Corn salt tolerance related gene, molecular marker and application

Abstract

The invention provides a corn salt resistance related gene. The nucleotide sequence of the gene is selected from (a) a sequence as shown in SEQ ID NO.1; (b) a nucleotide sequence which is obtained by substituting, deleting and / or adding one or more nucleotides to the sequence as shown in SEQ ID NO.1 and expresses protein with the same function; the invention also provides a molecular marker related to the gene and a method for identifying salt resistance of corn. According to the technical scheme, the salt resistance of the corn can be accurately, simply and conveniently identified in the early stage, and the corn breeding process is accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a corn salt tolerance related gene, a molecular marker and an application. Background Art

[0002] Salt-alkali stress is one of the abiotic stresses with wide distribution and great harm to agriculture, which affects all stages of plant growth and development. When plants suffer from salt stress, the seed germination rate decreases, the root growth is inhibited, the rooting becomes shallower, the absorption of nutrient elements is inhibited, the ion homeostasis in the plant body is destroyed, and the plant metabolism is disordered; the death of old leaves is accelerated, and the growth of new leaves is severely inhibited, resulting in weakened leaf photosynthesis, causing flower abortion and decreased fruiting rate in the reproductive growth stage, and ultimately resulting in reduced crop yields. However, the current basic theoretical research on salt-alkali tolerant corn biological breeding is lagging behind and the available gene resources are scarce. Therefore, I need to fully tap the excellent salt-tolerant gene resources of corn to select and create excellent salt-tolerant varieties.

[0003] Plant salt-alkali stress response is a complex biological process (Yang and Guo, 2018; Gong et al., 2020). Existing knowledge shows that the salt-alkali tolerance response of corn is mainly reflected in osmotic regulation, deionization toxicity, active oxygen scavenging, and transmembrane H + Gradient maintenance and other aspects (Liang et al, 2023). High concentrations of salt in soil or water will cause osmotic stress. Excessive salt will reduce the water potential of the roots and the ability of plants to absorb water (Hasegawa et al., 2000), leading to plant water loss (Yang and Guo, 2018). In addition, plants will also maintain plant water potential by synthesizing osmotic regulating substances. Existing studies have shown that when plants are subjected to salt stress, the concentration of betaine increases rapidly to maintain the osmotic balance between the cytoplasm and the vacuole and avoid cell dehydration (Chen and Murata, 2008).

[0004] In animals, plants, and some bacteria, glycine betaine is synthesized through a two-step process from choline, i.e., choline is oxidized to betaine aldehyde (BA) by choline dehydrogenase (CDH, in animals) or choline monooxygenase (CMO, in plants), and then betaine aldehyde is catalyzed by betaine aldehyde dehydrogenase (BADH) to form glycine betaine. In plants such as Chenopodiaceae and Poaceae, GB is produced by a two-step reaction of choline and betaine aldehyde (Hanson and Scott 1980, Hanson and Wyse 1982). However, the accumulation of GB and the presence of functional CMO and BADH are not detected in all plants. In some plants, such as alfalfa, barley, soybean, cotton, corn, pea, sorghum, spinach, strawberry, and wheat, GB accumulation can be detected; however, in Arabidopsis, eggplant, potato, tomato, rice and other plants, GB accumulation cannot be detected even under abiotic stress. (Kurepin, Ivanov et al. 2015, Annunziata, Ciarmiello et al. 2019). So far, CMO and BADH have only been found in Chenopodiaceae and Amaranthaceae plants. It is speculated that other choline oxidases may exist in plants of other families to replace CMO to perform this function (Russell, Rathinasabapathi et al. 1998). Therefore, it is very likely that new synthases and synthetic pathways exist in higher plants to synthesize GB, and related research needs to be further carried out.

[0005] Under stress conditions, searching for salt-tolerant high-betaine materials and developing molecular markers through bioinformatics methods is a feasible way to achieve crop improvement, which can provide more possibilities for crop improvement (Fang et al., 2016; Kumar et al., 2017). Summary of the invention

[0006] In order to overcome the shortcomings of existing technologies:

[0007] In one aspect, the present invention provides a corn salt tolerance-related gene, wherein the nucleotide sequence of the gene is selected from:

[0008] (a) the sequence shown in SEQ ID NO.1;

[0009] (b) A nucleotide sequence in which one or more nucleotides are replaced, deleted and / or added to the sequence shown in SEQ ID NO. 1 and the nucleotide sequence expresses a protein with the same function.

[0010] The "replacement, deletion and / or addition of one or more nucleotides and expression of proteins with the same function" can be achieved by those skilled in the art with conventional knowledge and techniques in the field of proteins and genes, including but not limited to amino acid codons, amino acid classification, protein structure analysis and function prediction knowledge and corresponding tools.

[0011] On the other hand, the present invention provides a protein encoded by the above-mentioned corn salt tolerance related gene, and its amino acid sequence is shown as SEQ ID NO.2.

[0012] Regarding the above-mentioned corn salt tolerance-related genes, the inventors of the present invention found that there were significant differences in salt tolerance and glycine betaine content among different inbred lines in the GWAS population. Using the GWAS population as material, the present invention cloned the corn glycine betaine synthesis gene ZmGB1 (Glycine Betaine 1) by using GWAS analysis and other bioinformatics methods. The coding region of this gene is 921 bp in length (see SEQ ID No. 1 for the detailed sequence) and encodes 306 amino acids (see SEQ ID No. 2 for the detailed sequence).

[0013] On the other hand, the present invention provides a corn salt tolerance QTL, characterized in that the QTL is located at position 87677579-87677606 on chromosome 3.

[0014] On the other hand, the present invention provides a molecular marker related to corn salt tolerance, wherein the molecular marker is a nucleotide sequence shown in SEQ ID NO.3 or SEQ ID NO.4, which shows SEQ ID NO.3 type or SEQ ID NO.4 type in the above-mentioned corn salt tolerance related gene or corn salt tolerance QTL.

[0015] Furthermore, the individual whose salt-tolerance QTL has the nucleotide sequence shown in SEQ ID No.3 is salt-tolerant; and the individual whose salt-tolerance QTL has the nucleotide sequence shown in SEQ ID No.4 is salt-sensitive.

[0016] On the other hand, the present invention provides a kit for identifying whether corn is salt-tolerant, the kit comprising a primer pair ZmGB1-F1 and a primer ZmGB1-R1 for detecting the above-mentioned molecular marker:

[0017] Primer ZmGB1-F1: GCAGACGTACGTAGGCAGAA (SEQ ID NO. 11);

[0018] Primer ZmGB1-R1: CTGTCTCAGCCCACGTCAT (SEQ ID NO. 12).

[0019] Furthermore, the kit also includes enzymes and other reagents for PCR amplification, so as to perform PCR amplification using the above primer pairs. The enzymes and other reagents for PCR amplification include, but are not limited to, various polymerases, dNTPs, buffers, etc. These reagents can be commercially available finished reagents or kits, or can be self-configured and designed according to reference books in the field of molecular biology such as "Molecular Cloning".

[0020] In another aspect, the present invention provides a method for identifying whether corn is salt tolerant, the method comprising:

[0021] (1) extracting genomic DNA of the corn to be tested;

[0022] (2) Amplify maize genomic DNA using the following primer pairs:

[0023] Primer ZmGB1-F1: GCAGACGTACGTAGGCAGAA (SEQ ID NO. 11),

[0024] Primer ZmGB1-R1: CTGTCTCAGCCCACGTCAT (SEQ ID NO. 12);

[0025] (3) Determine whether the corn to be tested is salt-tolerant based on the amplification results: if a 119 bp fragment is obtained by amplification, the corn to be tested is salt-tolerant; if a 110 bp fragment is obtained by amplification, the corn to be tested is salt-sensitive.

[0026] Furthermore, the nucleotide sequence of the 119 bp fragment is SEQ ID NO.3, and the nucleotide sequence of the 110 bp fragment is SEQ ID NO.4.

[0027] Furthermore, the PCR system used for amplification in step (2) is a 20 μl system, including: 2×Super MultiplexPCR Mix 10 μl, 10 μM Primer ZmGB1-F1 1 μl, 10 μM Primer ZmGB1-R1 1 μl, extracted corn genomic DNA 1 μl, diH2O 7 μl

[0028] Furthermore, the PCR program used for amplification in step (2) is: first, pre-denaturation at 94°C for 2 min; then, 34 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s; and finally extension at 72°C for 5 min.

[0029] Furthermore, in step (3), the amplification results are observed by electrophoresis, enzyme digestion or sequencing.

[0030] Furthermore, in step (1), corn seeds are used to extract genomic DNA of the corn to be tested.

[0031] On the other hand, the present invention provides the use of the above-mentioned kit, molecular marker or method in salt-tolerant corn breeding.

[0032] Furthermore, in the application, salt-tolerant corn is used for breeding.

[0033] Beneficial effects:

[0034] (1) The present invention provides a new major effect QTL for corn salt tolerance, and the nucleotide sequence of the salt tolerance QTL gene related thereto. In the salt tolerance QTL gene, a fragment located in its intron that is deleted or inserted and linked to corn salt tolerance is identified. The insertion or deletion of the fragment can be used as a molecular marker for corn salt tolerance. The present invention also provides a primer pair and a kit for detecting the corn salt tolerance molecular marker of the present invention, and a method for detecting whether corn is salt tolerant.

[0035] (2) Since salt tolerance in maize is a quantitative trait, phenotypic analysis is time-consuming and laborious. The above-mentioned major QTL for salt tolerance in maize, QTL genes for salt tolerance, molecular markers, primer pairs and kits can be applied to maize salt tolerance breeding. They can be identified during the seed period or the early stage of cotyledon growth, which is time-saving and accurate, and can accelerate the breeding process of salt-tolerant maize varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 It shows the main salt-tolerance site determined by GWAS population analysis in the salt-tolerance gene ZmGB1, and the location of its related gene ZmGB1 (Part A); a schematic diagram of the PbCXUN-Myc-ZmGB1 vector structure (Part B); and detection of overexpression levels in overexpression strains (Part C).

[0037] Figure 2 Schematic diagram of the structure of the ZmGB1 gene.

[0038] Figure 3 Wild-type and ZmGB1 overexpressing plants (ZmGB1) grown under control or salt conditions for 2 weeks OE -1, ZmGB1 OE -2) (Part A); Wild-type and ZmGB1 overexpressing plants (ZmGB1) grown under control or salt conditions for 2 weeks OE -1, ZmGB1 OE -2) (Part B); wild-type and ZmGB1 gene overexpressing plants (ZmGB1 OE -1, ZmGB1 OE -2) biomass determination results (Part C).

[0039] Figure 4 Results of association analysis of ZmGB1 genes resequencing and re-identification of candidate genes in different maize inbred lines.

[0040] Figure 5 Identification of nucleotide sequences that differ between susceptible materials (B73 and Zheng 58); Part A is the location of the identified missing fragment ZmGB1-Del; Part B is the sequence comparison of the PCR fragments amplified from haplotype 1 (taking B73 as an example) and haplotype 2 (taking Zheng 58 as an example) and the locations of primers ZmGB1-F1 and ZmGB1-R1 used to amplify the missing fragment.

[0041] Figure 6 The results are shown in Figure 1, which are the results of PCR amplification in B73 and Zheng 58 using a pair of primers (primer pair I).

[0042] Figure 7 The results are a comparison of the compound glycine betaine content and biomass of the salt-tolerant maize inbred line hap1 and the salt-sensitive maize inbred line hap2. DETAILED DESCRIPTION

[0043] The following examples are provided to facilitate a better understanding of the present invention, but are not limited thereto. These examples are only used for illustrative purposes and in no way limit the scope of protection of the present invention.

[0044] Unless otherwise specified, the equipment and reagents used in each example are commercially available.

[0045] Example 1 Cloning and functional analysis of corn salt tolerance genes

[0046] There are significant differences in salt tolerance among different inbred lines, and the glycine betaine content is different under 100mM NaCl treatment. Using the betaine content as a physiological indicator, a genome-wide association analysis was performed, and a site with a significant effect value was found at position 87677578 on chromosome 3. This peak SNP is located on the gene ZmGB1, which is a gene encoding aldehyde oxygenase, such as Figure 1 As shown in Part A.

[0047] In order to obtain ZmGB1 overexpression plants, (1) based on the prediction of the ZmGB1 gene structure on the MaizeGDB website, the full length of the gene (from the start codon to the stop codon) is 1729 bp, including five exons and four introns, of which the coding region sequence is 921 bp in length (SEQ ID NO.1, the encoded protein sequence is SEQ ID NO.2), as shown in Figure 2(2) To clone the full-length coding sequence of ZmGB1, 10-day-old salt-tolerant maize inbred line B73 seedlings were used as materials, and total RNA was extracted using the plant total RNA extraction kit (Cat.# DP432) of Tiangen Biochemical Technology (Beijing) Co., Ltd., and cDNA was obtained by reverse transcription using M-MLV reverse transcriptase of Promega (Beijing) Biotechnology Co., Ltd., and ZmGB1-specific primers (forward primer ZmGB1-gene-F: AATACTATGATCCCCTACGCGACTGCG (SEQ ID No. 5); reverse primer ZmGB1-gene-R: AATACTTCAGGCACAAAAATATCTG (SEQ ID No.6) was used for PCR amplification, and a product with the expected size (933 bp) was obtained. The PCR product was recovered and purified using the gel recovery kit (Cat.#DP105-3) of Tiangen Biochemical Technology (Beijing) Co., Ltd.; (3) The recovered PCR fragment was connected with the pBCXUN-Myc vector digested with XcmⅠ, and the ligation product was transferred into Escherichia coli. The primers Ubip-seq-F (TTTTAGCCCTGCCTTCATACGC SEQ ID No.7) and NosR-seq-R (AGACCGGCAACAGGATTCAATC SEQ ID No.8) on the vector were used for colony PCR amplification. The colonies with the target size bands detected by electrophoresis were positive clones, and the corresponding bacterial liquid was sent to Beijing Sanbo Yuanzhi Biotechnology Co., Ltd. for sequencing to obtain the correct pBCXUN-Myc-ZmGB1 vector ( Figure 1 (B) pBCXUN-Myc-ZmGB1 was transferred into Agrobacterium EHA105; (3) transgenic plants were obtained by embryo infection; (4) the expression level of ZmGB1 gene in the plants was detected ( Figure 1 Finally, two ZmGB1 candidate gene overexpression materials (named ZmGB1 OE -1 and ZmGB1 OE -2). Figure 3 As shown in part A, it shows that the ZmGB1 gene overexpression plants are no different from the wild type under normal conditions, but show a more salt-tolerant phenotype under salt stress.

[0048] Bioinformatics predicts that ZmGB1 encodes an aldehyde oxygenase. The content of glycine betaine, the main regulatory compound of ZmGB1, was determined by phenotypic experiments on metabolite content. The specific experimental process is as follows: (1) Take the aboveground part of the ZmGB1 overexpressing plant that has grown for 12 days, freeze it in liquid nitrogen and grind it; (2) Weigh 2 portions of 100 mg powder in a 1.5 ml centrifuge tube, add 1 ml MeOH to one portion and 1 ml 75% MeOH to the other portion, and extract it at low temperature and ultrasonically for 30 minutes; (3) Take 700 μl of each sample extracted with different extraction solutions, mix them, and shake them at low temperature for 1 hour; (4) After centrifugation, take 600 μl of liquid, put them in 1.5 ml centrifuge tubes respectively, and dry them on a rotary evaporator for 3 hours; (5) Add 100 μl 50% MeOH to each portion for re-dissolution, filter the membrane on the machine, and count the content of the compound in the sample. Figure 3 As shown in part B, the content of glycine betaine compounds in the aerial parts of ZmGB1 overexpressing plants was significantly increased, indicating that the salt-tolerant gene aldehyde oxygenase GB1 is a candidate gene affecting the betaine content of plants.

[0049] At the same time, the biomass measurement experiment of ZmGB1 overexpressing plants showed that plants with high glycine betaine content were more salt tolerant ( Figure 3 The specific experimental process is as follows: take the aboveground part of the ZmGB1 gene overexpressing plant grown for 12 days and weigh the fresh weight. Figure 3 As shown in Part C, the biomass of the aboveground part of the ZmGB1 gene overexpressing plant was significantly increased compared with the wild type, indicating that the salt tolerance gene ZmGB1 can regulate the salt tolerance of maize by regulating the synthesis of the compound glycine betaine under salt stress.

[0050] Example 2 Obtaining the Natural Variation Fragment (ZmGB1-Del16) of Maize Salt Tolerance QTL Gene ZmGB1

[0051] Based on the SNP with the highest effect value in the GWAS of glycine betaine, candidate gene association analysis was performed on the resequencing results of 160 inbred lines, and the genome sequences of ZmGB1 in the backbone inbred lines B73 and Zheng 58 were analyzed. It was found that Del16 (a 11994 bp deletion / insertion) was significantly correlated with glycine betaine content, such as Figure 4As shown in part A of . Taking B73 and Zheng 58 as examples, the ZmGB1 gene was resequenced (sequencing was completed at Beijing Qingke Xinye Biotechnology Co., Ltd.). By comparing the genome resequencing data of B73 and Zheng 58, it was found that in the inbred line B73, there was a 11994bp deletion on the promoter of the ZmGB1 gene, named ZmGB1-Del16 (the relevant sequences of B73 and Zheng 58 are shown in SEQ ID NO.9 and SEQ ID NO.10, which contain part of the genome sequence). According to the presence or absence of Del16, the 160 materials were divided into two haplotypes Hap1 and Hap2.

[0052] q-PCR results showed that there were significant differences in the transcription levels of ZmGB1 between inbred lines containing Del16 and those without Del16, such as Figure 4 As shown in part E, Del16 caused changes in the transcription level of ZmGB1, which further affected the content of glycine betaine and the salt tolerance of corn inbred lines.

[0053] Example 3 The fragment on the maize salt tolerance gene ZmGB1 is completely linked to ZmGB1-Del16 as a molecular marker

[0054] Resequencing of 160 inbred lines and candidate gene association analysis revealed the existence of fragments ZmGB1M1 and ZmGB1-Del16, which were completely linked to the resequencing detected snp Chr3_87676195. The candidate gene association results showed that the actual site that led to the transcription level of ZmGB1 was ZmGB1-Del16, but due to the large fragment, it was difficult to detect. We used the natural variant ZmGB1M1 that was completely linked to it to distinguish the haplotypes of ZmGB1.

[0055] Primers ZmGB1-F1 (forward) and ZmGB1-R1 (reverse) designed based on the flanking sequence of ZmGB1M1 were used to form primer pair I (ZmGB1-F1 / ZmGB1-R1). PCR amplification was performed using primer pair I as primers and genomic DNA of maize inbred line Zheng 58 and maize inbred line W156 as templates. PCR system 20μl: 2×Super MultiplexPCR Mix 10μl, 10μM Primer ZmGB1-F1 1μl, 10μM Primer ZmGB1-R1 1μl, DNA 1μl, diH2O7μl. PCR program: pre-denaturation at 94℃ for 2min, denaturation at 94℃ for 30s, annealing at 56℃ for 30s, extension at 72℃ for 30s, 34 cycles from denaturation to extension, and final extension at 72℃ for 5min. The results showed that when the maize inbred line B73 was used as a template for PCR amplification, primer pair I could obtain a band of 119 bp (see SEQ ID NO.3 for the detailed sequence); when the maize inbred line Zheng 58 total DNA was used as a template for PCR amplification, primer pair I could obtain a band of 110 bp (see SEQ ID NO.4 for the detailed sequence). Figure 6 As shown. Therefore, primer pair I can be used for salt-tolerant molecular assisted breeding of maize, and the salt-tolerant molecular marker based on primer pair I is named ZmGB1M1. The sequences of the primers are:

[0056] Primer ZmGB1-F1: GCAGACGTACGTAGGCAGAA;

[0057] Primer ZmGB1-R1: CTGTCTCAGCCCACGTCAT.

[0058] Example 4 Detecting whether corn is salt-tolerant using salt-tolerant molecular markers

[0059] 50 kinds of corn inbred line materials (including some corn backbone inbred lines) were selected for detection. The detection method was as described in Example 3. The primer pair for detecting the salt-tolerant molecular marker of the present invention in Example 3 was used to perform PCR amplification with the genomic DNA of the corn to be tested as a template. The results showed that the PCR product length of 25 inbred line primer pair I was 119 bp, which was a salt-tolerant genotype; the PCR product length of the other 25 inbred line primer pair I was 110 bp, which was a salt-sensitive genotype. The names of the inbred lines used and the identification results are shown in the following table:

[0060] Table 1 Identification results of inbred lines

[0061]

[0062]

[0063] Under salt stress conditions, the glycine betaine content in the leaves of the salt-tolerant genotype material (hap1, with ZmGB1-Del16 deletion, ZmGB1M1 is SEQ ID NO.3) was significantly higher than that of the salt-sensitive genotype material (hap2, without ZmGB1-Del16 deletion, ZmGB1M1 is SEQ ID NO.4); at the same time, the biomass decline rate of the salt-tolerant genotype material (hap1, with ZmGB1-Del16 deletion, ZmGB1M1 is SEQ ID NO.3) was significantly lower than that of the salt-sensitive genotype material (hap2, without ZmGB1-Del16 deletion, ZmGB1M1 is SEQ ID NO.4). Figure 7 As shown, it is consistent with the results of salt-tolerance molecular marker identification.

Claims

1. A gene related to corn salt tolerance, characterized in that: The nucleotide sequence of the gene is selected from: (a) the sequence shown in SEQ ID NO.1; (b) A nucleotide sequence in which one or more nucleotides are replaced, deleted and / or added to the sequence shown in SEQ ID NO. 1 and the nucleotide sequence expresses a protein with the same function.

2. The protein encoded by the corn salt tolerance related gene according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. Maize salt tolerance QTL, characterized by: The QTL is located at position 87677579-87677606 on chromosome 3.

4. A molecular marker related to salt tolerance in maize, characterized in that: The nucleotide sequences of the molecular markers are SEQ ID NO.3 and SEQ ID NO.4, and in the maize salt tolerance QTL according to claim 3, they show SEQ ID NO.3 type or SEQ ID NO.4 type.

5. According to the molecular marker of claim 4, the individual whose salt-tolerance QTL has the nucleotide sequence shown in SEQ ID No.3 is salt-tolerant; the individual whose salt-tolerance QTL has the nucleotide sequence shown in SEQ ID No.4 is salt-sensitive.

6. A kit for identifying whether corn is salt-tolerant, characterized in that: The kit comprises a primer pair ZmGB1-F1 and a primer ZmGB1-R1 for detecting the molecular marker according to claim 4: Primer ZmGB1-F1: GCAGACGTACGTAGGCAGAA (SEQ ID NO. 11); Primer ZmGB1-R1: CTGTCTCAGCCCACGTCAT (SEQ ID NO. 12).

7. A method for identifying whether corn is salt-tolerant, characterized in that: The method comprises: (1) extracting genomic DNA of the corn to be tested; (2) Amplify maize genomic DNA using the following primer pairs: Primer ZmGB1-F1: GCAGACGTACGTAGGCAGAA (SEQ ID NO. 11), Primer ZmGB1-R1: CTGTCTCAGCCCACGTCAT (SEQ ID NO. 12); (3) Determine whether the corn to be tested is salt-tolerant based on the amplification results: if a 119 bp fragment is obtained by amplification, the corn to be tested is salt-tolerant; if a 110 bp fragment is obtained by amplification, the corn to be tested is salt-sensitive.

8. The method according to claim 7, wherein the nucleotide sequence of the 119 bp fragment is SEQ ID NO.3, and the nucleotide sequence of the 110 bp fragment is SEQ ID NO.

4.

9. The method according to claim 7, wherein the PCR system used for amplification in step (2) is a 20 μl system comprising: 2×Super Multiplex PCR Mix 10μl, 10μM Primer ZmGB1-F1 1μl, 10μM Primer ZmGB1-R11μl, extracted corn genomic DNA 1μl, diH2O 7μl; the PCR program used for amplification in step (2) is: first, pre-denaturation at 94℃ for 2min; then, 34 cycles: denaturation at 94℃ for 30s, annealing at 56℃ for 30s, extension at 72℃ for 30s; finally extension at 72℃ for 5min.

10. The molecular marker according to claim 4 or 5, Use of the kit according to claim 6 or the method according to any one of claims 7 to 9 in salt-tolerant corn breeding.

Images