Acetohydroxy acid synthase mutants and their use in the production of branched chain amino acids

Abstract

The present application belongs to the field of protein engineering and biotechnology, and particularly relates to an acetyl-hydroxy acid synthase mutant and application thereof. The present application obtains an acetyl-hydroxy acid synthase mutant capable of improving the yield of branched-chain amino acids of a strain through in-depth research and mutant library screening, and the mutant can be applied to the production of branched-chain amino acids including L-leucine, L-isoleucine and L-valine, and has a potential application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to a novel acetyl-hydroxy acid synthase mutant and use thereof, in particular, to an acetyl-hydroxy acid synthase mutant, a microorganism containing the same or a method for producing L-branched chain amino acid. BACKGROUND

[0002] It is known that branched chain amino acids (e.g., L-valine, L-leucine and L-isoleucine) increase protein levels in individuals and play an important role as an energy source during exercise, and thus are widely used in pharmaceuticals, foods, etc. Like other amino acids, branched chain amino acids are mainly synthesized by biofermentation. In the biosynthesis of branched chain amino acids, acetyl-hydroxy acid synthase is the first enzyme in the biosynthesis of branched chain amino acids, which can catalyze two molecules of pyruvic acid to generate acetyl lactate (a precursor of valine and leucine), and can also catalyze ketobutyric acid and pyruvic acid to generate 2-acetyl-2-hydroxy-butyric acid (a precursor of isoleucine). Therefore, acetyl-hydroxy acid synthase is a very important enzyme involved in the initial biosynthesis process of L-branched chain amino acids.

[0003] Acetyl-hydroxy acid synthase IlvBN in Corynebacterium glutamicum is composed of two subunits, a large subunit encoded by the ilvB gene and a small subunit encoded by the ilvN gene. The large subunit has complete catalytic activity, and the small subunit has a regulatory role. The prior art shows that the three branched chain amino acids can all feedback inhibit the small subunit of acetyl-hydroxy acid synthase (Elisakova, V; Patek, M; Holatko, J; Nesvera, JN; Leyval, D; Goergen, JL; Delaunay, S. Feedback-resistant acetohydroxy acid synthase increases valine production in Corynebacterium glutamicum. Appl Environ Microbiol, 2005, 71: 207-213). Therefore, obtaining acetyl-hydroxy acid synthase that is free of feedback inhibition is the key to the synthesis of branched chain amino acids. In recent years, a number of acetyl-hydroxy acid synthase mutants that are free of feedback inhibition have been reported, such as CN107075496A, WO2023027284A1, WO2022255160A1. However, the prior art still needs to explore new mutants in order to improve the production of branched chain amino acids by strains. SUMMARY

[0004] By structure prediction and function analysis of the small subunit of acetohydroxy acid synthase IlvN, it is speculated that V15, I22, S41 positions are the core sites of catalysis, and further saturation mutation is carried out on the above positions, and I22R, I22K, S41R, S41W, S41F, S41L 6 mutants are obtained, the above mutants can improve the branched amino acid yield of the strain, and can be applied to the production of L-leucine, L-isoleucine and L-valine, and has potential application prospect, and the application is completed on this basis.

[0005] In a first aspect, the application provides an acetohydroxy acid synthase mutant, wherein the amino acid sequence of the mutant is based on the wild-type amino acid sequence shown in SEQ ID NO: 2, the amino acid residues at positions 22 and / or 41 are mutated, and the mutant can improve the branched amino acid yield of the strain.

[0006] The "wild type" refers to an object that can be found in nature. For example, a polypeptide or polynucleotide sequence that exists in an organism, can be isolated from a source in nature and has not been intentionally modified by humans in the laboratory is naturally occurring. As used in the present disclosure, "naturally occurring" and "wild type" are synonymous.

[0007] In some embodiments, the amino acid sequence of the "mutant" is based on the amino acid sequence shown in SEQ ID NO: 2, the 22nd position is mutated to any one of arginine, lysine, and / or the 41st position is mutated to any one of arginine, tryptophan, phenylalanine, and leucine.

[0008] In a second aspect, the application provides a coding gene of the acetohydroxy acid synthase mutant, a recombinant expression vector containing the coding gene, and a recombinant microorganism.

[0009] The "recombinant expression vector" refers to a DNA structure for expressing a coding gene. The recombinant expression vector can include, for example, a transcription unit comprising i) a set of genetic elements having a regulatory effect on gene expression, such as a promoter and an enhancer; ii) a structural or coding sequence that is transcribed into mRNA and translated into a protein; and iii) appropriate transcription and translation initiation and termination sequences. The recombinant expression vector is constructed in any suitable manner. The nature of the vector is not important, and any vector can be used, including plasmids, viruses, bacteriophages, and transposons. Possible vectors for use in the present disclosure include, but are not limited to, chromosomal, non-chromosomal, and synthetic DNA sequences, such as bacterial plasmids, bacteriophage DNA, yeast plasmids, and vectors derived from combinations of plasmids and bacteriophage DNA, DNA from viruses such as vaccinia, adenovirus, fowlpox, baculovirus, SV40, and pseudorabies.

[0010] The "recombinant microorganism" of the present application has the meaning commonly understood by those of ordinary skill in the art, i.e., a microorganism into which the acetyl-hydroxy acid synthase mutant of the present application is introduced, after the introduction, the microorganism is called a recombinant microorganism. In other words, any strain can be used in the present application as long as it can be introduced with the acetyl-hydroxy acid synthase mutant of the present application. The recombinant microorganism of the present application can be a bacterium, preferably a bacterium of the genus Corynebacterium. In a specific embodiment, the recombinant microorganism is Corynebacterium glutamicum, including but not limited to Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and mutants or strains of the above strains that produce branched-chain amino acids.

[0011] In the present application, the culture of the host cell can be carried out according to the conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture, and fed-batch culture, etc., and various culture conditions such as temperature, time, and pH value of the culture medium, etc. can be appropriately adjusted according to the actual situation.

[0012] In a third aspect, the present application provides the use of the acetyl-hydroxy acid synthase mutant of the first aspect or the recombinant microorganism of the second aspect in the production of branched-chain amino acids.

[0013] In a fourth aspect, the present application provides a method for producing branched-chain amino acids, which comprises culturing the recombinant microorganism of the second aspect to produce branched-chain amino acids, and further comprises the step of isolating or extracting branched-chain amino acids from the culture medium.

[0014] In a specific embodiment, the branched-chain amino acid is selected from one or more of L-leucine, L-isoleucine, and L-valine.

[0015] The present application has the following beneficial effects: the acetyl-hydroxy acid synthase mutant obtained in the present application has higher production of the three branched-chain amino acids, i.e., leucine, isoleucine, and valine, than the wild type WT control, and also higher than the known S41V+A91V positive control, and the S41V control. Therefore, the mutant of the present application can be applied to the production of leucine, isoleucine, and valine, and has potential application prospects. DETAILED DESCRIPTION

[0016] In order to make the purpose, technical solutions and advantages of the embodiments of the present application clearer, the present application will be described clearly and completely below in combination with the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments.

[0017] Example 1, Designing the de-feedback inhibition mutation site of Corynebacterium glutamicum acetyl-hydroxy acid synthase

[0018] Corynebacterium glutamicum acetyl-hydroxy acid synthase IlvBN is a key enzyme for branched-chain amino acid synthesis, which is composed of two subunits, the large subunit encoded by ilvB gene and the small subunit encoded by ilvN gene. The large subunit has complete catalytic activity, and the small subunit has regulatory effect, which can activate the catalytic activity of the large subunit and confer 3 branched-chain amino acids on the feedback inhibition of the holoenzyme. The amino acid sequence of IlvB in Corynebacterium glutamicum 13032 is shown as SEQ ID NO. 1, and the coding gene sequence is shown as SEQ ID NO. 3. The amino acid sequence of IlvN is shown as SEQ ID NO. 2, and the corresponding coding gene sequence is shown as SEQ ID NO. 4.

[0019] Since the acetyl-hydroxy acid synthase IlvBN of Corynebacterium glutamicum has no protein structure, the present application is based on the crystal structure of acetyl-hydroxy acid synthase from Escherichia coli (PDB code: 5YPP) to perform homology modeling and L-valine effector and protein interaction analysis, and it is predicted that L-valine is combined on the IlvN subunit, and the amino acids in the interaction range are also predicted. The conservation of each amino acid is analyzed by multiple sequence alignment based on 1000 homologous sequences. Existing researches also confirm that the mutants that remove the valine feedback inhibition also remove the feedback inhibition of leucine and isoleucine. The present application speculates that the similar structures of valine, leucine and isoleucine 3 effectors are combined in the same region, and the 3 branched-chain amino acids are mainly combined with IlvN through hydrophobic interaction, in which the conserved hydrophobic amino acids play an important role in the combination. Therefore, 3 sites in the range of L-valine effector which are highly conserved and the conserved residues are hydrophobic amino acids, are selected as mutation sites, i.e. the V15, I22 and S41 sites of Corynebacterium glutamicum IlvN.

[0020] Example 2, screening of Corynebacterium glutamicum acetyl-hydroxy acid synthase feedback inhibition mutants

[0021] Firstly, the screening method of the feedback inhibition removal acetyl-hydroxy acid synthase mutant is designed. Since the main limitation of valine synthesis in Corynebacterium glutamicum is the feedback inhibition of acetyl-hydroxy acid synthase IlvBN, removing the feedback inhibition of the enzyme can enhance the synthesis of valine. The screening method designed by the present application is as follows: the genes encoding acetyl-hydroxy acid synthase ilvBN and the downstream ilvC and ilvE genes of the metabolic pathway are expressed on the plasmid, the ilvN gene is amplified by carrying the amino acid saturation primer and the plasmid library of the specific site saturation mutation is constructed, and then the plasmid mutation library is transformed into the bottom plate bacteria with a valine biosensor, and the mutants with high efficiency of removing feedback inhibition are screened based on fluorescence enhancement.

[0022] Construction of valine biosensor chassis: Based on the lysine biosensor expression plasmid pLysGWT (Biosens Bioelectron. 2023 Feb 15; 222: 115004.) with eYFP as the reporter gene, the expression plasmid of valine biosensor was constructed. The plasmid backbone was amplified with pLysGWT plasmid as the template and pG-1 and pG-2 as primers. According to the reported Corynebacterium glutamicum ATCC13032 genome sequence (GenBank: BA000036.3), the endogenous lrp-brnF gene fragment was amplified with the ATCC13032 genome as the template and LB-1 and LB-2 as primers. After recovering the plasmid backbone and the target gene fragment, they were ligated by the Novagen one-step recombination kit and then transformed into E. coli Trans-T1 (Beijing Quanshi Gold Biotechnology Co., Ltd.). The obtained transformants were coated on LB solid medium containing 25 μg / mL kanamycin and incubated at 37°C overnight. The obtained transformants were verified by PCR using the universal plasmid primers PTRC99C-F and PBV220-R, and sent to a sequencing company for sequencing verification. The correct recombinant plasmid was named pEC-LB. LB medium: 5 g / L yeast powder, 10 g / L peptone, 10 g / L NaCl, and 15 g / L agar powder were added to prepare the solid medium. The correct pEC-LB plasmid was introduced into Corynebacterium glutamicum ATCC13032 by conventional electroporation method to obtain the ATCC13032 (pEC-LB) strain.

[0023] The plasmid overexpressing ilvBN, ilvC and ilvE genes was constructed as follows: The ilvBN, ilvC and ilvE genes were expressed on the basis of the pXMJ19 plasmid (GenBank: AJ133195.1), and the P trcThe expression of a gene is controlled by a promoter. The plasmid backbone was amplified using pXMJ19 plasmid as template and pXMJ19-1 and pXMJ19-2 as primers. The ilvBN gene fragment was amplified using ATCC13032 genome (GenBank: BA000036.3) as template and ilvBN-1 and ilvBN-2 as primers, corresponding to the fragment of Cgl1271-Cgl1272 in ATCC13032 genome (GenBank: BA000036.3); the ilvC gene fragment was amplified using ilvC-1 and ilvC-2 as primers, corresponding to the fragment of Cgl1273 gene in ATCC13032 genome (GenBank: BA000036.3); the ilvE gene fragment was amplified using ilvE-1 and ilvE-2 as primers, corresponding to the fragment of Cgl2204 gene in ATCC13032 genome (GenBank: BA000036.3). After recovering the plasmid backbone and the three gene fragments, they were ligated by using a One-step Recombination Kit of Novagen and then transformed into E. coli Trans-T1. The transformants were coated on LB solid medium containing 20 μg / mL chloramphenicol and incubated at 37°C overnight. The obtained transformants were verified by PCR using universal primers pXMJ19-F and pXMJ19-R and then sent to a sequencing company for sequencing verification. The correct recombinant plasmid was named pQ-ilvBNCE.

[0024] 3 sites unit point saturation mutation library plasmid and control plasmid construction as follows: with pQ-ilvBNCE as template, with XXX-F (such as V15-F) and ilvBNCE-R as primers and XXX-R (such as V15-R) and ilvBNCE-F as primers to amplify two fragments of each site, after fragment recovery, connect by Novagen one-step recombination kit, then transform into E. coli Trans-T1, spread on LB solid medium containing 20 μg / mL chloramphenicol, the transformants should be more than 300 clones. Add 2 mL sterile water to each library plate, collect the colonies with a spreader, centrifuge the collected bacterial solution and extract the plasmid library, and obtain the saturation mutation library plasmid of 4 sites. At the same time, using the above similar method, introduce the S41V and A91V combined dominant mutant identified in branched chain amino acid producing bacteria (Protein Expr Purif. 2015 May; 109: 106-12.) into the pQ-ilvBNCE plasmid, amplify the plasmid backbone with S41V-1 and A91V-2 primers, and amplify the ilvN fragment with S41V-2 and A91V-1 primers, then recover the fragments, connect by Novagen one-step recombination kit, then transform into E. coli Trans-T1, spread on LB solid medium containing 20 μg / mL chloramphenicol, and sequence to obtain the correct pQ-ilvBN S41V+A91V CE plasmid. The primers used in this example are shown in Table 1.

[0025] Table 1, primer information

[0026]

[0027]

[0028] High-throughput screening based on biosensor: according to the method reported in the conventional literature, prepare the competent cells of ATCC13032 (pEC-LB) strain, and transfer the above constructed 4 site saturation mutation library plasmids and positive control pQ-ilvBN S41V +A91V CE plasmid into the competent cells of ATCC13032 (pEC-LB), add 1 mL of 46°C preheated TSB medium, incubate at 46°C for 6 min, and incubate at 30°C for 2 h. Transfer the above culture liquid into 100 mL triangular flask containing 20 mL TSB liquid medium added with 5 μg / mL chloramphenicol and 25 μg / mL kanamycin, and culture at 30°C on a shaker until the OD 600 of the obtained bacterial solution is about 5. The initial OD 600about 0.5 to 30 mL fermentation medium (250 mL flask) containing 5 μg / mL chloramphenicol, 25 μg / mL kanamycin and 1 mM IPTG, 30°C for 5-6 h, the bacterial concentration was diluted to OD 600 about 0.05. The fluorescence intensity of single cells in the above bacterial solution was analyzed by flow cytometry, and the results showed that the fluorescence intensity of single cells in the I22 and S41 libraries was significantly higher than that in the positive control pQ-ilvBN S41V+A91V The fluorescence intensity of single cells in the I22 and S41 libraries was significantly higher than that in the positive control pQ-ilvBN. For the above two libraries, the region with significantly higher proportion of high fluorescence intensity than the positive control was selected as the sorting region, and the cells in this region were sorted onto plates for culture to obtain monoclonal. The composition of TSB medium was: glucose, 5 g / L; yeast powder, 5 g / L; soybean peptone, 9 g / L; urea, 3 g / L; succinic acid, 0.5 g / L; K2HPO4·3H2O, 1 g / L; MgSO4·7H2O, 0.1 g / L; biotin, 0.01 mg / L; vitamin B1, 0.1 mg / L; MOPS, 20 g / L; pH 7-7.2.

[0029] About 80 clones sorted from the above two libraries were subjected to 96-well plate fluorescence intensity re-screening, and single clones were picked into 96-well plates containing TSB medium for overnight culture, 200 μL per well, containing 5 μg / mL chloramphenicol, 25 μg / mL kanamycin, and then, the same volume of about 0.05 initial OD 600 was transferred to 96-well plates containing fermentation medium, 200 μL per well, containing 5 μg / mL chloramphenicol, 25 μg / mL kanamycin and 1 mM IPTG, and cultured for 6 h, the culture temperature was 30°C. After the culture, the fluorescence (excitation wavelength: 488 nm, emission wavelength: 520 nm) and OD 600 of the strains were detected by a microplate reader, and the fluorescence intensity (fluorescence / OD 600 ) was calculated. The formula of fermentation medium: glucose, 80 g / L; yeast powder, 2 g / L; (NH4)2SO4, 20 g / L; urea, 5 g / L; KH2PO4, 1 g / L; K2HPO4·3H2O, 1.3 g / L; MOPS, 42 g / L; CaCl2, 0.01 g / L; FeSO4·7H2O, 0.01 g / L; MnSO4·H2O, 0.01 g / L; ZnSO4·7H2O, 0.001 g / L; CuSO4, 0.0002 g / L; NiCl·6H2O, 0.00002 g / L; MgSO4·7H2O, 0.25 g / L; protocatechuic acid, 0.03 g / L; vitamin B1, 0.0001 g / L; biotin, 0.0002 g / L; pH 7-7.2.

[0030] For the clones with more than 30% fluorescence intensity increase compared with the control strain, PCR was performed using the plasmid universal primers pXMJ19-F and pXMJ19-R and sequencing company was used for sequencing verification. Finally, 6 mutants were obtained, and the corresponding strains, fluorescence intensity increase and mutation are shown in Table 2.

[0031] Table 2, fluorescence intensity increase and mutation of mutant strains

[0032]

[0033] Example 3, L-valine production evaluation of Corynebacterium glutamicum acetyl- CoA carboxylase mutant

[0034] The L-valine production of the 6 strains obtained above was evaluated using a 24-well plate, with wild-type plasmid and positive control plasmid strains as controls (strains named CgL-WT and CgL-S41V+A91V, respectively). First, the strains were inoculated into a 24-well plate containing 800 μL TSB liquid medium per well and cultured for 6-8 h, and the culture was inoculated into a 24-well plate containing 800 μL fermentation medium supplemented with 5 μg / mL chloramphenicol, 25 μg / mL kanamycin and 1 mM IPTG per well, with an initial OD 600 Control about 0.06, 30°C for 24 h, 800 rpm for the hole plate shaker, 90% relative humidity, and the OD 600 and L-valine production were detected after fermentation. Three parallel experiments were set up, and the L-valine concentration was determined by conventional amino acid liquid chromatography detection method. The results are shown in Table 3, and the L-valine production of all mutants is higher than that of the wild-type WT control and the known S41V+A91V positive control.

[0035] Table 3, L-valine production evaluation

[0036] Strain L-valine (g / L) CgL-WT 0.04±0.01 CgL-S41V+A91V 7.03±0.11 CgL-I22R 9.21±0.07 CgL-I22K 8.79±0.19 CgL-S41R 6.82±0.06 CgL-S41W 8.91±0.23 CgL-S41F 8.82±0.09 CgL-S41L 7.61±0.12

[0037] Example 4, reconstitution of Corynebacterium glutamicum acetyl-CoA carboxylase mutants and their application evaluation in branched-chain amino acid production

[0038] In order to further confirm the function of the above specific site mutations, CgL-I22R, CgL-I22K, CgL-S41W, CgL-S41F and CgL-S41L strains containing dominant mutants were selected for reconstitution.

[0039] The mutants were reconstituted by a similar method as in Example 2, and the corresponding mutants were introduced into pQ-ilvBNCE plasmid (new primers are shown in Table 4), to obtain pQ-ilvBN I22RCE, pQ-ilvBN I22K CE, pQ-ilvBN S41W CE, pQ-ilvBN S41F CE, pQ-ilvBN S41L CE plasmid. The above plasmids were respectively transformed into competent cells of ATCC 13032 (pEC-LB) to obtain CgL-I22R*, CgL-I22K*, CgL-S41W*, CgL-S41F* and CgL-S41L* strains.

[0040] Table 4, primer information

[0041] Primer Nucleotide sequence I22R-F CGTTCAGGACGTAGACGGAATCAGGTCCCGCGTATCAGGTATG I22K-F CGTTCAGGACGTAGACGGAATCAAATCCCGCGTATCAGGTATG I22-R GATTCCGTCTACGTCCTGAACG S41W-F CAACCTCGTGTCCCTCGTGTGGGCAAAGACCGAAACACACGG S41F-F CAACCTCGTGTCCCTCGTGTTTGCAAAGACCGAAACACACGG S41L-F CAACCTCGTGTCCCTCGTGCTGGCAAAGACCGAAACACACGG S41-R CACGAGGGACACGAGGTTG

[0042] The above strains and control strains were subjected to plate fermentation evaluation by the same method as in Example 3, and the concentrations of the three branched-chain amino acids were determined by the amino acid liquid phase detection method of Example 3. The results are shown in Table 5. The production of the three branched-chain amino acids of all mutants was higher than that of the wild type WT control strain, the production of L-valine of all mutants was higher than that of the known S41V+A91V combination mutant control strain, and the production of L-leucine and L-isoleucine of multiple mutants was higher than or comparable to that of the known S41V+A91V combination mutant control strain, indicating that the obtained acetohydroxy acid synthase mutants of the application are beneficial to the synthesis of the three branched-chain amino acids and can be applied to the production of branched-chain amino acids.

[0043] Table 5, production of three branched-chain amino acids

[0044]

[0045]

[0046] Example 5, application evaluation of Corynebacterium glutamicum acetohydroxy acid synthase mutants in L-isoleucine production

[0047] In order to further evaluate the application of the obtained advantage mutants in L-isoleucine production, the advantage mutants I22K and S41W mutants and the WT control were selected for comparative analysis.

[0048] In order to enhance the synthesis of L-isoleucine, first, pQ-ilvBNCE, pQ-ilvBN I22K CE, pQ-ilvBN S41W CE plasmid basis to further overexpress the feedback inhibition relieved threonine dehydrase gene ilvA F383V respectively, pQ-ilvBNCE, pQ-ilvBN I22K CE, pQ-ilvBN S41WCEA plasmid as a template, pXM-1 and pXM-2 as primers to amplify the backbone part; 13032 genome as a template, ilvA-1 and ilvA-2 as primers to amplify part of ilvA gene fragment, ilvA-3 and ilvA-4 as primers to amplify another part of ilvA gene fragment, and F383V mutant was introduced by primers. The above plasmid backbone was respectively recombined with two ilvA gene fragments to obtain pQ-ilvBNCEA F383V , pQ-ilvBN I22K CEA F383V and pQ-ilvBN S41W CEA F383V plasmid. In order to enhance the supply of L-threonine precursor of the chassis cell, the T311I mutation (base mutation ACC→ATC) of the feedback inhibition relieved aspartokinase lysC gene, the G378E mutation (GGG→GAG) of homoserine dehydrogenase hom gene, the start codon GTG mutation of lysC gene to ATG and the insertion of artificial strong promoter P pyc -20 (CN113755492A) before the start codon of hom gene were introduced in the genome of Corynebacterium glutamicum ATCC13032 in turn, and the obtained strain was named as ZLJHT4 strain. gpmA pQ-ilvBNCEA F383V , pQ-ilvBN I22K CEA F383V and pQ-ilvBN S41W CEA F383V , respectively, and were electrotransformed into ZLJHT4 strain competent cells to obtain CgL-ilvBNCEA F383V , CgL-ilvBN I22K CEA F383V and CgL-ilvBN S41W CEA F383V strains. The primers used in this example are shown in Table 6.

[0049] Table 6, primer information

[0050]

[0051]

[0052] The above strains were subjected to the same plate fermentation evaluation as in Example 3, and the concentration of L-isoleucine was determined using the amino acid liquid chromatography detection method of Example 3. The results are shown in Table 7, and the L-isoleucine yield of the acetyl-hydroxy acid synthase I22K and S41W mutants was increased by more than 78% compared to the wild type WT control strain, indicating that the mutants obtained by the present application are conducive to the efficient synthesis of L-isoleucine and can be applied to the production of L-isoleucine.

[0053] Table 7, L-isoleucine yield

[0054] Strain L-isoleucine (g / L) [CgL-ilvBNCEA F383V ]]> 0.51±0.01 [CAT] CgL-ilvBN I22K CEA F383V ]]> 0.91±0.02 [CAT] CgL-ilvBN S41W CEA F383V ]]> 0.97±0.02

[0055] Example 6, characterization of the feedback inhibition enzyme properties of the Corynebacterium glutamicum acetyl-hydroxy acid synthase mutants

[0056] In order to further characterize the level of feedback inhibition removal of the mutants, the WT, I22R and S41W mutants were respectively recombinantly expressed in E. coli, and the feedback inhibition removal effect was characterized.

[0057] Recombinant expression of enzymes and preparation of crude enzyme solution: pET-28a protein expression plasmid and E. coli BL21(DE3) (Beijing Zixingjin Biotechnology Co., Ltd.) host were used to express recombinant proteins. For plasmid construction, 28a-F and 28a-R primers were used to amplify the plasmid backbone with pET-28a plasmid as the template; ilvBN-F and ilvBN-R primers were used to amplify the corresponding ilvBN gene fragments with plasmids containing the corresponding wild type or mutants (I22R and S41W) as the templates; the two fragments were recovered and ligated using a NuvaOne one-step recombination kit, and then transformed into E. coli Trans-T1 (Beijing Zixingjin Biotechnology Co., Ltd.). The transformants were verified by PCR and sequencing, and the expression plasmids pET-WT, pET-I22R and pET-S41W were obtained. The above expression plasmids were transformed into E. coli BL21(DE3) to obtain recombinant expression strains. The recombinant expression strains were cultured overnight in LB medium, inoculated into 40 mL LB liquid medium containing 50 μg / mL kanamycin at a 1% inoculation amount, and cultured in a 500 mL flask at 37°C, 220 rpm on a shaker until the OD600 reached 0.6-0.8. Then, 1 mM IPTG was added to induce expression, and the culture was continued for 4-6 hours. The cells were harvested by centrifugation at 4°C, 5000 rpm for 10 minutes, and the cell pellets were stored at -20°C. The cell pellets were resuspended in 50 mM potassium phosphate buffer (pH 7.0) containing 0.1 mM pyridoxal phosphate (PLP), and the cells were broken by sonication. The supernatant was collected by centrifugation at 4°C, 12,000 rpm for 30 minutes, and the crude enzyme solution was obtained. 600The IPTG was added to a final concentration of 0.5 mM, and the recombinant protein was induced by culturing at 16°C, 220 rpm for 16 h. The recombinant expression bacteria were washed twice with 100 mM potassium phosphate buffer (pH 7.4), and then resuspended to the same bacterial concentration. The supernatant collected by ultrasonic disruption and centrifugation at 12000 rpm for 15 min at 4°C was the crude enzyme solution. The primers used in this example are shown in Table 8.

[0058] Table 8. Primers used for construction of the recombinant expression plasmid of acetohydroxy acid synthase

[0059] Primer Nucleotide sequence 28a-F CTCGAGCACCACCACCACCAC 28a-R GCTGCTGTGATGATGATGATG ilvBN-F CATCATCATCATCACAGCAGCGTGAATGTGGCAGCTTCTCAAC ilvBN-R TGGTGGTGGTGGTGCTCGAGTTAGATCTTGGCCGGAGCCATG

[0060] The enzyme activity determination system of acetohydroxy acid synthase was: 100 mM potassium phosphate buffer (pH 7.4), 50 mM sodium pyruvate, 10 mM MgCl2, 100 μM thiamine pyrophosphate (TPP) and 100 μM flavin adenine dinucleotide (FAD), appropriate amount of crude enzyme solution and corresponding concentration of inhibitors. The change in OD 525nm The change in absorbance was measured by a microplate reader at 37°C. The enzyme activity of each mutant or wild type without adding inhibitors was set to 100%, and the residual relative enzyme activity after adding inhibitors was calculated respectively. The enzyme activity unit was defined as follows: the amount of enzyme required to produce 1 nanomole of product per minute, which was 1 U. The specific enzyme activity referred to the catalytic activity of enzyme contained in each milligram of crude enzyme. Three parallel experiments were set.

[0061] The residual relative enzyme activity of wild type and mutant enzymes under the condition of adding each of 10 mM L-valine, L-leucine and L-isoleucine inhibitors is shown in Table 9. The relative enzyme activity of wild type WT enzyme after adding 10 mM inhibitors was 42 ± 13%, while the mutants I22R and S41W still had 80 ± 9% and 90 ± 2% activity, respectively, after adding 10 mM inhibitors, indicating that the mutants of the application can simultaneously relieve the feedback inhibition of L-valine, L-leucine and L-isoleucine, which is beneficial to the efficient production of L-valine, L-leucine and L-isoleucine and their derivatives.

[0062] Table 9. Residual relative enzyme activity of wild type and mutant enzymes under the condition of adding and not adding inhibitors

[0063]

[0064] The above describes the embodiments of the application. However, the application is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the application shall be included in the protection scope of the application.

Claims

1. An acetyl-hydroxy acid synthase mutant, characterized in that, the amino acid sequence of the mutant is based on the amino acid sequence shown in SEQ ID NO: 2, and is mutated to be any one of arginine or lysine at position 22, or any one of arginine, tryptophan, phenylalanine, or leucine at position 41.

2. A gene encoding the acetyl-hydroxy acid synthase mutant according to claim 1.

3. A recombinant expression vector containing the gene encoding according to claim 2.

4. A recombinant microorganism containing the gene encoding according to claim 2 or the recombinant expression vector according to claim 3.

5. The recombinant microorganism of claim 4, wherein, The recombinant microorganism is a microorganism of the genus Corynebacterium that produces branched-chain amino acids.

6. The recombinant microorganism of claim 5, wherein, The recombinant microorganism is Corynebacterium glutamicum.

7. Use of the acetyl-hydroxy acid synthase mutant according to claim 1 or the recombinant microorganism according to claims 5-6 in the production of branched-chain amino acids.

8. A method of producing branched chain amino acids, characterized by, The method includes culturing the recombinant microorganism of claim 4 or 5 to produce branched-chain amino acids, and further includes the step of isolating or extracting the branched-chain amino acids from the culture medium.

9. The method of claim 8, wherein, The branched-chain amino acids are selected from one or more of L-leucine, L-isoleucine, and L-valine.

Images