / j.mycosystema.240032.).
[0004] Note: The scientific names in the text are italicized according to biological naming conventions. If there are specific requirements not to italicize, please adjust according to the actual situation.The application of lignin-degrading fungi can improve the lignin degradation rate, and optimizing the culture conditions of the strains can further improve the enzyme production activity of the strains, thereby promoting the degradation of lignin. However, how to obtain suitable strains is the key problem, and there is currently no report on the degradation of forest tree lignin or cellulose by Phlebiopsis pilatii. The research on lignin biodegradation at home and abroad mainly focuses on the fields of the paper industry, biocomposting, environmental protection, and the feed and food industries, and less research has been carried out in the field of forest fire prevention. In the forestry field, due to the differences in tree species, the lignin degradation ability of lignin-degrading strains for different forest trees will also be different. Summary of the Invention
[0005] In view of the problems existing in the prior art, the present invention provides a strain of Phlebiopsis pilatii and its application. The strain provided by the present invention can be used for degrading lignin and cellulose, preparing preparations for degrading lignin and / or cellulose, etc., has good degradation ability for lignin / cellulose in ground cover combustibles, has good laccase activity, lignin peroxidase and manganese peroxidase activities, and can increase the weight loss rate of forest land combustibles.
[0006] The technical solution of the present invention to solve the above technical problems is as follows:
[0007] The present invention provides a strain of Phlebiopsis pilatii with the strain name of Phlebiopsis pilatii HE39, and the preservation number is CGMCC No. 41168. It was preserved in the China General Microbiological Culture Collection Center (CGMCC) on February 5, 2024, and the preservation address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China.
[0008] The present invention has carried out research on the screening of fungi with the ability to degrade lignin in forest ground cover combustibles and preliminarily optimized the components of its culture medium, providing a basis for expanding new ways to reduce the load of ground cover combustibles by applying lignin-degrading strains. Through research, it is found that the strain HE39 provided by the present invention has good degradation ability for lignin and cellulose in ground cover combustibles, has good laccase activity, lignin peroxidase and manganese peroxidase activities, and can increase the weight loss rate of forest land combustibles.
[0009] The present invention provides a fermentation method for the above strain HE39, including the following steps: inoculating Phlebiopsis pilatii HE39 into a culture medium for fermentation culture.
[0010] Further, in the culture medium, the carbon source is selected from one or more of sucrose, corn flour, soluble starch, and glucose.
[0011] Further, in the culture medium, the nitrogen source is selected from one or more of tryptone, soybean powder, yeast powder, and malt extract powder.
[0012] Further, in the culture medium, the inorganic salts are selected from one or more of calcium chloride, sodium chloride, magnesium sulfate, and potassium dihydrogen phosphate.
[0013] Preferably, in the culture medium, the carbon source is sucrose, the nitrogen source is soybean powder, and the inorganic salt is calcium chloride.
[0014] Further, in the culture medium, the content of the carbon source is 10.0 g / L.
[0015] Further, in the culture medium, the content of the nitrogen source is 20.0 g / L.
[0016] Further, in the culture medium, the content of the inorganic salts is 3.0 g / L.
[0017] Using the above culture medium is beneficial to improving the enzyme production activity of strain HE39.
[0018] The present invention provides a bacterial agent, including the above-mentioned Phlebiopsis pilatii HE39 and / or the supernatant of Phlebiopsis pilatii HE39.
[0019] The bacterial agent provided by the present invention has good degradation ability for lignin in ground cover combustibles, has good laccase activity, lignin peroxidase and manganese peroxidase activities, and can increase the weight loss rate of forest combustibles.
[0020] The above-mentioned bacterial agent can be the supernatant of HE39, and can be prepared by the following method: inoculating Phlebiopsis pilatii HE39 onto a PDA plate, culturing at 28°C, taking the mycelial cake and inoculating it into a PDB medium, culturing at a constant temperature and oscillating at 28°C and 160 rpm for 7 d, centrifuging, and taking the supernatant.
[0021] The present invention provides a method for preparing the supernatant of HE39, including the following steps: inoculating Phlebiopsis pilatii HE39 onto a PDA plate for culture, taking the mycelial cake and inoculating it into a PDB medium, culturing at a constant temperature and oscillating, centrifuging, and taking the supernatant.
[0022] Further, the temperature for culturing on the PDA plate is 28°C.
[0023] Further, the conditions for culturing at a constant temperature and oscillating include: culturing at a constant temperature and oscillating at 28°C and 160 rpm for 7 d.
[0024] The present invention provides a method for preparing the above-mentioned microbial agent, which includes the following steps: inoculating the above-mentioned Phlebiopsis pilatii into a fermentation medium and performing fermentation culture.
[0025] The fermentation medium can refer to the medium used in the fermentation method of HE39.
[0026] The present invention provides the application of the above-mentioned Phlebiopsis pilatii HE39 in any one of (1) to (5);
[0027] (1) Degrading lignin and / or cellulose;
[0028] (2) Preparing a preparation for degrading lignin and / or cellulose;
[0029] (3) Degrading ground cover combustibles;
[0030] (4) Increasing the activity of lignin-degrading enzymes;
[0031] (5) Increasing the weight loss rate of forest land combustibles.
[0032] The present invention provides the application of the above-mentioned microbial agent in any one of (1) to (4);
[0033] (1) Degrading lignin and / or cellulose;
[0034] (2) Degrading ground cover combustibles;
[0035] (3) Increasing the activity of lignin-degrading enzymes;
[0036] (4) Increasing the weight loss rate of forest land combustibles.
[0037] The strain and microbial agent provided by the present invention can have good degradation ability for lignin and cellulose in ground cover combustibles, have good laccase activity, lignin peroxidase and manganese peroxidase activities, and can increase the weight loss rate of forest land combustibles.
[0038] The present invention provides a method for using the above-mentioned strain or microbial agent, which includes the following steps: treating lignin or a substance containing lignin with the above-mentioned Phlebiopsis pilatii HE39 or the above-mentioned microbial agent.
[0039] The present invention provides a method for using the above-mentioned strain or microbial agent, which includes the following steps: treating cellulose or a substance containing cellulose with the above-mentioned Phlebiopsis pilatii HE39 or the above-mentioned microbial agent.
[0040] The above method can also be used as a method for degrading lignin / cellulose, a method for degrading ground cover combustibles, a method for increasing the activity of lignin-degrading enzymes, and a method for increasing the weight loss rate of forest land combustibles. Description of the Drawings
[0041] Figure 1 It is the proportion of each genus of fungi.
[0042] Figure 2 The left figure shows the chromogenic reaction of the 2-1-24 bacterial colony on guaiacol-PDA, and the right figure shows the decolorization reaction of the HE-1-3-⑨ bacterial colony on aniline blue-PDA plate.
[0043] Figure 3 It is the degradation effect diagram of the filter paper strip by the HE-1-3-⑨ strain.
[0044] Figure 4 It is the result of the change in the cellulose content of the ground cover combustibles degraded indoors.
[0045] Figure 5 It is the colony growth state of the strain HE-1-3-⑨.
[0046] Figure 6 It is the phylogenetic tree of the lignin-degrading bacterium HE39 based on the rDNA-ITS sequence.
[0047] Figure 7 It is the experimental result of the change in the cellulose degradation rate of the ground cover combustibles under different bacterium agent treatments. Detailed Embodiments
[0048] The principles and features of the present invention are described below in conjunction with the drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.
[0049] Lignin-degrading fungi are widely used in the biodegradation of lignin. To explore the degradation effect of lignin-degrading fungi on forest ground cover combustibles, the ground cover combustibles of broad-leaved Korean pine forest, poplar-birch mixed forest, larch-birch mixed forest, and Korean spruce forest were used as the sources of degradation bacterial strains and degradation test samples, and the mass loss and lignin content of the combustibles after degradation were measured. The results show that: 1 strain of bacteria with good lignin degradation ability for ground cover combustibles was screened out, and it was identified as Phlebiopsis pilatii HE39; this strain first showed strong lignin degradation ability, and the lignin degradation rates of poplar-birch and spruce combustibles after 10 days of treatment were 19.69% and 16.01% respectively, and the weight loss rates of larch-birch and spruce combustibles after 60 days of treatment were 23.00% and 22.00%; sucrose, soybean powder, and calcium chloride were the optimal carbon source, nitrogen source, and inorganic salt for enzyme production by the strain HE39 respectively, and the optimized fermentation medium formula (g / L) was determined: sucrose 10.0, soybean powder 20.0, calcium chloride 3.0, Tween 80 0.5, prepared with water.
[0050] Unless otherwise specified, the experimental methods used in this invention are all conventional methods in the art; the materials, reagents, methods and instruments used are all conventional materials, reagents, methods and instruments in the art, and those skilled in the art can obtain them through commercial channels or prepare them by conventional methods.
[0051] General situation of the research area: The research area is located in the Yitong Forest Pest Natural Enemy Breeding Demonstration Base of Jilin Academy of Forestry Sciences, with geographical location of 124°50′ - 125°46′E and 43°03′ - 43°38′N. It belongs to the continental monsoon climate, with an annual average temperature of 2.8°C, a frost-free period of 120 - 140 days, and an annual average precipitation of 723 mm. The average altitude of the test site is 300 m. The main forest stands include broad-leaved Korean pine (Pinus koraiensis) forest, Manchurian ash (Fraxinus mandshurica) forest, Mongolian oak (Querus mongolica) forest, white birch (Betula platyphylla) forest, aspen (Populus davidiana) forest, larch (Larix gmelinii) forest, miscellaneous tree forest, etc. The soil in the research area is mainly dark brown forest soil.
[0052] The PDA medium is prepared according to the following ratio: 200 g of potato, 20 g of glucose, 20 g of agar, 3 g of KH2PO4, 1.5 g of MgSO4·7H2O, 0.01 g of VB1, and 1000 mL of distilled water.
[0053] PDA - guaiacol medium: Guaiacol is added to the PDA medium, and the final concentration of guaiacol is 0.02% by volume percentage.
[0054] PDA - aniline blue medium: Aniline blue is added to the PDA medium, and the final concentration of aniline blue is 0.1 g / L.
[0055] The PDB medium is prepared according to the following ratio: 200 g of potato, 20 g of glucose, 3 g of KH2PO4, 1.5 g of MgSO4·7H2O, 0.01 g of VB1, and 1000 mL of distilled water.
[0056] The Hutchinson's medium is prepared according to the following ratio: 1.0 g of KH2PO4, 0.1 g of NaCl, 0.3 g of MgSO4·7H2O, 2.5 g of NaNO3, 0.01 g of FeCl3, 0.1 g of CaCl2, 1000 mL of distilled water, and the pH value is 7.2.
[0057] The malt extract medium is prepared according to the following ratio: 10.0 g of glucose, 20.0 g of malt extract, 0.5 g of Tween 80, 3.0 g of KH2PO4, and 1000 mL of distilled water.
[0058] The basal medium was prepared in the following proportions: 10.0 g of glucose, 20.0 g of malt extract powder, 3.0 g of KH2PO4, 0.5 g of Tween 80, 1000 mL of distilled water, and the natural pH.
[0059] The CMC-Na medium was prepared in the following proportions: 10.0 g of carboxymethyl cellulose sodium, 4.0 g of ammonium sulfate, 2.0 g of potassium dihydrogen phosphate, 0.5 g of magnesium sulfate heptahydrate, 10.0 g of peptone, 15.0 g of agar, and 1000 mL of distilled water.
[0060] In the examples, both primer ITS1 and primer ITS4 were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0061] In the examples, if data statistics and analysis were involved, Excel and Origin software were used to perform statistical analysis on the data.
[0062] The following is an introduction through specific examples.
[0063] Example 1
[0064] Plot setting and sample collection: In four forest stands including broad-leaved Korean pine forest, Populus davidiana-Betula platyphylla mixed forest, Betula platyphylla-Larix gmelinii mixed forest, and pure Picea koraiensis forest in the study area, representative sites were selected as experimental plots according to indicators such as altitude, slope aspect, slope gradient, and slope position. Five 1 m×1 m subplots were randomly set in each forest type plot, and in the summer of 2022, the undecomposed layer and semi-decomposed layer of ground cover combustibles were collected as the source of degradation strains and degradation test samples.
[0065] Strain isolation and identification: After moderately crushing the collected ground cover combustible samples from different decomposition layers, they were placed in sterile water and shaken evenly. The mother liquor was diluted into a series of concentration gradients (i.e., the mother liquor was diluted 10, 20, and 30 times into a series of concentration gradients), and the diluted solution was spread on PDA medium plates containing streptomycin (200 μg / L) and cultured in a constant temperature incubator at 28°C for 5 d. Single colonies with significantly different morphological characteristics were picked, and after repeated isolation and purification, pure strains were obtained and numbered for preservation. Fungal genomic DNA was extracted, and PCR amplification was performed using primer ITS1 (TCCGTAGGTGAACCTGCGG, shown in SEQ ID NO:1) and ITS4 (TCCTCCGCTTATTGATATGC, shown in SEQ ID NO:2). After 1% agarose gel electrophoresis, the unpurified products were entrusted to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. According to the ITS sequencing results, sequence alignment was performed using Blast on NCBI, and combined with the existing relevant ITS sequences in GenBank, a phylogenetic tree was constructed using MEGA5.1 software.
[0066] A total of 62 fungal strains were isolated by the above method, and the isolated strains were classified and identified by combining morphological observation and ITS-rDNA sequencing. After identification, they were classified into 21 species belonging to 18 genera: Aspergillus, Cerrena, Coniochaeta, Coniothyrium, Discosia, Fusarium, Phoma, Paraconiothyrium, Paramyrothecium, Peniophora, Pestalotiopsis, Phlebiopsis, Plectosphaerella, Trichoderma, Microdiplodia, Myrothecium, Schizophyllum and Letendraea. Among them, Paraconiothyrium was the dominant genus, accounting for 55% of the total number of isolated strains. Followed by Coniothyrium and Pestalotiopsis, accounting for 11% and 6% of the total number of isolated strains respectively ( Figure 1 ).
[0067] Example 2
[0068] 2.1 Screening of lignin-degrading fungi: One strain was selected from each of the 21 identified species as a representative strain for screening lignin-degrading fungi. The guaiacol plate colorimetric method and aniline blue plate decolorization method were used to evaluate whether the strains had the ability to secrete extracellular lignin-degrading enzymes. A fungal cake was prepared at the edge of the pure strain colony and inoculated in the center of the PDA-guaiacol plate. After culturing at a constant temperature of 28 °C for 5 days, the colonies with obvious color development circles around were selected, and the diameters of the colonies and color development circles on the PDA-guaiacol medium were measured with a vernier caliper to screen out the strains with a larger ratio of color development circle to colony diameter. The selected strains were inoculated on the PDA-aniline blue plate and cultured at a constant temperature of 28 °C. The formation time of the decolorization circle was observed and recorded, and the diameters of the colonies and decolorization circles on the PDA-aniline blue medium were measured with a vernier caliper.
[0069] The guaiacol colorimetric method can better reflect the laccase activity of the strains, while the decolorization of aniline blue is related to the production of lignin peroxidase and manganese peroxidase. Through observation and calculation, among the 18 genera, only the strains of Phlebiopsis, Cerrena, Paraconiothyrium, Coniothyrium, Letendraea and Peniophora can oxidize guaiacol to produce color development circles ( Figure 2), among which, the chromogenic circle diameters of 9 strains of fungi, namely HE-1-3-⑨, YM-1-3-①5, YM-3-4-⑥, 2-1-24, YM-1-4-⑤, 2-1-36, Red 1-3-4-⑥, YY-3-3-③, and 1-2-25, are relatively large. As shown in Table 1, their φC / φF values are all greater than 1. It is speculated that they may be lignin-degrading fungi with relatively high laccase activity. Among them, 4 strains of fungi, namely Red 1-3-4-⑥, HE-1-3-⑨, 2-1-24, and YM-1-4-⑤, can also decolorize aniline blue( Figure 2 ), that is, they can produce peroxidase. It is preliminarily judged that these 4 strains of bacteria are lignin-degrading fungi.
[0070] Table 1 Results of guaiacol plate chromogenic reaction and aniline blue plate decolorization
[0071]
[0072] Note: φF: colony diameter; φC: chromogenic circle diameter; φD: decolorization circle diameter
[0073] 2.2 Screening of cellulose-degrading fungi
[0074] (1) The Congo red staining method was used to screen cellulose-degrading strains. The purified strains were inoculated on the CMC-Na medium plate in a triangular pattern and cultured at a constant temperature of 28 °C. After the strains grew colonies on the plate, Congo red reagent was added to the medium for staining, and then 1 mol / L NaCl solution was added for decolorization. The colonies with hydrolysis zones were picked, and the hydrolysis zone and colony diameters on the CMC-Na medium were measured with a vernier caliper. Those with a larger ratio were selected for the filter paper strip degradation test to verify the actual degradation ability of the cellulose-degrading strains.
[0075] Experimental results: The identified strains were inoculated on the CMC-Na plate for culture. After staining and decolorization, the hydrolysis zones of 6 strains from the genera Coniochaeta, Pestalotiopsis, Aspergillus, Coniothyrium, Phlebiopsis, and Cerrena were obvious, and their φH / φF values were greater than 1. They were HE-1-3-⑨, 1-1-41, 1-2-1, 2-1-24, YY-3-3-⑥, and 2-2-32 respectively. It was preliminarily judged that these 6 strains of bacteria were cellulose-degrading fungi. The sizes of the colonies and their surrounding hydrolysis zones are shown in Table 2. The size of the hydrolysis zone is related to the amount and activity of cellulase produced by the fungi. The larger the hydrolysis zone, the stronger the ability of the strain to degrade cellulose. Among them, the φH / φF value of strain HE-1-3-⑨ was significantly higher than that of other tested strains, indicating that it had the greatest potential to produce cellulase.
[0076] Table 2 CMC-Na plate staining results
[0077]
[0078] Note: φH: diameter of hydrolysis zone
[0079] (2) Filter paper strip degradation test, including the following steps: Prepare a bacterial cake at the edge of the colony of the selected strain, inoculate it into PDB medium, and culture it at a constant temperature of 28 °C and 160 rpm on a constant temperature shaker for 5 d to obtain a strain seed solution, and obtain a bacterial suspension after centrifugation. Add filter paper strips to Hutchinson's inorganic salt medium, inoculate 1 mL of the bacterial solution, and culture it at a constant temperature of 28 °C and 160 rpm on a constant temperature shaker. Regularly observe the degradation of the filter paper strips, and judge the degradation ability of cellulose-degrading bacteria according to the degree of breakage of the filter paper strips.
[0080] 7 - 15 d after inoculation with each strain, the filter paper strips showed ulceration. The degradation effect diagram of the filter paper strips by strain HE-1-3-⑨ is as Figure 3 shown, indicating that strain HE-1-3-⑨ has the ability to degrade cellulose.
[0081] Based on the above results, it can be seen that strain HE-1-3-⑨ has the ability to degrade both lignin and cellulose.
[0082] Example 3
[0083] Ground cover fuel degradation test: Inoculate the strain screened in Example 2 onto a PDA plate and culture it at a constant temperature of 28 °C for 7 d. Use a puncher (φ = 6 mm) to prepare a bacterial cake in the area where the mycelium grows vigorously. Transfer the bacterial cake into a triangular flask containing 100 mL of PDB medium, and culture it at a constant temperature of 28 °C and 160 rpm on a constant temperature shaker for 7 d. Centrifuge at 4000 rpm for 10 min, and the supernatant is the bacterial suspension of the lignin-degrading strain.
[0084] Dry the ground cover fuel sample in the undecomposed layer in Example 1 to a constant weight, and cut it into small pieces. Weigh 2 g of the small piece sample and place it in a 50 mL triangular flask containing 20 mL of malt extract medium, inoculate 600 μL of the bacterial solution (i.e., the bacterial suspension of the lignin-degrading strain prepared by the above method), for measuring the mass loss of the fuel and the lignin content during the degradation process. Prepare another triangular flask containing fuel samples of different forest types, and add sterile water equal to the amount of the bacterial solution as a control. Place the above triangular flasks in an artificial incubator and culture them at 25 °C and a humidity of 80%. Start sampling from the 10th d after inoculation. Each time, take 3 triangular flasks treated with different bacterial solutions to measure the mass loss, lignin content, and cellulose content of the samples, and sample once every 10 d. Take the last sample on the 60th d.
[0085] Take out the degraded ground cover fuel sample from the triangular flask, remove the surface mycelium with tweezers, dry it to a constant weight, and calculate the mass loss rate of the degraded sample.
[0086]
[0087] Qingdao Standard Testing Group Co., Ltd. used the double-antibody sandwich ELISA method to determine the lignin content and cellulose content of the ground cover combustible samples during the degradation process, and calculated the lignin degradation rate and cellulose degradation rate.
[0088]
[0089] In the research, it was found that YM-1-4-⑤ had a slow growth rate and was not suitable for application in degradation. Therefore, considering the growth rate of the strains, three strains, namely Red 1-3-4-⑥, HE-1-3-⑨, and 2-1-24, were selected to carry out the degradation test of ground cover combustibles. As can be seen from Table 3, during the 60 days of degradation, the mass of the ground cover combustibles in each forest stand type showed a fluctuating downward trend as a whole. The weight loss was more obvious in the first 10 days, with a maximum of 25.17%. There were differences in the weight loss rates of combustibles in different forest stand types. The overall weight loss rates of the combustibles in Larch-Birch, Spruce, and Poplar-Birch were higher than those of the combustibles in the Broad-leaved Korean Pine Forest. After 60 days of degradation, the maximum weight loss rates of the combustibles in Larch-Birch, Spruce, and Poplar-Birch reached 23.00%, 22.00%, and 26.33% respectively, while the maximum weight loss rate of the combustibles in the Broad-leaved Korean Pine Forest was only 11.83%. Among them, the highest weight loss rates of the combustibles in Larch-Birch and Spruce both occurred after degradation by the strain HE-1-3-⑨.
[0090] Table 3 Changes in the mass loss of ground cover combustibles in different forest types during degradation
[0091]
[0092] During the degradation process, the lignin content in the ground cover combustibles showed significant differences under different strain treatments (Table 4). In the first 10 days, except for the combustibles in the broad-leaved Korean pine forest, the lignin content in the combustibles of other forest stand types decreased rapidly, which was consistent with the results of the combustible mass loss in the same stage. The weight loss of the combustible samples might be partly attributed to the degradation of lignin. Among them, strain HE-1-3-⑨ showed the strongest lignin degradation ability first. The highest degradation rates of lignin in the combustibles of poplar-birch and spruce both occurred after degradation by strain HE-1-3-⑨, reaching 19.69% and 16.01% respectively. In the stage of 10d - 20d, the lignin content in the spruce combustibles degraded by strain Red 1-3-4-⑥ and HE-1-3-⑨ continued to decrease, while the lignin content in the broad-leaved Korean pine combustibles in the treatment group of strain 2-1-24 increased, showing an enrichment phenomenon. Considering the entire degradation process, the lignin degradation effects in the spruce combustibles and poplar-birch combustibles were better than those in the larch-white birch and broad-leaved Korean pine combustibles. After 60 days, the highest degradation rates were 23.42% and 23.28% respectively, and strains Red 1-3-4-⑥ and HE-1-3-⑨ showed strong lignin degradation abilities. Considering the speed of exerting the lignin degradation ability, strain HE-1-3-⑨ was determined as the target strain.
[0093] Table 4 Changes in lignin content of ground cover combustibles in different forest types during the degradation process
[0094]
[0095] The changes in the cellulose content in the ground cover combustibles of each forest stand type are as Figure 4 shown. Similar to lignin, the cellulose content decreased significantly from 0 to 10 days. Among them, the combustibles in the broad-leaved Korean pine forest had the largest decrease, and the degradation rate was about 1.79 - 2.83 times that of other combustibles. By the end of the indoor degradation, compared with other strains, strain HE-1-3-⑨ showed higher activity and the best degradation effect on cellulose, with a degradation rate of about 16.79% - 21.90%. After 60 days of degradation, when comparing different forest stand types, the cellulose content in the combustibles of the broad-leaved Korean pine forest decreased the most and had the highest degradation degree.
[0096] Based on the results of the indoor degradation test of the ground cover combustibles, strains Red 1-3-4-⑥ and HE-1-3-⑨ showed relatively high lignin degradation abilities, and strain HE-1-3-⑨ had relatively strong cellulose degradation ability. Although the previously screened strain 2-1-24 had the ability to degrade both lignin and cellulose, its effect was not good when using the ground cover combustibles as the degradation substrate. Therefore, finally, strains Red 1-3-4-⑥ and HE-1-3-⑨ were selected as the source strains for the preparation of the microbial agent and applied to the field degradation test.
[0097] Example 4 Strain Identification
[0098] After culturing strain HE-1-3-⑨ on PDA medium at a constant temperature of 28 °C for 7 days, the surface of the colony of strain HE-1-3-⑨ was white and villous, the hyphae were slender, and the arrangement was relatively uniform and loose( Figure 5 ).
[0099] According to the ITS sequencing results, the ITS sequence of strain HE-1-3-⑨ was aligned with the type strains and closely related strains in GenBank, and a phylogenetic tree was constructed using MEGA 5.1 software. The results of the phylogenetic tree analysis are shown in Figure 6 , and strain HE-1-3-⑨ was identified as Phlebiopsis pilatii and named HE39.
[0100] On February 5, 2024, strain HE-1-3-⑨ was deposited in the China General Microbiological Culture Collection Center (CGMCC). The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China. The strain name is HE39, and the recommended taxonomic name belongs to Phlebiopsis pilatii. The deposit number is CGMCC No. 41168.
[0101] Example 5
[0102] Optimization of medium components: The following components were respectively selected as the test carbon source, nitrogen source, and inorganic salt to replace glucose, malt extract powder, and potassium dihydrogen phosphate in the basal medium.
[0103] The specific experimental method includes the following steps:
[0104] Inoculate strain HE39 onto a PDA plate and culture it at a constant temperature of 28 °C for 7 days. Use a punch (φ = 6 mm) to prepare a mycelial cake in the area where the mycelia grow vigorously. Transfer the mycelial cake into a triangular flask containing 100 mL of PDB medium and culture it at a constant temperature of 28 °C and 160 rpm for 7 days. Centrifuge at 4000 rpm for 10 min, and the supernatant is the lignin-degrading strain suspension, which is used as the seed liquid for subsequent experiments. Transfer the seed liquid into a 250 mL triangular flask containing 50 mL of the corresponding medium, and the inoculation amount is 3% (volume percentage). Culture it at 28 °C and 180 rpm for 3 days. After centrifugation, take the supernatant to measure the enzyme activities of LiP, MnP, and Lac. The LiP enzyme activity was measured by Qingdao Kechuang Quality Inspection Co., Ltd. using an ELISA kit; the MnP enzyme activity was measured by Qingdao Kechuang Quality Inspection Co., Ltd. using an ELISA kit; the Lac enzyme activity was measured by Qingdao Kechuang Quality Inspection Co., Ltd. using an ELISA kit.
[0105] Select the best carbon source, nitrogen source, and inorganic salt based on the results of multiple enzyme activity assays as the new fermentation medium formula to provide a source of nutrients for the subsequent preparation of field degradation agents.
[0106] Different carbon sources: Replace glucose in the basal medium with sucrose, corn starch, and soluble starch, respectively.
[0107] Different nitrogen sources: Replace malt extract powder in the basal medium with yeast powder, tryptone, and soybean powder, respectively.
[0108] Different inorganic salts: Replace potassium dihydrogen phosphate in the basal medium with calcium chloride, sodium chloride, and magnesium sulfate, respectively.
[0109] By separately replacing the components of nutrients such as carbon source, nitrogen source, and inorganic salt in the basal medium, analyze the effects of different components on the ability of strain HE39 to produce lignin-degrading enzymes. The results are shown in Table 5. According to the enzyme activity assay results, when sucrose is used as the carbon source, the LiP and MnP of strain HE39 reach the maximum, which are 568.27 U / L and 42.32 U / L, respectively; when soybean powder is used as the nitrogen source, the Lac of strain HE39 reaches the maximum, which is 100.53 U / L; when calcium chloride is used as the inorganic salt, the LiP of strain HE39 has the highest activity. In summary, sucrose, soybean powder, and calcium chloride are the optimal enzyme-producing carbon source, nitrogen source, and inorganic salt for strain HE39, respectively. Based on this, the optimized fermentation medium (g / L) is determined as follows: sucrose 10.0, soybean powder 20.0, calcium chloride 3.0, and Tween 80 0.5. The above formula will be used as the source of nutrients for the subsequent preparation of the agent.
[0110] Table 5 Enzyme production activities of strain HE39 under different medium components
[0111]
[0112] In addition, it was found in the study that the lignin degradation rate sometimes increased during the degradation process, showing an enrichment phenomenon. On the one hand, it may be because lignin, as a difficult-to-degrade substance, forms a barrier structure by binding to other macromolecules such as cellulose in ground cover combustibles, restricting the entry of microorganisms and inhibiting their physiological and metabolic activities. On the other hand, the easily decomposable components (soluble carbon, nitrogen, phosphorus, etc.) in the ground cover combustibles are rapidly lost at the initial stage of degradation, resulting in a rapid decrease in the proportion of easily decomposable components in the combustibles, and an increase in the proportion of difficult-to-degrade components such as lignin, affecting its degradation rate. Therefore, the study of lignin degradation in ground cover combustibles needs to comprehensively consider the influence of other components.
[0113] Lignin-degrading bacteria can be applied in multiple fields. In the agricultural field, through the screening of highly efficient lignin-degrading bacteria and the optimization of enzyme production conditions, they can be applied to the degradation of agricultural production wastes (such as straw) to improve the degradation efficiency. In the livestock industry, lignin-degrading bacteria can be used to break the lignin structure in plant-based feeds, improve the digestion and utilization effect of animals on feeds, and thus reduce feed costs. In the industrial field, lignin-degrading fungi can be used to construct a co-culture system for the biological pretreatment of straw, reduce the structural barrier of lignin biomass, and effectively improve the efficiency of biomass conversion to produce biofuels. In the forestry field, lignin-degrading bacteria can be used to improve soil quality and structure, increase plant growth efficiency, and thus promote the stability of the ecosystem.
[0114] Example 6 Field Degrading Bacterial Agent and Its Preparation Method
[0115] Fermentation medium (g / L): sucrose 10.0, soybean powder 20.0, calcium chloride 3.0, Tween 80 0.5, prepared with water.
[0116] The preparation method of the bacterial agent includes the following steps: Select the screened fungus HE39 as the source strain for preparing the bacterial agent. Open the pure culture strain plate in the sterile operation table, use a sterilized punch (outer diameter 6 mm) to make bacterial cakes in the area with vigorous mycelial growth, inoculate 40 bacterial cakes into a 1000 mL Erlenmeyer flask containing 400 mL of fermentation medium, and incubate at 28 °C and 160 rpm under constant temperature for 5 d. Centrifuge at 4000 rpm for 10 min and take the supernatant to obtain the degrading strain bacterial agent.
[0117] Example 7
[0118] The field degradation test was carried out in the pure forests of Betula platyphylla, Larix olgensis, and the mixed forest of Quercus mongolica - Pinus sylvestris var. mongolica in the Yitong Base of the Jilin Academy of Forestry Sciences. One 10 m × 10 m plot was set for each forest type, and 3 1 m × 1 m subplots were set in each plot. Before the start of the field degradation, collect the ground combustibles in the subplots, dry them to a constant weight, put them into nylon mesh bags, 10.0 g per bag, mark the forest type and sample number on the bag, weigh and record the initial mass, put them back into the subplots, and fix them with metal nets.
[0119] Select the screened degrading fungal strains as the source strains for preparing the microbial agents. Open the pure culture plate of the degrading strains in the sterile operating table, use a sterilized punch (outer diameter 6 mm) to prepare fungal cakes in the area with vigorous mycelial growth, inoculate 40 fungal cakes into a 1000 mL Erlenmeyer flask containing 400 mL of the optimized fermentation medium, add 0.5 g of Tween 80, and culture at a constant temperature of 28 °C and 160 rpm for 5 d to obtain the microbial suspension of the degrading strains, which are bottled and reserved respectively. At three doses (low, medium, and high, 50 mL, 100 mL, and 150 mL respectively), spray the corresponding microbial agents onto the nylon mesh bags in the small quadrats in the way of artificial spraying as evenly as possible so that all the combustibles in the bags can come into contact with the microbial agents. The same treatment is carried out for each standard plot of the three forest types. Collect combustible samples once every 14 d, take 5 bags each time, and sample 6 times in total to measure the cellulose content of the samples. The detection method of the cellulose degradation rate refers to Example 3.
[0120] The field degradation effect of the cellulose of the ground cover combustibles is as Figure 7 shown. With the prolongation of the degradation time, the cellulose degradation rates of the ground cover combustibles of different forest types after being treated with the microbial agent HE39 and the microbial agent H46 (the microbial agent prepared by the method of Example 6 from Red 1-3-4-⑥) all show an increasing trend, and are significantly higher than those of the control group (without using the microbial agent). By the end of the field degradation, the cellulose degradation rates of the combustibles in the birch, larch, and Mongolian oak - Scotch pine forests are 15.29% - 20.59%, 8.66% - 12.68%, and 14.32% - 18.66% respectively, which are 1.74 - 2.69 times, 1.79 - 3.08 times, and 4.01 - 5.53 times higher than those of the control respectively. During the whole degradation process, the degradation effect of the microbial agent HE39 is always better than that of the microbial agent H46; for both microbial agents, the cellulose degradation effect among different doses is high dose > medium dose > low dose > control group.
[0121] Example 8
[0122] The experimental method refers to Example 7. Field degradation effect: The lignin degradation effects of the ground cover combustibles in the birch, larch, and Mongolian oak - Scotch pine forests with the microbial agent applied are all better than those of the control group without the microbial agent applied. After 84 d of field degradation, the highest lignin degradation rate can reach 23.48%.
[0123] Four lignin-degrading fungi were qualitatively screened from the ground cover combustible samples collected in the wild. Through the determination of the mass loss of combustibles and the lignin degradation rate during the ground cover combustible degradation test, the strain HE39 with relatively strong comprehensive lignin degradation ability was finally obtained. Its degradation significantly improved both the mass loss of ground cover combustibles and the lignin degradation rate, indicating that it has certain feasibility and further research and development value to use lignin-degrading fungi to reduce the load of ground cover combustibles. In the present invention, the weight loss rate of the poplar-birch combustibles was the highest, reaching 26.33% after 60 days of degradation; after degradation by HE39, its lignin degradation rate could reach 23.28%, which was higher than that of other strains.
[0124] The lignin-degrading strain HE39 screened in the present invention has a promoting effect on the degradation of lignin in ground cover combustibles. Therefore, in order to achieve the purpose of efficient degradation of ground cover combustibles, other strains with degradation ability can also be introduced to prepare a compound microbial agent in practical applications, and the optimal enzyme production conditions can be explored to achieve a synergistic degradation effect. The present invention can provide a basis for using microorganisms to reduce the load of forest combustibles and lower the forest fire risk level and fire losses.
[0125] The above are only the preferred embodiments of the present invention, and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. A strain of Pseudomonas pilatus, characterized in that: The strain is named Pseudomonas pilatus ( Phlebiopsis pilati ) HE39, the deposit number is CGMCC No. 41168.
2. The fermentation method of Pseudomonas pilatus according to claim 1, characterized in that: The following steps are involved: Pseudomonas pilatus Phlebiopsis pilatii ) HE39 was inoculated into culture medium for fermentation.
3. The fermentation method of Pseudomonas pilatus according to claim 2, characterized in that: The method comprises the following steps: in the culture medium, the carbon source is selected from one or more of sucrose, corn flour, soluble starch and glucose.
4. The fermentation method of Pseudomonas pilatus according to claim 2 or 3, characterized in that: In the culture medium, the nitrogen source is selected from one or more of tryptone, soybean powder, yeast powder and malt extract powder.
5. The fermentation method of Pseudomonas pilatus according to claim 2 or 3, characterized in that: In the culture medium, the inorganic salt is selected from one or more of calcium chloride, sodium chloride, magnesium sulfate and potassium dihydrogen phosphate.
6. The fermentation method of Pseudomonas pilatus according to claim 2 or 3, characterized in that: In the culture medium, the carbon source content was 10.0 g / L, the nitrogen source content was 20.0 g / L, and the inorganic salt content was 3.0 g / L.
7. A bacterial agent, characterized in that: It includes the Pseudomonas pilatris described in claim 1.
8. The method for preparing the bacterial agent according to claim 7, characterized in that: The method comprises the following steps: inoculating the Pseudomonas pilatus described in claim 1 into a fermentation medium and performing fermentation culture.
9. Use of Pseudomonas pilatus according to claim 1 in any one of (1) to (5); (1) Degradation of lignin and / or cellulose; (2) preparing a preparation for degrading lignin and / or cellulose; (3) Degrading combustible materials on forest floor; (4) Producing lignin-degrading enzymes; (5) Increase the weight loss rate of combustible materials in forest land.
10. Use of the bacterial agent according to claim 7 in any one of (1) to (4); (1) Degradation of lignin and / or cellulose; (2) Degrading combustible materials on forest floor; (3) Produce lignin-degrading enzymes; (4) Increase the weight loss rate of combustible materials in forest land.