Microcin C7 efficient expression strain and preparation method thereof

Abstract

The invention discloses a Microcin C7 high-efficiency expression strain and a preparation method thereof. A pCas9-sgRNA integrated vector is used for replacing an RBS region of the strain, so that the binding efficiency of an expression gene mCCA of Microcin C7 and ribosome is enhanced, translation starting variation is reduced, the translation rate is increased, and stable and high-efficiency expression of Microcin C7 can be realized. According to the fermentation culture medium provided by the invention, the corn steep liquor powder is used for replacing part of peptone, the strain fermentation efficiency is high, and the production cost is greatly reduced. The invention also provides a preparation method of the Microcin C7, the heptapeptide with a wider antibacterial spectrum is obtained, the industrial production level of the heptapeptide is improved, the application prospect of the heptapeptide in the fields of feed additives, veterinary drugs, foods and medicines is widened, and an efficient and economic biological antibacterial agent and preservative are provided for the industry.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a Microcin C7 high-efficiency expression strain and a preparation method thereof. Technical Background

[0002] Driven by the current green farming concept of "antibiotic replacement and antibiotic reduction", it is urgent to develop immunomodulatory peptides with strong antibacterial activity to achieve greener and safer feed additives. Microcin C7 is a small peptide composed of 7 amino acid residues (MATGNAD), and its C-terminus is modified with adenosine monophosphate (AMP) by covalent bonds (MATGNAD-AMP). Microcin C7 has strong antibacterial activity against a variety of Gram-negative bacteria and some Gram-positive bacteria. It also has the effects of improving intestinal homeostasis, regulating intestinal microbiota, enhancing immunity and promoting animal growth. The peptide was first discovered in Escherichia coli carrying the Mcc operon plasmid, and was later found in the probiotic Lactobacillus johnsonii. Its synthesis pathway involves multiple gene clusters (mccABCDEF), among which the mccA gene encodes a heptapeptide and the modification gene (mccBCDEF) is responsible for subsequent modification and transportation. As a widely used probiotic, Lactobacillus johnsonii can express a seven-peptide immunomodulator with strong antibacterial activity, so it plays an important role in feed additives. However, the yield of Microcin C7 expressed by Lactobacillus johnsonii is not high, which limits its application in feed.

[0003] We have previously invented a method to improve the expression of Microcin C7 in Lactobacillus johnsonii (ZL201911127892.0), using the J23119 constitutive promoter to strongly express the mccA gene. Although this method has increased the yield of the heptapeptide to a certain extent (yield is about 0.9-1.1 g / L), the content of Microcin C7 in the fermentation broth is low and the production cost is high. Summary of the invention

[0004] This patent of the present invention uses Lactobacillus johnsonii M1 strain as the base bacteria, replaces the original ribosome binding site (Ribosome Binding Site, RBS) of the mccA gene of Microcin C7, successfully constructs a Microcin C7 high-efficiency expression strain, increases the yield of Microcin C7, and reduces production costs.

[0005] Provided is a method for preparing a Microcin C7 efficient expression strain, which is used for producing and preparing Microcin C7, further improving the expression level of Microcin C7 by Lactobacillus johnsonii, reducing the production cost of Microcin C7, and providing a cheap biological antibacterial agent and preservative for feed additives, veterinary drugs, food and medicine.

[0006] The purpose of the present invention is achieved by the following measures: The present invention provides a Microcin C7 efficient expression strain, which is deposited in China Center for Type Culture Collection, classified and named: Lactobacillus sp.LJ4462, deposited on September 14, 2024, at Wuhan University, Wuhan, China, with a deposit number of CCTCC M 20241988.

[0007] Furthermore, the Microcin C7 high-efficiency expression strain contains a DNA sequence of the RNA binding site as described in SEQ No. 3 in its genome.

[0008] The present invention also provides an RBS fragment combined with the mccA sequence, and the DNA sequence of the fragment is as described in SEQ No. 3.

[0009] The present invention also provides a method for preparing a Microcin C7 high-efficiency expression strain, comprising the following steps: Step 1: Using the public database, a new RBS sequence of the gene mccA was designed according to the theoretical au value as donor DNA.

[0010] Step 2, Gibson technology is used to construct a pCas-sgRNA integrated vector targeting the target site sequence; Step 3, transforming the vector from step 2 and the donor DNA into Lactobacillus plantarum with Microcin C7, replacing the RBS sequence of the gene mccA, and constructing a high-efficiency expression strain; Step 4, fermenting the strain in a culture medium, and detecting the content of Microcin C7 in the fermentation broth.

[0011] Furthermore, the RBS sequence is the DNA sequence described in SEQ No 3.

[0012] Furthermore, in step 2, the target site sequence is the DNA sequence described in SEQ No 1.

[0013] Furthermore, in step 2, the construction of the pCas9-sgRNA integrated plasmid uses the pUC57 plasmid containing the J23119 promoter and the sgRNA encoding DNA sequence and the pPACasR1G4005new plasmid vector as templates, amplifies the fragments of the J23119 promoter and the sgRNA encoding DNA sequence and the pPACasR1G4005new plasmid vector backbone fragment product, and Gibson connects the two products to obtain the pCas9-sgRNA integrated vector, the sequence of which is shown in SEQ No4.

[0014] Furthermore, the Lactobacillus plantarum is Lactobacillus johnsonii M1 strain.

[0015] The present invention also provides a method for preparing Microcin C7, which is prepared by fermentation using the above strain, comprising the following steps: Step 1, inoculating the strain of claim 1 into MRS medium, adjusting the pH to 6.2-6.6, culturing for 16-18 hours, and then transferring to fermentation medium at 5% volume and culturing for 14-16 hours at a temperature of 25-37° C. and dissolved oxygen ≤5%; Step 2, after the fermentation is completed, the fermentation liquid is transferred to a storage tank, centrifuged by a butterfly centrifuge, impurities are removed by a ceramic membrane, filtered by a ceramic ultrafiltration membrane, and spray-dried after adjusting the isoelectric point to obtain a Microcin C7 sample; Step 3, using high performance liquid chromatography to detect the content of Microcin C7 in the fermentation broth and the sample.

[0016] Furthermore, the fermentation medium contains 1.0% peptone, 1.0% yeast extract, 0.5% corn steep liquor, 2.0% glucose, 0.2% dipotassium hydrogen phosphate, 0.058% magnesium sulfate, and 0.025% manganese sulfate (mass percentage).

[0017] Beneficial Effects The invention provides a Microcin C7 efficient expression strain, which can realize the efficient expression of Microcin C7, with the highest expression level reaching 2.36 g / L. After the strain LJ44626 is continuously propagated for 10 generations, the expression amount of Microcin C7 is still stable at 2.3-2.4 g / L, and the yield is higher than all currently reported Microcin C7 expression levels.

[0018] The present invention provides an RBS sequence for the mccA gene, which can enhance the binding efficiency of the expression gene mCCA of Microcin C7 with ribosomes, reduce the variation of translation initiation, and increase the translation rate, thereby stably expressing the protein in the cell, and ultimately achieving a significant increase in yield.

[0019] The present invention provides a method for preparing a Microcin C7 efficient expression strain, and realizes efficient expression of Microcin C7 by replacing the RBS region of the strain, thereby providing a new direction and idea for the large-scale industrial production of Microcin C7, and also providing a new reference for the preparation of efficient expression strains of other polypeptides.

[0020] The pCas9-sgRNA integrated vector for replacing the RBS sequence of the mccA gene of Lactobacillus plantarum provided by the present invention is suitable for the preparation of RBS sequence replacement of various similar strains.

[0021] The present invention provides a fermentation medium with lower production cost, in which corn slurry powder is used to replace part of peptone, the strain fermentation efficiency is high, and the cost of the medium can be reduced by 182.5 yuan per ton after the medium formula is adjusted.

[0022] The present invention provides a preparation method of Microcin C7, obtains a heptapeptide with a broader antibacterial spectrum, improves the industrial production level of the heptapeptide, broadens its application prospects in the fields of feed additives, veterinary drugs, food and medicine, and provides the industry with an efficient and economical biological antibacterial agent and preservative. The successful construction of the Microcin C7 efficient expression system has played a leading role in the animal husbandry and feed industry. Microcin C7 improves the immunity of livestock and poultry and reduces the incidence of diseases, thereby reducing the amount of veterinary antibacterial drugs used for treatment, and promotes the development of green breeding technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 pCas9-gRNA plasmid map Figure 2 Colony PCR images Figure 3 MRS plate streak growth diagram of positive clone strains with different RBS sequences Figure 4 Antibacterial activity of fermentation broth of highly expressed strains (1, vancomycin; 2, colistin sulfate; 3, 92205 strain; 4, M1 strain; 5, 18613 strain; 6, 44626 strain; 7, MRS culture broth) Specific implementation plan

[0024] The following are specific embodiments to specifically describe the present invention. It is pointed out that the following embodiments are only used to further illustrate the present invention and cannot be understood as limiting the scope of protection of the present invention. The technology in the field is that skilled persons can make some non-essential improvements and adjustments to the present invention based on the above invention content.

[0025] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the relevant art.

[0026] Example 1) Sequence design

[0027] Using the RBS design tool (https: / / salislab.net / software / design_rbs_calculator), new RBS sequences were designed according to the theoretical au values ​​of 140000, 12000, 100000, 80000, 60000, 40000 and 20000, respectively. The newly designed RBS sequences are shown in Table 1. Subsequently, the target site sequence near the RBS was designed using the sgRNA design tool (http: / / www.rgenome.net / cas-designer) (sgRNA target site sequence: TGCTAGCGGCGAAAGACTTAAGG, the sequence is shown in SEQ No. 1), and the J23119 promoter was added before the designed sgRNA to construct the DNA sequence of the mature sgRNA that can be expressed in the Lactobacillus johnsonii M1 strain. The sequence is shown in SEQ No. 2 and was synthesized by Qingke Biotechnology and cloned on the pUC57 plasmid. At the same time, a repair template was designed based on the new RBS region sequence and handed over to Qingke Biotechnology Co., Ltd. to synthesize donor DNA, where the RBS-44626 sequence is shown in SEQ No. 3.

[0028] Table 1 RBS sequences with different au values RBS name au value RBS sequence RBS-136131 136131 GCGAGGAGACTTAAGGAGACATTTC RBS-135441 135441 TGTCCCAGCGGCTTAAGGAGGAAATAT RBS-118905 118905 TTTACACCCTTACGGAAAAGGAGGAGATC RBS-92205 92205 GGACGCAGCCCCTAAGGAGCCTTAAAC RBS-80298 80298 GAAAATTTACAAACTTAAAAAGGAGCCAAAC RBS-64115 64115 TAAATATCCGAAGTATTAAGGAGACCATT RBS-44626 44626 TCCTACGGATCGGAACTTAAGGACGTACTAT RBS-38472 38472 CAGCCAAAACTGCGGGGAAATTTTTC RBS-22261 22261 TTGTCTACTAAAATACGGCGATCCAAGTAGGTCTTT RBS-18613 18613 GCACATATTTAACTAAGCAGGTCTGG 2) Construction of pCas9-gRNA integrated plasmid vector

[0029] Using pPACasR1G4005new as the vector backbone, the pCas9-gRNA integrated plasmid was constructed. The plasmid map is shown in Figure 1 As shown. Using the primers sgRNA-F / sgRNA-R in Table 2, the pUC57 plasmid containing the J23119 promoter and sgRNA encoding DNA sequence was used as a template to amplify the fragment of the J23119 promoter and sgRNA encoding DNA sequence. Using the primers pCas9-F / pCas9-R in Table 2, the pPACasR1G4005new plasmid vector was used as a template to amplify the pPACasR1G4005new plasmid vector backbone fragment product. Then, the PCR product was purified using a DNA purification column, and the two products were Gibson connected. The final plasmid was named pCas9-sgRNA, and the sequence is shown in SEQ No4. These products were transformed into DH5α competent cells and verified by sequencing.

[0030] Table 2 Common primer sequences for constructing vectors Primer name Primer sequences sgRNA-F 5'- ACAGCTAGCTCAGTCCTAGGTAT sgRNA-R 5'-GCTTGAGCTCTCTAGAACTAGTGTT pCas9-F 5'-AGTTCTAGAGAGCTCAAGCTCATGG pCas9-R 5'-TAGGACTGAGCTAGCTGTCAA 3) RBS zone replacement

[0031] Activate Lactobacillus plantarum M1 at 30°C overnight, take 500 μL the next day and transfer to 50 mL MRS, and culture at 30°C until OD 600 ≈0.4, centrifuge to collect bacteria, prepare electroporation competent cells; add about 100 ng of pCas9-sgRNA plasmid to each 80 μL competent cells, and add 10 different donor DNAs (about 400 ng) at the same time, and electroporate at 1500 V; add 900 μL MRS to the electroporated cells, resuscitate and culture at 30℃ 220 rpm for 1 h, then spread on erythromycin MRS resistance plates, and invert and culture at 30℃ for 48h. Pick single clones for PCR identification to detect whether single colonies have RBS replacement. The replaced original RBS is shown in SEQ No 5. Primers RBS-F and RBS-R, primer RBS-F is the DNA sequence of the RBS region, for example, the RBS-F primer for detecting positive clones of strain LJ92205 is: GGACGCAGCCCCTAAGGAGCCTTAAAC; RBS-R: CGGCGAAGCTGTCGACGA is a common primer for detection, and the amplified product is about 224bp. The single colony with successful RBS region replacement was PCR amplified with a high-fidelity polymerase and sent to Shanghai Sangon Biotechnology Co., Ltd. for first-generation sequencing verification. The PCR verification band is as follows Figure 2 As shown, the theoretical value of the PCR product is 231 bp, and the positive rate of first-generation sequencing is 100%. A total of 8 positive strains with successful RBS region replacement were screened out, named LJ136131, LJ135441, LJ118905, LJ92205, LJ44626, LJ38472, LJ22261 and LJ18613 for subsequent expression verification. The remaining two RBS region replacements (RBS-80298 and RBS-64115) did not screen out positive clones with correct replacement, so they were not further explored.

[0032] 4) Fermentation verification of positive clones

[0033] The positive clones screened were streaked on MRS plates and their growth was shown in Figure 3As shown. The growth of mutant strains LJ92205, LJ44626, LJ18613 and LJ38472 was similar to that of the original M1 strain, indicating that the replacement of these four RBS regions had no significant effect on the normal growth of the chassis strain. However, the other four strains (LJ22261, LJ136131, LJ135441 and LJ118905) showed growth inhibition after the replacement of the RBS region, indicating that the replacement of these four RBS regions may lead to negative mutations, which is not conducive to subsequent fermentation verification. Therefore, we selected LJ92205, LJ44626, and LJ18613 for subsequent fermentation verification.

[0034] The strain was inoculated into MRS medium, pH was adjusted to 6.2-6.6, cultured for 16-18 hours, and then transferred to fermentation medium (1.0% peptone, 1% yeast extract, 0.5% corn syrup powder, 2% glucose, 0.2% dipotassium hydrogen phosphate, 0.058% magnesium sulfate, 0.025% manganese sulfate, pH 6.2-6.6) at a volume of 5% at a fermentation temperature of 25-37°C, dissolved oxygen ≤5%, and cultured for 14-16 hours. After the fermentation, the fermentation broth was transferred to a storage tank, centrifuged by a butterfly centrifuge, impurities removed by a ceramic membrane, filtered by a ceramic ultrafiltration membrane, and spray dried after adjusting the isoelectric point to obtain a Microcin C7 sample.

[0035] The content of Microcin C7 in the fermentation broth was detected by high performance liquid chromatography. The contents of LJ92205, LJ 44626, LJ18613 and M1 were 0.85 g / L, 2.36 g / L, 1.53 g / L and 1.12 g / L, respectively. Among them, the content of Microcin C7 in strain LJ44626 was the highest, 2.1 times that of M1. The content of Microcin C7 in the original strain M1 sample was 3%, and the content of Microcin C7 in strain LJ44626 increased to 5%. To further verify the expression stability of the prepared strain, after the strain LJ44626 was continuously propagated for 10 generations, the expression level of LJ44626 remained stable at 2.3~2.4 g / L.

[0036] Microcin C7 HPLC detection method: Use reverse phase column: C18 (4.6×250 mm); eluent: mobile phase A (0.1% trifluoroacetic acid), mobile phase B (90% acetonitrile) according to Table 4. The parameters should be: column temperature: 25 ℃, detection wavelength: 260 nm; maximum pressure: 200 bar. Table 3 Mobile phase gradient elution program Time A% B% mL / min 0.00 95 5 1 5.00 95 5 1 10.00 87 13 1 13.00 87 13 1 15.00 50 50 1 20.00 0 100 1 25.10 10 100 1 30.00 95 5 1 35.00 95 5 1 The pure product is dissolved in water, the sample is loaded to determine the peak time of the pure product, and then the fermentation liquid is loaded. The external standard method calculates the peak area and concentration (the sample amount is consistent) in direct proportion, and the content is calculated using the following formula:

[0037] Wherein AX is the peak area of ​​Microcin C7 in the fermentation broth; CX is the content of Microcin C7 in the fermentation broth (μg / g); AR is the peak area of ​​the reference substance; CR is the concentration of the reference substance (μg / mL).

[0038] 5) Antibacterial activity of Microcin C7 high-efficiency strain fermentation broth

[0039] The screened strains LJ92205, LJ44626, LJ18613 and M1 were fermented in a culture medium (1.0% peptone, 1% yeast extract, 0.5% corn syrup powder, 2% glucose, 0.2% potassium dihydrogen phosphate, 0.058% magnesium sulfate, 0.025% manganese sulfate, pH 6.2-6.6, fermentation temperature 25-37°C, dissolved oxygen ≤5%), and the fermentation supernatant was tested for its antibacterial activity against Gram-positive and Gram-negative bacteria. The method for determining the antibacterial activity is as follows: Ⅰ. Bacterial recovery: streak the indicator bacteria plate and culture it at a suitable temperature for 20 h; pick a single colony in the corresponding liquid culture medium and culture it for about 12-16 h. Dilute the bacterial solution with saline to about 1×10 8 CFU / ml, set aside. Ⅱ. Take 10 mL of fermentation broth sample at 8000 g, centrifuge at 4℃, collect the supernatant and store at -20℃ for later use. Ⅲ. In the clean bench, take 100 μL of indicator bacteria solution and add it to 100 mL of corresponding agar medium kept at 50 ± 5℃, shake gently to avoid foaming. At this time, the content of bacteria in the medium is 1×10 6 CFU / ml. Pour 15-20 mL into each culture dish, spread it evenly, and wait for it to cool and solidify. Use a sterile hole puncher to make holes evenly, draw 150-200 μL of fermentation liquid sample and inject it into the corresponding hole, set up sterile water as a blank control, and mark the culture dish. Put the culture dish in a 2-8℃ refrigerator for 1-2 hours to allow the sample to diffuse. Move the culture dish to the incubator for culture. Observe the growth of the bacteria and the antibacterial effect in the next 16-18 hours. Figure 4 As shown in the figure, Microcin C7 has strong antibacterial effect on Escherichia coli ATCC 25922, Escherichia coli ATCC1515 and Staphylococcus aureus ATCC 29213, and the antibacterial spectrum of Microcin C7 is wider than that of the previously applied patent (ZL201911127892.0).

Claims

1. A Microcin C7 efficient expression strain, characterized by: Deposited in China Center for Type Culture Collection, deposit date: September 14, 2024, address: Wuhan University, Wuhan, China, accession number: CCTCC M 20241988.

2. A Microcin C7 high-efficiency expression strain as claimed in claim 1, characterized in that: The genome contains the DNA sequence of the Ribosome Binding Site as described in SEQ No 3.

3. An RBS fragment binding to the mccA sequence, characterized in that: The fragment is a DNA sequence as described in SEQ No 3.

4. A method for preparing a Microcin C7 high-efficiency expression strain, comprising the following steps: Step 1: Using the public database, a new RBS sequence of the gene mccA was designed according to the theoretical au value as donor DNA; Step 2, using Gibson technology to construct a pCas9-sgRNA integrated vector targeting the target site sequence; Step 3, transforming the vector in step 2 and the donor DNA into a lactobacillus having a Microcin C7 expression sequence, replacing the RBS sequence of the gene mccA, and constructing a highly efficient expression strain; Step 4, fermenting the strain in a culture medium, and detecting the content of Microcin C7 in the fermentation broth.

5. The method according to claim 4, further characterized in that : The RBS sequence in step 1 is the DNA sequence described in SEQ No 3.

6. The method according to claim 4, further characterized in that : The target site sequence in step 2 is the DNA sequence described in SEQ No 1.

7. The method according to claim 4, further characterized in that : In step 2, the construction of the pCas9-sgRNA integrated plasmid uses the pUC57 plasmid containing the J23119 promoter and the sgRNA encoding DNA sequence and the pPACasR1G4005new plasmid vector as templates to amplify the fragments of the J23119 promoter and the sgRNA encoding DNA sequence and the pPACasR1G4005new plasmid vector backbone fragment product, and the two products are Gibson connected to obtain the pCas9-sgRNA integrated vector with a sequence as shown in SEQ No4.

8. The method according to claim 4-7, further characterized in that : The strain in step 3 is Lactobacillus johnsonii M1 strain.

9. A method for preparing Microcin C7, characterized in that: The method is prepared by fermentation of the strain as claimed in claim 1, comprising the following steps: Step 1, inoculating the strain of claim 1 into MRS medium, adjusting the pH to 6.2-6.6, culturing for 16-18 hours, and then transferring to fermentation medium at 5% volume and culturing for 14-16 hours at a temperature of 25-37° C. and dissolved oxygen ≤5%; Step 2, after the fermentation is completed, the fermentation liquid is transferred to a storage tank, centrifuged by a butterfly centrifuge, impurities are removed by a ceramic membrane, filtered by a ceramic ultrafiltration membrane, and spray-dried after adjusting the isoelectric point to obtain a Microcin C7 sample; Step 3, using high performance liquid chromatography to detect the content of Microcin C7 in the fermentation broth and the sample.

10. The method according to claim 9, characterized in that: The fermentation medium contains 1.0% peptone, 1.0% yeast extract, 0.5% corn steep liquor, 2.0% glucose, 0.2% dipotassium hydrogen phosphate, 0.058% magnesium sulfate, and 0.025% manganese sulfate (in mass percentage).

Images