Gene editing vector, and construction method and application of gastric cancer cell model

Abstract

The invention relates to the technical field of biological medicine, in particular to a gene editing vector and a construction method and application of a gastric cancer cell model. The gene editing vector is used for expressing Cas9 enzyme and sgRNA; the sgRNA is sgRNA1 (small guide RNA 1) or sgRNA3 (small guide RNA 3); the sgRNA1 is formed by splicing the sgRNA1-F and the sgRNA1-R, and the sgRNA1-F and the sgRNA1-R are used The sgRNA3 is formed by splicing the sgRNA3-F and the sgRNA3-R, and the sgRNA3-F and the According to the present invention, the CRISPR / Cas9 technology is adopted to target the STK39 gene exon so as to construct the gene editing vector, such that the STK39 gene knockout SGC-7901 cell strain is obtained; the STK39 gene knockout SGC-7901 cell strain establishes an effective gastric cancer cell model for the related research of the gastric cancer endogenous STK39 gene.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a gene editing vector, a method for constructing a gastric cancer cell model and applications thereof. Background Art

[0002] Gastric cancer, also known as gastric cancer, is a serious malignant tumor. Its severity is reflected in its high incidence, high mortality and difficulty in treatment. Since the early symptoms of gastric cancer are not obvious, it is often in the middle and late stages when diagnosed, and its mortality rate remains high, and the difficulty and risk of treatment are significantly increased. In addition, the prognosis of gastric cancer is poor, and even after active treatment, the patient's survival rate may be seriously affected.

[0003] Serine / Threonine Kinase 39, English name is Serine / Threonine Kinase 39, English abbreviation is STK39. It is overexpressed in a variety of tumor tissues and plays an important role in the occurrence and development of tumors. Studies have shown that STK39 is highly expressed in cholangiocarcinoma CCA and is negatively correlated with the prognosis of CCA patients. Functionally, knocking down STK39 inhibits cell proliferation, migration and invasion, while overexpressing STK39 promotes tumor invasion. In vivo experiments also verified the carcinogenic effect of STK39 in CCA. STK39 promotes the progression of CCA by activating the PI3K / AKT signaling pathway. It shows that STK39 can be used as a valuable prognostic candidate molecule and potential therapeutic target for CCA. In summary, it is necessary to develop and construct a vector that can accurately knock out the STK39 gene to study the biological effects of the STK39 gene on gastric cancer cell lines. Summary of the invention

[0004] To solve the above problems, the present invention provides a gene editing vector, a method for constructing a gastric cancer cell model and its application.

[0005] The present invention is achieved through the following technical solutions:

[0006] On the one hand, the present invention provides a gene editing vector, which expresses Cas9 enzyme and sgRNA.

[0007] The sgRNA is sgRNA1 or sgRNA3.

[0008] The sgRNA1 is spliced ​​by sgRNA1-F and sgRNA1-R; the sgRNA1-F is shown in SEQ ID No.2; and the sgRNA1-R is shown in SEQ ID No.3.

[0009] The sgRNA3 is spliced ​​by sgRNA3-F and sgRNA3-R; sgRNA3-F is shown as SEQ ID No.4; sgRNA3-R is shown as SEQ ID No.5.

[0010] Preferably, the linearized PX459 vector is digested with BbsI, and the annealed product of sgRNA is ligated with T4 ligase to construct a gene editing vector including a Cas9 expression cassette and an sgRNA expression cassette.

[0011] Preferably, the gene editing vector is used to construct a gastric cancer cell model with STK39 gene knockout.

[0012] Preferably, the STK39 gene knockout refers to knocking out the second exon fragment of the STK39 gene using a gene editing vector.

[0013] The second aspect of the present invention provides a method for constructing a gastric cancer cell model, comprising transfecting the gene editing vector into gastric cancer cells, successfully knocking out the second exon fragment of the target gene STK39 in the gastric cancer cells, and obtaining the gastric cancer cell model; the gastric cancer cells are SGC-7901 cells.

[0014] The gastric cancer cell model constructed by the construction method.

[0015] Preferably, the gastric cancer cell model is used in screening drugs for treating gastric cancer.

[0016] Preferably, by performing transcriptome sequencing analysis on the gastric cancer cell model, detecting targets in related pathways that cause upregulation or downregulation of STK39 gene expression, matching targets with drugs, screening out drugs that have a regulatory effect on STK39-related pathways as candidate drugs, and detecting the effects of candidate drugs on gastric cancer treatment to determine gastric cancer treatment drugs.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] (1) Compared with zinc finger nucleases (ZFNs) and transcription activator-like effector molecules (TALENs), CRISPR / Cas9 technology is more efficient, rapid, simple, and inexpensive. CRISPR / Cas9 technology can be used to quickly, efficiently, and inexpensively construct the knockout of the STK39 gene in SGC-7901 cells.

[0019] (2) The present invention verifies that by transfecting SGC-7901 cells with the gene editing vector provided by the present invention, a stable SGC-7901 cell line with STK39 gene knockout can be constructed, thereby establishing a gastric cancer cell model for related research on the endogenous STK39 gene of gastric cancer.

[0020] (3) At the same time, the present invention studies the biological characteristics of STK39 knocked-out SGC-7901 cells, using SGC-7901 wild-type cells as a reference, using CCK8 experiments to detect the effect of STK39 on cell proliferation, and using cell scratch and Transwell experiments to detect the effect on cell migration and invasion. Compared with SGC-7901 wild-type cells, the proliferation, migration and invasion abilities of the STK39 knocked-out SGC-7901 cell line were weakened, further confirming that endogenous STK39 in cells can be used as an effective target for gastric cancer treatment, indicating that active ingredients that inhibit / block the endogenous STK39 regulatory pathway in tumor cells can be used to prepare gastric cancer therapeutic agents. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 This is a verification and linearization diagram of the Cas9 vector backbone PX459 in Example 1 of the present invention;

[0023] Figure 1 In the figure, A is an agarose gel electrophoresis of the PX459 plasmid, wherein from left to right are PX459, PX459 and Marker lanes; B is an agarose gel electrophoresis of PX459 after BbsI digestion, wherein from left to right are PX459 after digestion, PX459 after digestion, PX459 after digestion, PX459 after digestion, PX459 and Marker lanes;

[0024] Figure 2 This is a sequencing diagram of the successful connection of sgRNA to linearized PX459 in Example 1 of the present invention;

[0025] Figure 2 In the figure, A is the connection sequencing map of STK39-sgRNA1 and PX459; B is the connection sequencing map of STK39-sgRNA2 and PX459; Figure C is the agarose gel electrophoresis map after the plasmids were extracted from the two vectors, in which the lanes from left to right are Marker, lenti-STK39-1 and lenti-STK39-3 respectively;

[0026] Figure 3 The sequencing results of the three SGC-7901 knockout cell lines KO-1, KO-2, and KO-3 in Example 2 of the present invention are shown;

[0027] Figure 4 The qPCR results of the three SGC-7901 knockout cell lines KO-1, KO-2, and KO-3 in Example 2 of the present invention are shown;

[0028] Figure 5 The protein expression level diagram of the three SGC-7901 knockout cell lines KO-1, KO-2, and KO-3 in Example 2 of the present invention;

[0029] Figure 5 In the figure, A is the Western blot detection result; B is the quantification graph of the Western blot result;

[0030] Figure 6 This is a graph showing the CCK8 detection results of the three SGC-7901 knockout cell lines KO-1, KO-2, KO-3 and the SGC-7901 wild-type cell WT in Example 3 of the present invention;

[0031] Figure 7 The figure is a scratch test result diagram of the three SGC-7901 knockout cell lines KO-1, KO-2, KO-3 and SGC-7901 wild-type cells WT in Example 3 of the present invention (40 times);

[0032] Figure 7 In the figure, A is a microscope observation image; B is a bar graph comparison chart made based on the statistical data of the microscope observation image;

[0033] Figure 8 The figure is a microscope observation result of the Transwell migration detection experiment of the three SGC-7901 knockout cell lines KO-1, KO-2, KO-3 and the SGC-7901 wild-type cell WT in Example 3 of the present invention (100 times);

[0034] Fig. 9 This is a data statistical bar comparison chart based on microscope observation pictures of the Transwell migration detection experiment of the three SGC-7901 knockout cell lines KO-1, KO-2, KO-3 and SGC-7901 wild-type cells WT in Example 3 of the present invention;

[0035] Fig.10 The figure is a microscopic observation result of the Transwell invasion detection experiment of the three SGC-7901 knockout cell lines KO-1, KO-2, KO-3 and SGC-7901 wild-type cells WT in Example 3 of the present invention (100 times);

[0036] Fig.11This is a statistical bar chart comparing the data of the Transwell invasion assay of the three SGC-7901 knockout cell lines KO-1, KO-2, KO-3 and the SGC-7901 wild-type cell WT in Example 3 of the present invention based on microscopic observation images. DETAILED DESCRIPTION

[0037] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively below, and preferred embodiments of the present invention are provided. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0039] The inventive concept of the present invention is as follows:

[0040] CRISPR / Cas9 is the third generation of gene editing technology after the introduction of zinc finger nuclease ZFN, transcription activator-like effector molecule TALENs and other gene editing technologies. It has the advantages of high efficiency, simplicity, low cost, etc., and has become the most mainstream gene editing system today. The basic principle is to use guide RNA to guide the Cas9 enzyme to cut the DNA double strands, forming a DNA double-strand break, i.e. DSB, and then repair the broken DNA through non-homologous end joining, i.e. NHEJ, resulting in the insertion or deletion of bases, and ultimately making the protein expressed by the target gene lose its function.

[0041] Based on this, the present invention provides a gene editing vector, which expresses Cas9 enzyme and sgRNA.

[0042] The sgRNA is sgRNA1 or sgRNA3.

[0043] The sgRNA1 is spliced ​​by sgRNA1-F and sgRNA1-R; the sgRNA1-F is shown in SEQ ID No.2; and the sgRNA1-R is shown in SEQ ID No.3.

[0044] The sgRNA3 is spliced ​​by sgRNA3-F and sgRNA3-R; sgRNA3-F is shown as SEQ ID No.4; sgRNA3-R is shown as SEQ ID No.5.

[0045] The STK39 gene editing vector was constructed quickly, efficiently and at low cost using CRISPR / Cas9 technology. It can be used to study the effects of the STK39 gene on the biological characteristics of gastric cancer cell lines, such as proliferation, migration and invasion, and to construct a gastric cancer cell model.

[0046] Based on the same inventive concept, the present invention provides a method for constructing a gastric cancer cell model, wherein the gene editing vector is transfected into gastric cancer cells, and the exons of the target gene STK39 are successfully knocked out in the gastric cancer cells to obtain the gastric cancer cell model. By this method, the STK39 gene editing vector is transfected into SGC-7901 cells to achieve the knockout of the STK39 gene in the SGC-7901 cells, and a stable gastric cancer cell model with the STK39 gene knocked out is constructed, which is conducive to the subsequent discussion of the pathogenesis of gastric cancer affected by the STK39 gene, and provides important ideas for the future development of targeted drugs for gastric cancer treatment.

[0047] The technical solution of the present invention will be further described below in conjunction with specific embodiments.

[0048] All sequences presented in this application are oriented from 5' to 3'.

[0049] Example 1: Construction of STK39 gene knockout vector

[0050] The gene editing vector constructed in this example is based on CRISPR / Cas9 technology, and a single gRNA knockout target recombinant plasmid is constructed. The specific operation steps are as follows:

[0051] 1. Target primer design

[0052] Taking the human genome sequence as the target, the STK39 genome sequence was searched at http: / / www.ncbi.nlm.nih.gov, and the second exon sequence of the CDS region was selected through the common exon sequence of the transcript. Two pairs of sgRNAs were designed as shown in SEQ ID NO.1: STK39-sgRNA1-F, STK39-sgRNA1-R, STK39-sgRNA3-F, and STK39-sgRNA3-R.

[0053] SEQ ID NO.1:

[0054] GCAGTGGAGCTACTGCTGTGGTTCAGGCAGCCCTATGCAAACCCAGG CAAGAACGTGTAGCAATAAAACGGATCAACTTGGAAAAATGCCAGACCA GTATGGATGAACTATTA.

[0055] STK39-sgRNA1-F is shown in SEQ ID NO.2, which is: CACCGagcaataaaacggatcaact.

[0056] STK39-sgRNA1-R is shown in SEQ ID NO.3, which is: AAACagttgatccgttttattgctC.

[0057] STK39-sgRNA3-F is shown in SEQ ID NO.4, which is: CACCggaaaaatgccagaccagta.

[0058] STK39-sgRNA3-R is shown in SEQ ID NO.5, which is: AAACtactggtctggcatttttcc.

[0059] 2. Construction of knockout recombinant vector

[0060] 2.1 Linearized vector construction: The backbone vector for expressing Cas9 enzyme was PX459, which was purchased from Addgene. The vector includes two restriction endonuclease BbsI cleavage sites. PX459 was linearized using restriction endonuclease BbsI. The linearization enzyme system is shown in Table 1. It was added to the PCR tube according to the following system, then fully mixed and incubated at 37°C for more than 4 hours. The enzyme cleavage product was subjected to agarose gel electrophoresis. Figure 1 As shown, the gel containing the linearized vector is purified and recovered using a gel recovery kit for use.

[0061] Table 1 Linearization enzyme digestion system

[0062]

[0063]

[0064] 2.2 Phosphorylation of sgRNA primers: Phosphorylate the two pairs of synthesized sgRNA primers, the primer sequences are SEQ ID NO.2 to SEQ ID NO.5, and the phosphorylation reaction system is as shown in Table 2; add them into the PCR tube according to the following system, then mix them thoroughly, transfer the PCR tube to the PCR instrument and react according to the annealing temperature system in Table 3.

[0065] Table 2 Primer phosphorylation reaction system

[0066] Components Volume: 10 μL Forward: 100μM 1.0μL Reverse: 100 μM 1.0μL 10×T4LigationBuffer 1.0μL T4 Polynucleotide Kinase 0.5μL <![CDATA[ddH2O]]> 6.5μL

[0067] Table 3 Annealing temperature system

[0068] temperature Time: min 37℃ 30min 95℃ 5min 95℃～25℃ 5℃ / min

[0069] The reaction solution collected at the end is the phosphorylated double-stranded gRNA, and the product can be stored at -20°C.

[0070] 2.3 Connect the linearized vector: connect the two pairs of phosphorylated double-stranded gRNA fragments obtained in 2.2 and the linearized Cas9 expression vector obtained in 2.1. The connection system is shown in Table 4. Add them to the centrifuge tube in sequence according to the following system, then mix them thoroughly, transfer them to a PCR instrument and incubate them overnight at 16°C. The next day, transform the incubation product into Escherichia coli DH5α, prepare LB solid culture medium and liquid culture medium in advance, and add ampicillin at a ratio of 1:1000. Spread the Escherichia coli DH5α cells on the LA solid culture plate and place it in a constant temperature incubator at 37°C for 14 hours.

[0071] Table 4 Connection system

[0072]

[0073]

[0074] After 14 hours, expand the culture and carefully pick a single colony on the culture plate with a high-pressure matching pipette tip, then inject the pipette tip into a 50mL centrifuge tube containing 5mL LA liquid culture medium and mark them clearly. Place the centrifuge tube in a shaker and culture at 37℃, 220rpm for 14 hours.

[0075] After 14 hours, the bacterial solution should be turbid. At this time, collect the bacterial solution and preserve the bacteria. The steps for preserving the bacteria are as follows: first prepare 60% glycerol, mix the collected bacterial solution with 60% glycerol in equal proportions to form a glycerol bacterial solution, take 1.8mL of the glycerol bacterial solution into a high-pressure 2mL centrifuge tube, send the glycerol bacteria to the company for sequencing, and transfer the remaining glycerol bacteria to other high-pressure 2mL centrifuge tubes and store them in a -20℃ refrigerator. After the sequencing is complete, the correct plasmid is the expression vector containing sgRNA and Cas9, such as Figure 2 A and Figure 2 As shown in B, the glycerol bacteria corresponding to the vector correctly constructed by sequencing alignment was taken out from the -20℃ refrigerator, 1mL of glycerol bacteria was pipetted into a 50mL centrifuge tube containing 5mL of LA medium, and cultured at 37℃, 220rpm for 14h. After the bacterial solution became turbid, the plasmid was extracted according to the steps in the instructions of the Kangwei Century Small Extraction Plasmid Extraction Kit to obtain two successfully constructed gene editing vectors, as shown in Figure 2 As shown in C, named lenti-STK39-1 and lenti-STK39-3.

[0076] Example 2: Establishment of STK39 gene knockout SGC-7901 stable cell line

[0077] 1. Monoclonal cell line screening

[0078] 1.1 Selection of puromycin concentration: lenti-STK39-1 and lenti-STK39-3 vectors are resistant to puromycin and can be used for later screening of positive clone cell lines.

[0079] It is necessary to determine the minimum lethal dose of puromycin for normal cells. Different mammalian cells have different sensitivities and tolerance concentrations to puromycin. SGC-7901 cells were cultured at 2×10 5 The cells were plated at a density of 10 cells / mL in a 24-well plate. After 24 h, when the cell coverage rate reached 80%, puromycin was added at concentrations of 0 μg / mL, 6 μg / mL, 8 μg / mL, 10 μg / mL, 12 μg / mL, 14 μg / mL, 16 μg / mL, and 18 μg / mL. The culture was maintained for 7 days to observe the optimal concentration that could cause normal cell death. The optimal concentration was 10 μg / mL.

[0080] After determining the optimal concentration, SGC-7901 cells were again plated at 2×10 5 The cells were plated at a density of 10 cells / mL in a 24-well plate. After 24 hours, when the cell coverage rate reached 80%, the constructed gene editing plasmids lenti-STK39-1 and lenti-STK39-3 were co-transfected into SGC-7901 cells. To prevent off-target effects and uncertainties such as unsuccessful transfection, each vector was set up with 1 duplicate well, that is, each vector was transfected with 2 wells, and 1 well for co-transfection of two vectors and 1 duplicate well for co-transfection of two vectors were designed. The specific operation steps of transfection were carried out according to the instructions of lipofectamine2000 of biosharp company. After 48 hours, the cells were cultured in DMEM / high-glucose complete medium with a puromycin concentration of 10 μg / mL. The medium was changed every other day. After about 5 days, normal cells that were not transfected with the plasmid died. The cells were cultured in DMEM / high-glucose complete medium with a puromycin concentration of 6 μg / mL. The medium was changed every other day. After 14 days of screening, cell pools were obtained, expanded into 6-well plates, and frozen in time for subsequent experiments.

[0081] 1.2 Screening of monoclonal cells: Replace the cell pools obtained by screening with a culture medium without puromycin for expansion culture, and use the limiting dilution method to screen monoclonal cells. The specific implementation is as follows:

[0082] Limiting dilution: Digest the selected cell pool with trypsin, resuspend in culture medium, count, dilute the cell suspension in multiples until there are 200 cells in 10 ml culture medium, inoculate in 96-well plates, inoculate 100 ul of cell suspension in each well, about 3 cells per well on average, then observe the cells in each well daily for about a week, and typical aggregate growth will appear in single cells. Mark the wells where single cells grow, observe the cells in time, transfer cells that have reached the passage density to 24-well plates or 12-well plates, continue to expand the culture of monoclonal cells, and finally transfer to 6-well plates, freeze the cells in time to prevent contamination.

[0083] 2. Verification of monoclonal cell lines

[0084] 2.1 Genome-level sequencing verification

[0085] The expanded monoclonal cells were collected, and DNA genome was extracted using a DNA extraction kit, and PCR primers were designed 300 bp upstream and downstream of the second exon sequence of the STK39 genome containing the knockout site, and the sequences were shown in SEQ ID NO.6 and SEQ ID NO.7. PCR amplification was performed, and the amplification system was shown in Table 5.

[0086] SEQ ID NO.6 Forward primer: TGACTCTGTCTCTTAGGAGTCTG.

[0087] SEQ ID NO.7 Reverse primer: TAGATGGAGGGCCAGAAGCT.

[0088] Table 5 Amplification system

[0089] Components Volume: 20 μL DNA template amount 1.0μL Forward primer: 10 μM 0.8μL Reverse primer: 10 μM 0.8μL 2×PCRMasterMix 10μL <![CDATA[RNase-freeddH2O]]> 7.4μL

[0090] 4 μL of the amplified product was taken for agarose nucleic acid electrophoresis, and the remaining 16 μL was sent to the company for sequencing. Three SGC-7901 knockout cell lines (SGC-7901-STK39-KO) were successfully obtained, namely KO-1, KO-2, and KO-3. The sequencing results are shown in Figure 3 .

[0091] 2.2 qPCR verification of mRNA levels in three SGC-7901 knockout cell lines

[0092] The RNA of SGC-7901 wild-type cells WT and three knockout cell lines KO-1, KO-2, and KO-3 were extracted respectively, and reverse transcription reaction was performed to obtain cDNA. The specific reaction was as follows, which was divided into two steps. The first step reaction system is shown in Table 6, and the second step reaction system is shown in Table 7.

[0093] Table 6 First step reaction system

[0094] Components Volume: 16 μL Template RNA 1.0 μg 4×gDNAwipermix 4.0μL <![CDATA[RNase-freeddH2O]]> To16.0μL

[0095] React at 42°C for 2 min;

[0096] Table 7 Second step reaction system

[0097] Components Volume: 20 μL First step reaction solution 16.0μL 5×HiScriptIIqRTSuperMixII 4.0μL

[0098] The reaction was carried out at 50°C for 15 min and terminated at 85°C for 5 s.

[0099] The qPCR upstream and downstream primers of the STK39 gene were designed as shown in SEQ ID NO.8 and SEQ ID NO.9. The SGC-7901 wild-type cells and three knockout cell lines KO-1, KO-2, and KO-3 were tested by qPCR. The upstream and downstream primers were diluted 10 times and the cDNA was diluted 2 times. The qPCR reaction system is shown in Table 8. The results are shown in Table 8. Figure 4 As shown, the mRNA expression levels of STK39 in the three knockout cell lines KO-1, KO-2, and KO-3 were significantly lower than those in SGC-7901-WT cells.

[0100] SEQ ID NO.8 Forward primer: CCATACAGGCCATCACAGCA.

[0101] SEQ ID NO.9 Reverse primer: TGGTCTCCCAGACCCGTATT.

[0102] Table 8 qPCR reaction system

[0103] Components Volume: 20 μL cDNA products 2.0μL Forward primer 1.0μL Reverse primer 1.0μL SYBRGreen 10.0μL <![CDATA[RNase-freeddH2O]]> 6.0μL

[0104] 2.3 Western blot verification of protein expression of STK39 gene knockout SGC-7901 monoclonal cell line The total protein of SGC-7901-WT, i.e. SGC-7901 wild-type cells, and three SGC-7901 knockout cell lines were extracted for Western Blot detection. The specific steps are as follows:

[0105] The cells were lysed using protein lysis buffer, in which the ratio of protease inhibitor to cell tissue rapid lysis buffer was 1:100. After the cells were collected, they were centrifuged and the supernatant was collected after centrifugation. The protein concentration was determined using the BCA method. 40 μg of protein sample was added to the well. After the loading was completed, electrophoresis was started with a voltage of 220V. After the sample was dispersed, the membrane was transferred using the wet transfer method for about 35 minutes. The rapid blocking solution was blocked for 15 minutes. The membrane was washed with TBST for 10 minutes and incubated with the primary antibody at 4°C overnight. After the primary antibody was recovered, the membrane was washed with TBST 3 times for 10 minutes each time, and the secondary antibody was incubated at room temperature for 2 hours. After the secondary antibody was recovered, the membrane was washed with TBST 3 times for 10 minutes each time. The ultrasensitive ECL colorimetric solution was used for color development. The results are shown in Figure 5 As shown, the STK39 protein expression levels of the three SGC-7901 knockout cell lines KO-1, KO-2, and KO-3 were significantly lower than those of the SGC-7901-WT cells, indicating that the SGC-7901 cell line with STK39 gene knockout was successfully constructed.

[0106] In this example, the gene editing vector for knocking out the target with a single gRNA provided by the present invention was used to transfect SGC-7901 cells, thereby achieving efficient knockout of the STK39 gene in SGC-7901 cells, thereby constructing an endogenous STK39 gene-deficient SGC-7901 cell line, and establishing a gastric cancer cell model with a stable knockout of the STK39 gene, effectively solving the technical problems that have not been solved by the prior art.

[0107] Example 3: Detection of biological characteristics of STK39 gene knockout SGC-7901 cells

[0108] This example tests the biological characteristics of SGC-7901-WT and three SGC-7901 knockout cell lines, and proves that the proliferation, migration and invasion abilities of the three SGC-7901 knockout cell lines are weakened. In general, it is suggested that STK39 is an effective target for gastric cancer treatment, and endogenous STK39 in gastric cancer cells promotes tumor development. The influence of this part of STK39 protein should also be considered in the implementation of tumor immunotherapy and new drug development, suggesting that active ingredients that inhibit / block the endogenous STK39 regulatory pathway of tumor cells can be used to treat gastric cancer.

[0109] The specific test process and results are as follows:

[0110] 1.CCK8 cell proliferation assay

[0111] SGC-7901-WT and three SGC-7901 knockout cell lines in good condition were digested with trypsin and prepared to a density of 2×10 4 / mL cell suspension; 100ul cell suspension was plated in a 96-well plate, SGC-7901-WT and SGC-7901-STK39-KO were plated with 3 replicates, and a total of 4 96-well plates were plated; and 100μL PBS was added to the empty sample wells around the experimental wells to prevent the experimental well culture medium from volatilizing during the long-term culture in the incubator and affecting the final experimental results; after the cells were completely attached, that is, 6 hours later, 10μL CCK8 reagent was added to each experimental well, and the cells were placed in a 37℃ constant temperature incubator for 2h, and the absorbance was read at 450nm colorimetrically using an enzyme reader, and this time was determined as 0h; according to the above-mentioned experimental method, the cell OD value was measured every other day, and 4 time points, namely 0h, 24h, 48h, and 72h, were selected, and the cell proliferation curve was drawn. The results are shown in Figure 6 As shown, the proliferation ability of the three SGC-7901 knockout cell lines KO-1, KO-2, and KO-3 was significantly reduced compared with SGC-7901-WT cells.

[0112] 2. Cell scratch assay

[0113] Use a marker pen to draw horizontal lines evenly on the back of the 6-well plate with a ruler, one line every 1 cm, across the wells; add about 300,000 cells to each 6-well plate, make 3 duplicate wells for each cell, and when the cells are full of monolayer cells, use a 1000μL pipette tip to draw lines perpendicular to the horizontal lines on the back of the 6-well plate with a ruler, wash the cells with PBS to remove the scratched cells, and culture in a 37℃, 5% CO2 incubator. Take pictures at 0h, 24h, 48h, and 72h, and the results are as follows: Figure 7 As shown, the migration ability of the three SGC-7901 knockout cell lines KO-1, KO-2, and KO-3 was significantly restricted compared with that of SGC-7901-WT cells.

[0114] 3. Transwell experiment

[0115] Take cells in good condition, digest them and dilute them to make a cell suspension with a concentration of 5×10 5 / ml;

[0116] For migration experiments, 200 μL of cell suspension can be directly added to a 24-well Transwell cell chamber, and DMEM medium containing 20% ​​fetal bovine serum can be added to the outer chamber;

[0117] For invasion experiments, the matrigel was diluted with serum-free DMEM medium at a ratio of 1:8, 100 μL was added to a 24-well Transwell chamber, and placed in a 37°C incubator for 3 h to allow the matrigel to aggregate into a gel, and 100 μL of serum-free DMEM was added to hydrate the basement membrane; then 200 μL of cell suspension containing 1×10 cells was taken. 5The cells were vertically dripped into the chamber, and DMEM medium containing 20% ​​fetal bovine serum was added to the outer chamber;

[0118] Subsequently, the 24-well plate was placed in a cell culture incubator and cultured for 48 hours. The culture plate was taken out, the culture medium and matrix gel in the chamber were discarded, the inside of the chamber was gently wiped with a cotton ball to remove the residual matrix gel and cells, the inside of the chamber was washed twice with PBS, 1 ml of 4% paraformaldehyde was added to the 24-well plate, the lower chamber was placed in for cell fixation for 30 minutes, the chamber was taken out, and the inside of the chamber was washed once with PBS; 1 ml of crystal violet solution was added to the 24-well plate, the chamber was placed in for cell fixation for 20 minutes, the culture plate was taken out, the crystal violet inside the chamber was gently wiped with a cotton ball, the inside of the chamber was washed twice with PBS, and properly air-dried. The cells were observed under an inverted microscope at 10× field of view and photographed.

[0119] The migration results are as follows Figure 8 and Fig. 9 As shown, it can be seen from the intuitive and quantitative figures that the migration ability of the three SGC-7901 knockout cell lines KO-1, KO-2, and KO-3 is significantly inhibited compared with SGC-7901-WT cells.

[0120] The invasion results are as follows Fig.10 and Fig.11 As shown, from the intuitive and quantitative figures, it can be seen that the invasion ability of the three SGC-7901 knockout cell lines KO-1, KO-2, and KO-3 is significantly inhibited compared with SGC-7901-WT cells.

[0121] In summary, this example detected the biological characteristics of the constructed STK39 gene knockout SGC-7901 cell model and determined that the proliferation, migration and invasion abilities of the knockout cells were inhibited. This confirmed that the gastric cancer cell model was successfully constructed and the effect was obvious, which is of great significance for the research on gastric cancer treatment and the development of targeted drugs.

[0122] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0123] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A gene editing vector, characterized in that: The gene editing vector expresses Cas9 enzyme and sgRNA; The sgRNA is sgRNA1 or sgRNA3; The sgRNA1 is composed of sgRNA1-F and sgRNA1-R; the sgRNA1-F is shown in SEQ ID No.2; and the sgRNA1-R is shown in SEQ ID No.3; The sgRNA3 is spliced ​​by sgRNA3-F and sgRNA3-R; sgRNA3-F is shown as SEQ ID No.4; sgRNA3-R is shown as SEQ ID No.

5.

2. The gene editing vector according to claim 1, characterized in that: The PX459 vector was linearized by BbsI digestion, and the annealed product of sgRNA was ligated with T4 ligase to construct a gene editing vector including Cas9 expression cassette and sgRNA expression cassette.

3. Use of the gene editing vector as described in claim 1 in constructing a gastric cancer cell model with STK39 gene knockout.

4. Use of the gene editing vector according to claim 3 in constructing a gastric cancer cell model with STK39 gene knockout, characterized in that: The STK39 gene knockout refers to knocking out the second exon fragment of the STK39 gene using a gene editing vector.

5. A method for constructing a gastric cancer cell model, characterized in that: The method comprises transfecting gastric cancer cells with the gene editing vector of claim 1, successfully knocking out the second exon fragment of the target gene STK39 in the gastric cancer cells, and obtaining the gastric cancer cell model; The gastric cancer cells are SGC-7901 cells.

6. A gastric cancer cell model constructed by the construction method according to claim 5.

7. Use of the gastric cancer cell model according to claim 6 in screening drugs for treating gastric cancer.

8. Use of the gastric cancer cell model according to claim 7 in screening gastric cancer therapeutic drugs, characterized in that: By performing transcriptome sequencing analysis on the gastric cancer cell model, the targets in the related pathways that cause upregulation or downregulation of STK39 gene expression are detected, the targets are matched with drugs, and the drugs that have regulatory effects on STK39-related pathways are screened out as candidate drugs. The effects of candidate drugs on gastric cancer treatment are tested to determine the gastric cancer treatment drugs.

Images