Method for preparing multi-branch O-GalNAc oligosaccharide

Abstract

The invention discloses a method for preparing a multi-branch O-GalNAc (O-GalNAc) oligosaccharide. According to the method, an in-vitro enzymatic synthesis strategy is adopted, monosaccharide activation and glycosyl transferase catalytic reaction are coupled, operation is simple and safe, the reaction conversion rate and the product yield are greatly improved, and a foundation is laid for industrial production of O-GalNAc oligosaccharide. According to the invention, synthesis of O-GalNAc oligosaccharides with multi-branch structures such as three branches, four branches and the like can be realized, and reference is provided for synthesis of oligosaccharides and glycoconjugates with more complex structures.

Description

Technical Field

[0001] The present invention relates to the field of enzyme engineering technology and synthetic biology technology, and in particular to a method for preparing multi-branched O-GalNAc oligosaccharides by an in vitro enzymatic method. Background Art

[0002] Glycosylation is one of the common forms of post-translational modification of proteins in eukaryotes. More than 50% of proteins in the human body are modified by glycosylation in different forms. The occurrence of protein glycosylation affects the folding, half-life, water solubility and biological activity of proteins, giving proteins rich and colorful biological functions.

[0003] O-GalNAc glycosylation modification (O-GalNAc Glycosylation) is also called mucin type O-Glycan. Structurally, it refers to a glycosylation modification in which N-acetylgalactosamine (GalNAc) is connected to the hydroxyl groups of Ser, Thr, and Tyr in the protein or polypeptide structure through a glycosidic bond. Depending on the structure of the starting sugar chain, the structurally diverse O-GalNAc sugar chains can be divided into 8 different core structures (Core 1-Core 8), among which Core 1 to Core 4 structures are more common, while Core 5 to Core 8 are very rare O-GalNAc modified forms (Brockhausen, I., Wandall, HH, Hagen, KGT, & Stanley, P. (2022). O-GalNAc Glycans. In A. Varki (Eds.) et.al., Essentials of Glycobiology. (4th ed., pp. 117–128). Cold Spring Harbor Laboratory Press.).

[0004] The diversity, density and aggregation of O-GalNAc sugar chains on mucins can affect the chemical, physical and biological properties of mucins. The ends of O-GalNAc sugar chains can be further modified by sialylation and sulfation, which changes the charge of sugar chains, increases the water retention of cells, and protects cells from physical and chemical damage. In addition, the presence of O-GalNAc sugar chains also affects the exposure and configuration of glycopeptide epitopes, further affecting the adhesion of mucins and glycoproteins. In addition, highly O-glycosylated mucins can function through the interaction between sugar-binding proteins (GBPs) and oligosaccharides. O-GalNAc glycosylation modification plays a very important role in life activities such as cell growth and body development. During tumor growth, O-GalNAc glycosylation also changes, and abnormal glycosylation modification phenomena such as premature termination of sugar chain synthesis and high sialylation modification occur.

[0005] In 2014, Westerlind et al. (Pett, C., & Westerlind, U. (2014). A convergent strategy for the synthesis of type-1 elongated mucin cores 1-3 and the corresponding glycopeptides. Chemistry (Weinheim an der Bergstrasse, Germany), 20 (24), 7287–7299.) synthesized O-GalNAc sugar chains using chemical synthesis. This method first synthesized three chemical synthetic building blocks, Gal 1-3GlcNAc disaccharide, T antigen and Tn antigen, and then achieved the synthesis of Core 1 tetrasaccharide, Core 2 hexasaccharide and Core 3 trisaccharide through protection and deprotection steps. This strategy requires cumbersome protection and deprotection steps and has a low yield. It is only suitable for the synthesis of O-GalNAc oligosaccharide sequences with simple structures, and there are still great challenges in the preparation of complex O-sugar chains. In 2018, Chen's group (Santra, A., Li, Y., Ghosh, T., Li, R., Yu, H., & Chen, X. (2019). Regioselective One-Pot Multienzyme (OPME) Chemoenzymatic Strategies for Systematic Synthesis of Sialyl Core 2 Glycans. ACS catalysis, 9(1), 211–215) prepared the trisaccharide structure of O-GalNAc Core 2 by chemical synthesis, and then used the enzymatic extension strategy to sialylate the Core 2 trisaccharide using the "one-pot multienzyme method" to synthesize sialylated O-GalNAc oligosaccharides. In 2021, Wang et al. (Wang S, Chen C, Gadi MR, et al. Chemoenzymatic modular assembly of O-GalNAc glycans for functional glycomics. Nat Commun. 2021; 12(1): 3573.) chemically synthesized five core structures of O-GalNAc oligosaccharide chains, and further used 13 enzymatic synthesis modules to develop the Core Synthesis / Enzymatic Extension (CSEE) strategy to synthesize more than 80 O-Glycan oligosaccharide fragments with different antigenic epitopes. This method relies on the chemical synthesis of Core oligosaccharide fragments with different branched structures, and there are still challenges in the large-scale preparation of O-oligosaccharide fragments.

[0006] The separation, purification and chemical enzymatic synthesis strategies of O-glycans have been well developed, but they are mainly focused on the preparation and characterization of oligosaccharide fragments with relatively simple structures. Complex sugar chains, especially O-glycans with 1-6GlcNAc branch structures, are currently mainly obtained by chemical synthesis due to the lack of 1,6GlcNAcT enzyme elements. The steps are cumbersome and the yield is low. There is no efficient enzymatic synthesis strategy for multi-branched O-GalNAc oligosaccharide fragments. Summary of the invention

[0007] In view of the above deficiencies in the prior art and the technical problems that need to be solved, the present invention provides a method for enzymatically synthesizing multi-branched O-GalNAc oligosaccharides, which is simple and safe to operate, greatly improves the reaction conversion rate and product yield, and can lay the foundation for the industrial production of O-GalNAc oligosaccharides.

[0008] In a first aspect of the present invention, a method for enzymatically synthesizing O-GalNAc oligosaccharides is provided, comprising the following steps:

[0009] (1) Preparation of core 1 disaccharide:

[0010] Galactose (Gal), the monosaccharide shown in formula Ⅰ, and enzyme Ⅰ react to obtain core 1 disaccharide;

[0011]

[0012] Where R is -LX;

[0013] X is selected from: an azido group, an alkyne group, a sulfhydryl group, an amino acid residue, a lipid residue, a carbohydrate residue, a protein residue, etc.;

[0014] L can be any suitable linking group, such as a single bond, an alkylene group, an oligopeptide residue or wait;

[0015] a is an integer from 1 to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10);

[0016] (2) Preparation of core 2 trisaccharide:

[0017] N-acetylglucosamine (GlcNAc), Core 1 disaccharide, and enzyme II react to obtain core 2 trisaccharide;

[0018]

[0019] Optionally, (3) extending:

[0020] Core 2 trisaccharide, galactose (Gal), and glycosyltransferase III react to obtain double-branched oligosaccharide compound 1;

[0021]

[0022] Optionally, (4) extending:

[0023] The double-branched oligosaccharide compound 1, N-acetylglucosamine (GlcNAc), and glycosyltransferase IV react to obtain the double-branched oligosaccharide compound 2;

[0024]

[0025] By repeating steps (3) and / or (4), and so on, double-branched oligosaccharides of different lengths can be obtained.

[0026] In some embodiments of the present invention, the double-branched oligosaccharide has the following structure:

[0027]

[0028] Wherein, m is an integer from 0 to 5 (e.g., 0, 1, 2, 3, 4, 5);

[0029] n is an integer from 0 to 5 (e.g., 0, 1, 2, 3, 4, 5).

[0030] In one embodiment of the present invention, the method further comprises:

[0031] (5) Branching: Double-branched oligosaccharides, N-acetylglucosamine (GlcNAc), and enzyme V react to obtain multi-branched oligosaccharides.

[0032] Specifically, the double-branched oligosaccharide in step (5) can be the aforementioned double-branched oligosaccharide compound 1 or double-branched oligosaccharide compound 2, or can be other double-branched oligosaccharides of different lengths obtained by repeating steps (3) and / or (4).

[0033] In some embodiments of the present invention, the multi-branched oligosaccharide has the following structure:

[0034]

[0035] In some embodiments of the present invention, m=0, n=0.

[0036] In some embodiments of the present invention, m=1, n=0.

[0037] In some embodiments of the present invention, m=1, n=1.

[0038] In some embodiments of the present invention, m=2, n=1.

[0039] In some embodiments of the present invention, m=2, n=2.

[0040] In some embodiments of the present invention, L is a C1-C6 alkylene group, such as a methylene group, an ethylene group, or a propylene group.

[0041] In some embodiments of the present invention, L is

[0042] In some embodiments of the present invention, R is an azido-substituted alkyl group, for example

[0043] In some embodiments of the present invention, R is an amino acid residue, such as a serine residue.

[0044] In some embodiments of the present invention, R is an oligopeptide or a protein.

[0045] Specifically, the reaction system in step (1) also includes ATP.

[0046] Specifically, in step (1), the molar ratio of the monosaccharide represented by formula I to galactose (Gal) is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0047] Specifically, in step (1), the molar ratio of the monosaccharide represented by formula I to ATP is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0048] Specifically, in step (1), enzyme I comprises: galactokinase (BiGalK), D-galactose-1,3-N-acetyl-D-hexosamine phosphorylase (BiGalHexNAcP), or consists of them.

[0049] Specifically, in the reaction system described in step (1), the concentration of enzyme I is 0.1-10 mg / mL (e.g., 0.1, 0.5, 1, 2, 3, 4, 5, 6, 10 mg / mL), for example, 1 mg / mL.

[0050] Specifically, the reaction system in step (1) also includes magnesium ions, such as MgCl2.

[0051] Specifically, the reaction system in step (1) further includes a buffer, such as Tris-HCl.

[0052] Specifically, the reaction system in step (1) further includes a diluent, such as water, for example, distilled water.

[0053] Specifically, the pH of the reaction system in step (1) is 4.5-8.5 (e.g., 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5), especially 7-8, such as 7.5.

[0054] Specifically, the reaction temperature in step (1) is 0-40°C (e.g., 0, 5, 10, 15, 20, 25, 30, 35, 40°C), particularly 35-40°C, particularly 37°C.

[0055] Specifically, the reaction time of step (1) is 3-72 hours (e.g., 3, 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 66, 72 hours), in particular 24-36 hours, for example 30 hours.

[0056] Specifically, step (1) also includes the step of adding a quenching agent (such as glacial ethanol) to terminate the reaction.

[0057] Specifically, step (1) also includes a purification step, such as a combination of one or more of centrifugation, desalting, and passing through a strongly basic anion exchange resin.

[0058] In some embodiments of the present invention, step (1) comprises:

[0059] (1-1) preparing an aqueous solution of galactose (Gal), adenosine triphosphate (ATP), a monosaccharide represented by formula I, MgCl2, and Tris-HCl;

[0060] (1-2) adding galactokinase (BiGalK) and D-galactose-1,3-N-acetyl-D-hexosamine phosphorylase (BiGalHexNAcP) for reaction;

[0061] (1-3) Termination of the reaction;

[0062] (1-4) The reaction solution is centrifuged, the supernatant is desalted by Bio-Gel P2 molecular sieve, and then separated and purified by a strong alkaline anion exchange resin medium. After desalting again by Bio-Gel P2 molecular sieve, Core1 disaccharide is obtained.

[0063] Specifically, the reaction system in step (2) further comprises nucleoside triphosphates, such as one or two of adenosine triphosphate (ATP), uridine triphosphate (UTP), guanosine triphosphate (GTP), and cytidine triphosphate (CTP), especially ATP and UTP.

[0064] Specifically, in step (2), the molar ratio of Core 1 disaccharide to N-acetylglucosamine (GalNAc) is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0065] Specifically, in step (2), the molar ratio of Core 1 disaccharide to ATP is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0066] Specifically, in step (2), the molar ratio of Core 1 disaccharide to UTP is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0067] In one embodiment of the present invention, in step (2), enzyme II comprises: N-acetylglucosamine 1-position kinase (BlNahK), GlcNAc-1-P uridyltransferase (AGX1), pyrophosphatase (PmPpA), glycosyltransferase GCNT1, or consists of them. BlNahK and AGX1 can use ATP and UTP to synthesize sugar nucleotide UDP-GlcNAc, and PmPpA hydrolyzes the reaction byproduct pyrophosphate into phosphoric acid, thereby promoting the catalytic reaction to proceed in the forward direction.

[0068] In one embodiment of the present invention, step (2) comprises: uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), Core 1 disaccharide, and enzyme II react to obtain core 2 trisaccharide (wherein UDP-GlcNAc can directly use the corresponding product (such as a commercially available product)).

[0069] Specifically, in step (2), the molar ratio of Core 1 disaccharide to UDP-GlcNAc is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0070] In one embodiment of the present invention, in step (2), enzyme II comprises: glycosyltransferase GCNT1, or consists of it.

[0071] Specifically, in the reaction system described in step (2), the concentration of enzyme II is 0.1-10 mg / mL (e.g., 0.1, 0.5, 1, 2, 3, 4, 5, 6, 10 mg / mL), for example, 1 mg / mL.

[0072] Specifically, the reaction system in step (2) also includes magnesium ions, such as MgCl2.

[0073] Specifically, the reaction system in step (2) also includes a buffer, such as Tris-HCl.

[0074] Specifically, the reaction system in step (2) further includes a diluent, such as water, for example, distilled water.

[0075] Specifically, the pH of the reaction system in step (2) is 4.5-8.5 (e.g., 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5), especially 7-8, such as 7.5.

[0076] Specifically, the reaction temperature in step (2) is 0-40°C (e.g., 0, 5, 10, 15, 20, 25, 30, 35, 40°C), particularly 35-40°C, particularly 37°C.

[0077] Specifically, the reaction time of step (2) is 3-10 days (e.g., 3, 4, 5, 6, 7, 8, 9, 10 days), for example, 7 days.

[0078] Specifically, step (2) also includes the step of adding a quenching agent (such as glacial ethanol) to terminate the reaction.

[0079] Specifically, step (2) also includes a purification step, such as a combination of one or more of centrifugation, desalting, and passing through a strongly basic anion exchange resin.

[0080] In some embodiments of the present invention, step (2) comprises:

[0081] (2-1) preparing an aqueous solution of N-acetylglucosamine (GlcNAc), Core 1 disaccharide, adenosine triphosphate (ATP), uridine triphosphate (UTP), MgCl2, and Tris-HCl;

[0082] (2-2) Add BiNahK, AGX1, PmPpA, and glycosyltransferase GCNT1, and react;

[0083] (2-3) Termination of the reaction;

[0084] (2-4) The reaction solution is centrifuged, the supernatant is desalted by Bio-Gel P2 molecular sieve, and then separated and purified by a strongly basic anion exchange resin medium. The Core2 trisaccharide is obtained after desalting again by Bio-Gel P2 molecular sieve.

[0085] In some embodiments of the present invention, step (2) comprises:

[0086] (2-1) preparing an aqueous solution of uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), Core 1 disaccharide, MgCl2, and Tris-HCl;

[0087] (2-2) Add glycosyltransferase GCNT1 and react;

[0088] (2-3) Termination of the reaction;

[0089] (2-4) The reaction solution is centrifuged, the supernatant is desalted by Bio-Gel P2 molecular sieve, and then separated and purified by a strongly basic anion exchange resin medium. The Core2 trisaccharide is obtained after desalting again by Bio-Gel P2 molecular sieve.

[0090] Specifically, the reaction system in step (3) further comprises nucleoside triphosphates, such as one or two of adenosine triphosphate (ATP), uridine triphosphate (UTP), guanosine triphosphate (GTP), and cytidine triphosphate (CTP), in particular ATP and UTP.

[0091] Specifically, in step (3), the molar ratio of Core 2 trisaccharide to galactose (Gal) is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0092] Specifically, in step (3), the molar ratio of Core 2 trisaccharide to UTP is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0093] Specifically, in step (3), the molar ratio of Core 2 trisaccharide to ATP is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0094] In one embodiment of the present invention, in step (3), the enzyme III comprises: galactokinase (BiGalK), UDP-sugar pyrophosphorylase (AtUSP), pyrophosphatase (PmPpA) and β-1,4-galactosyltransferase (NmLgtB); or consists of them. BiGalK and AtUSP can use ATP and UTP to synthesize UDP-Gal, and PmPpA promotes the reaction to proceed in the forward direction.

[0095] In one embodiment of the present invention, step (3) comprises: reacting Core 2 trisaccharide, uridine diphosphate galactose (UDP-Gal), and glycosyltransferase III to obtain a double-branched oligosaccharide compound 1 (wherein UDP-Gal can directly use a corresponding product (such as a commercially available product)).

[0096] Specifically, in step (3), the molar ratio of Core 2 trisaccharide to UDP-Gal is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0097] In one embodiment of the present invention, in step (3), the enzyme III comprises: β-1,4 galactosyltransferase (NmLgtB), or the enzyme III is NmLgtB.

[0098] Specifically, in the reaction system described in step (3), the concentration of enzyme III is 0.1-10 mg / mL (e.g., 0.1, 0.5, 1, 2, 3, 4, 5, 6, 10 mg / mL), for example, 1 mg / mL.

[0099] Specifically, the reaction system in step (3) also includes magnesium ions, such as MgCl2.

[0100] Specifically, the reaction system in step (3) also includes a buffer, such as Tris-HCl.

[0101] Specifically, the reaction system in step (3) also includes a diluent, such as water, for example, distilled water.

[0102] Specifically, the pH of the reaction system in step (3) is 4.5-8.5 (e.g., 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5), especially 7-8, such as 7.5.

[0103] Specifically, the reaction temperature in step (3) is 0-40°C (e.g., 0, 5, 10, 15, 20, 25, 30, 35, 40°C), particularly 35-40°C, particularly 37°C.

[0104] Specifically, the reaction time of step (3) is 3-72 hours (e.g., 3, 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 66, 72 hours), in particular 24-48 hours, for example 36 hours.

[0105] Specifically, step (3) also includes the step of adding a quenching agent (such as glacial ethanol) to terminate the reaction.

[0106] Specifically, step (3) also includes a purification step, such as a combination of one or more of centrifugation, desalting, and passing through a strongly basic anion exchange resin.

[0107] In some embodiments of the present invention, step (3) comprises:

[0108] (3-1) Core 2 trisaccharide, galactose (Gal), adenosine triphosphate (ATP), uridine triphosphate (UTP), MgCl2, and Tris-HCl are prepared into an aqueous solution;

[0109] (3-2) Add BiGalK, AtUSP, PmPpA, and NmLgtB, and react;

[0110] (3-3) Termination of the reaction;

[0111] (3-4) The reaction solution was centrifuged, and the supernatant was desalted by Bio-Gel P2 molecular sieve, separated and purified by strong alkaline anion exchange resin medium, and desalted again by Bio-Gel P2 molecular sieve to obtain the double-branched oligosaccharide compound 1.

[0112] In some embodiments of the present invention, step (3) comprises:

[0113] (3-1) Core 2 trisaccharide, uridine diphosphate galactose (UDP-Gal), MgCl2, and Tris-HCl are prepared into an aqueous solution;

[0114] (3-2) Add NmLgtB and react;

[0115] (3-3) Termination of the reaction;

[0116] (3-4) The reaction solution was centrifuged, and the supernatant was desalted by Bio-Gel P2 molecular sieve, separated and purified by strong alkaline anion exchange resin medium, and desalted again by Bio-Gel P2 molecular sieve to obtain the double-branched oligosaccharide compound 1.

[0117] Specifically, the reaction system in step (4) further comprises nucleoside triphosphates, such as one or two of adenosine triphosphate (ATP), uridine triphosphate (UTP), guanosine triphosphate (GTP), and cytidine triphosphate (CTP), in particular ATP and UTP.

[0118] Specifically, in step (4), the molar ratio of the double-branched oligosaccharide compound 1 to N-acetylglucosamine (GlcNAc) is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0119] Specifically, in step (4), the molar ratio of the double-branched oligosaccharide compound 1 to UTP is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0120] Specifically, in step (4), the molar ratio of the double-branched oligosaccharide compound 1 to ATP is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0121] In one embodiment of the present invention, in step (4), enzyme IV includes: N-acetylglucosamine 1-site kinase (BlNahK), GlcNAc-1-P uridylyltransferase (AGX1), pyrophosphatase (PmPpA), β-1,3-N-acetylglucosamine transferase (HpLgtA), or consists of them.

[0122] In one embodiment of the present invention, step (4) comprises: reacting a double-branched oligosaccharide compound 1, uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), and glycosyltransferase IV to obtain a double-branched oligosaccharide compound 2 (wherein UDP-GlcNAc can directly use a corresponding product (e.g., a commercially available product)).

[0123] Specifically, in step (4), the molar ratio of the double-branched oligosaccharide compound 1 to UDP-GlcNAc is 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0124] Specifically, in step (4), the enzyme IV includes: β-1,3-N-acetylglucosamine transferase (HpLgtA), or the enzyme IV is HpLgtA.

[0125] Specifically, in the reaction system described in step (4), the concentration of enzyme IV is 0.1-10 mg / mL (e.g., 0.1, 0.5, 1, 2, 3, 4, 5, 6, 10 mg / mL), for example, 1 mg / mL.

[0126] Specifically, the reaction system in step (4) also includes magnesium ions, such as MgCl2.

[0127] Specifically, the reaction system in step (4) also includes a buffer, such as Tris-HCl.

[0128] Specifically, the reaction system in step (4) also includes a diluent, such as water, for example, distilled water.

[0129] Specifically, the pH of the reaction system in step (4) is 4.5-8.5 (e.g., 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5), especially 7-8, such as 7.5.

[0130] Specifically, the reaction temperature in step (4) is 0-40°C (e.g., 0, 5, 10, 15, 20, 25, 30, 35, 40°C), particularly 35-40°C, particularly 37°C.

[0131] Specifically, the reaction time of step (4) is 3-72 hours (e.g., 3, 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 66, 72 hours), in particular 12-36 hours, for example 24 hours.

[0132] Specifically, step (4) also includes the step of adding a quenching agent (such as glacial ethanol) to terminate the reaction.

[0133] Specifically, step (4) also includes a purification step, such as a combination of one or more of centrifugation, desalting, and passing through a strongly basic anion exchange resin.

[0134] In some embodiments of the present invention, step (4) comprises:

[0135] (4-1) preparing a double-branched oligosaccharide compound 1, N-acetylglucosamine (GlcNAc), adenosine triphosphate (ATP), uridine triphosphate (UTP), MgCl2, and Tris-HCl into an aqueous solution;

[0136] (4-2) Add BlNahK, AGX1, PmPpA, add HpLgtA, and react;

[0137] (4-3) Termination of the reaction;

[0138] (4-4) The reaction solution was centrifuged, and the supernatant was desalted by Bio-Gel P2 molecular sieve, separated and purified by strong alkaline anion exchange resin medium, and desalted again by Bio-Gel P2 molecular sieve to obtain the double-branched oligosaccharide compound 2.

[0139] In some embodiments of the present invention, step (4) comprises:

[0140] (4-1) preparing a double-branched oligosaccharide compound 1, uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), MgCl2, and Tris-HCl into an aqueous solution;

[0141] (4-2) Add HpLgtA and react;

[0142] (4-3) Termination of the reaction;

[0143] (4-4) The reaction solution was centrifuged, and the supernatant was desalted by Bio-Gel P2 molecular sieve, separated and purified by strong alkaline anion exchange resin medium, and desalted again by Bio-Gel P2 molecular sieve to obtain the double-branched oligosaccharide compound 2.

[0144] In some embodiments of the present invention, the method includes a combination of steps (3)-(4)-(3).

[0145] In some embodiments of the present invention, the method includes a combination of steps (3)-(4)-(3)-(4).

[0146] In some embodiments of the present invention, the method includes a combination of steps (3)-(4)-(3)-(4)-(3).

[0147] Specifically, the reaction system in step (5) further comprises nucleoside triphosphates, such as one or two of adenosine triphosphate (ATP), uridine triphosphate (UTP), guanosine triphosphate (GTP), and cytidine triphosphate (CTP), in particular ATP and UTP.

[0148] Specifically, in step (5), the molar ratio of the double-branched oligosaccharide to N-acetylglucosamine (GlcNAc) can be 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0149] Specifically, in step (5), the molar ratio of the double-branched oligosaccharide to UTP can be 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0150] Specifically, in step (5), the molar ratio of the double-branched oligosaccharide to ATP can be 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0151] In one embodiment of the present invention, in step (5), enzyme V comprises: N-acetylglucosamine 1-site kinase (BlNahK), GlcNAc-1-P uridylyltransferase (AGX1), pyrophosphatase (PmPpA), β1,6-N-acetylglucosamine transferase (GCNT2); or consists of them.

[0152] In one embodiment of the present invention, step (5) comprises: double-branched oligosaccharides, uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), and enzyme V reaction to obtain multi-branched oligosaccharides (wherein UDP-GlcNAc can directly use the corresponding product (such as a commercially available product)).

[0153] Specifically, in step (5), the molar ratio of the double-branched oligosaccharide to UDP-GlcNAc can be 1:1-5, for example, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:4, 1:5.

[0154] In one embodiment of the present invention, in step (5), the enzyme V comprises: β1,6-N-acetylhexosaminyltransferase (GCNT2), or the enzyme V is GCNT2.

[0155] Specifically, in the reaction system described in step (5), the concentration of enzyme V is 0.1-10 mg / mL (e.g., 0.1, 0.5, 1, 2, 3, 4, 5, 6, 10 mg / mL), for example, 0.5 mg / mL.

[0156] Specifically, the reaction system in step (5) also includes a buffer, such as Tris-HCl.

[0157] Specifically, the reaction system in step (5) also includes a diluent, such as water, for example, distilled water.

[0158] Specifically, the pH of the reaction system in step (5) is 7-8, for example 7.5.

[0159] Specifically, the reaction temperature in step (5) is 35-40°C, especially 37°C.

[0160] Specifically, the reaction time of step (5) is 1-3 days, for example 2 days.

[0161] Specifically, step (5) also includes the step of adding a quenching agent (such as glacial ethanol) to terminate the reaction.

[0162] Specifically, step (5) also includes a purification step, such as a combination of one or more of centrifugation, desalting, and passing through a strongly basic anion exchange resin.

[0163] In some embodiments of the present invention, step (5) comprises:

[0164] (5-1) preparing a double-branched oligosaccharide, N-acetylglucosamine (GlcNAc), adenosine triphosphate (ATP), uridine triphosphate (UTP), and Tris-HCl into an aqueous solution;

[0165] (5-2) Add BlNahK, AGX1, PmPpA, add GCNT2, and react;

[0166] (5-3) Termination of the reaction;

[0167] (5-4) The reaction solution is centrifuged, and the supernatant is desalted by Bio-Gel P2 molecular sieve, separated and purified by strong alkaline anion exchange resin medium, and desalted again by Bio-Gel P2 molecular sieve to obtain multi-branched oligosaccharides.

[0168] In some embodiments of the present invention, step (5) comprises:

[0169] (5-1) preparing a double-branched oligosaccharide, uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), and Tris-HCl into an aqueous solution;

[0170] (5-2) Add GCNT2 and react;

[0171] (5-3) Termination of the reaction;

[0172] (5-4) The reaction solution is centrifuged, and the supernatant is desalted by Bio-Gel P2 molecular sieve, separated and purified by strong alkaline anion exchange resin medium, and desalted again by Bio-Gel P2 molecular sieve to obtain multi-branched oligosaccharides.

[0173] In some embodiments of the present invention, the method includes a combination of steps (3)-(4)-(3)-(4)-(3)-(5).

[0174] In one embodiment of the present invention, the method further comprises a step of preparing glycosyltransferase GCNT1, which is mainly achieved by integrating GCNT1 gene (GenBank: BC074885.2) into Pichia pastoris (eg, P. pastoris GS115) and expressing the target protein.

[0175] Specifically, the preparation steps of glycosyltransferase GCNT1 include:

[0176] (G-1) Linearizing the recombinant expression vector containing the GCNT1 gene;

[0177] (G-2) Transforming the linearized recombinant expression vector into yeast competent cells;

[0178] (G-3) Screening and verification of transformed strains;

[0179] (G-4) induced expression;

[0180] Optionally, (G-5) purifying the protein.

[0181] Specifically, the nucleotide sequence of the GCNT1 gene is shown in SEQ ID NO:1.

[0182] In some embodiments of the present invention, the expression vector is a plasmid, such as pPIC9K.

[0183] Specifically, in step (G-1), the recombinant expression vector is linearized by restriction endonuclease SacⅠ.

[0184] Specifically, in step (G-2), the linearized expression vector is transformed into competent cells by electroporation; in one embodiment of the present invention, the electroporation conditions include: voltage 1.5 kV, capacitance 25 F, resistance 200 Ω.

[0185] Specifically, the screening in step (G-3) includes: culturing the strain transformed in step (G-2) in a screening medium for screening.

[0186] Specifically, the selection medium contains Geneticin (G418).

[0187] Specifically, the verification in step (G-3) includes: picking a single colony on the screening culture medium, preparing a bacterial suspension, lysing the bacteria, and verifying by colony PCR.

[0188] Specifically, the PCR amplification verification of the target gene was carried out according to the conditions of denaturation at 94°C for 30s, annealing at 55°C for 1min, extension at 72°C for 30s, and further extension at 72°C for 5min after 35 cycles.

[0189] Specifically, step (G-4) comprises: inoculating the screened strain into a BMGY liquid culture medium, culturing at 25-35° C. (preferably 30° C.) and shaking (for example, at 250 rpm) until OD600 = 2-6, to obtain a seed solution;

[0190] Centrifuge the seed solution to collect the bacteria;

[0191] The cells are resuspended in BMMY medium, cultured at 20-30°C (preferably 25°C) with shaking (for example, at 250 rpm), and methanol is added (for example, every 24 hours) to induce expression of the target protein.

[0192] In some embodiments of the present invention, step (G-5) comprises: separating and purifying the protein in the fermentation broth of step (G-4) by using a Ni column.

[0193] Specifically, the separation and purification step comprises:

[0194] (P-1) flushing and balancing the Ni column;

[0195] (P-2) diluting, calibrating, centrifuging and collecting the culture supernatant in sequence;

[0196] (P-3) Wash, elute and remove impurities from foreign proteins.

[0197] Specifically, step (P-1) includes loading a proper amount of Ni Sepharose 6 Fast Flow filler into the gravity column, washing the filler with 10 column volumes of double distilled water to remove impurities in the medium, and then balancing the column with 5 column volumes of pH 7.5 PBS buffer.

[0198] Specifically, step (P-2) includes using pH 7.5 PBS buffer to dilute the collected bacterial culture supernatant 5 times, then adjusting the pH to 7.5, and centrifuging to collect the diluted sample.

[0199] Specifically, step (P-3) includes washing the impurities with 10 column volumes of pH 7.5 PBS buffer, and then gradient eluting the impurities and the target protein with PBS buffer containing 25 mM and 500 mM imidazole, respectively; collecting the eluted fractions and removing the high concentration of imidazole in the eluate using an ultrafiltration tube with a molecular weight cutoff of 10 kDa.

[0200] In addition, the sixth aspect of the present invention provides a recombinant yeast strain, which uses Pichia pastoris (e.g., P. pastoris GS115) as a vector and functionally expresses a heterologous nucleic acid sequence (GenBank: BC074885.2), which encodes a glycosyltransferase GCNT1; the preparation step of the glycosyltransferase GCNT1 can simply include fermenting the recombinant yeast strain, and optionally, separating and purifying the fermentation broth to obtain the target protein.

[0201] Specifically, the fermentation medium can be any medium suitable for fermenting and culturing the recombinant yeast strain; in one embodiment of the present invention, the medium is BMMY medium.

[0202] Specifically, the fermentation temperature is 20-30°C (e.g., 20, 22, 24, 25, 26, 28, 30°C), preferably 25°C.

[0203] Specifically, the fermentation is carried out under shaking (eg, 200-400 rpm), preferably under shaking at 250 rpm.

[0204] Specifically, the fermentation includes adding methanol regularly (for example, every 24 hours) to induce expression of the target protein.

[0205] In one embodiment of the present invention, the method further comprises a step of preparing glycosyltransferase GCNT2, which is mainly achieved by integrating the GCNT2 gene (Uniprot: Q8N0V5-2) into Pichia pastoris (eg, P. pastoris GS115) and expressing the target protein.

[0206] Specifically, the preparation steps of glycosyltransferase GCNT2 include:

[0207] (A-1) linearizing the recombinant expression vector containing the GCNT2 gene;

[0208] (A-2) Transforming the linearized recombinant expression vector into yeast competent cells;

[0209] (A-3) Screening and verifying transformed strains;

[0210] (A-4) Induced protein expression;

[0211] Optionally, (A-5) purifying the protein.

[0212] Specifically, the nucleotide sequence of the GCNT2 gene is shown in SEQ ID NO:2.

[0213] In some embodiments of the present invention, the expression vector is a plasmid, such as pPIC9K.

[0214] Specifically, in step (A-1), the recombinant expression vector is linearized by restriction endonuclease Sac I.

[0215] Specifically, in step (A-2), the linearized expression vector is transformed into competent cells by electroporation; in one embodiment of the present invention, the electroporation conditions include: voltage 1.5 kV, capacitance 25 μF, resistance 200 Ω.

[0216] Specifically, the screening in step (A-3) includes: culturing the strain transformed in step (A-2) in a screening medium for screening.

[0217] Specifically, the selection medium contains Geneticin (G418).

[0218] Specifically, the verification in step (A-3) includes: picking a single colony on the screening culture medium, preparing a bacterial suspension, lysing the bacteria, and verifying by colony PCR.

[0219] Specifically, the PCR amplification verification of the target gene was carried out according to the conditions of denaturation at 95°C for 30s, annealing at 60°C for 1min, extension at 68°C for 1min20s, and further extension at 68°C for 5min after 32 cycles.

[0220] Specifically, step (A-4) comprises: inoculating the screened strain into a Buffered Glycerol-complex (BMGY) liquid culture medium, culturing at 25-35° C. (preferably 30° C.) and shaking (for example, at 250 rpm) until OD600 = 2-6, to obtain a seed solution;

[0221] Centrifuge the seed solution to collect the bacteria;

[0222] The cells are resuspended in Buffered Methanol-complex (BMMY) medium, cultured at 20-30°C (preferably 25°C) with shaking (for example, at 250 rpm), and methanol is added (for example, every 24 hours) to induce expression of the target protein.

[0223] In some embodiments of the present invention, step (A-5) comprises: separating and purifying the protein in the fermentation broth of step (A-4) by using a Ni column.

[0224] Specifically, the separation and purification step comprises:

[0225] (B-1) flushing and balancing the Ni column;

[0226] (B-2) diluting, calibrating, centrifuging, and collecting the culture supernatant in sequence;

[0227] (B-3) Washing, eluting and removing impurities from foreign proteins.

[0228] Specifically, in step (B-1), a proper amount of Ni Sepharose 6 Fast Flow filler is loaded into the gravity column, the filler is washed with 10 column volumes of ddH2O, and then the purification column is balanced with 10 column volumes of PBS buffer at pH 7.4.

[0229] Specifically, in step (B-2), the culture supernatant was diluted 5 times with pH 7.4 PBS buffer, then adjusted to pH 7.4 with 5M NaOH, and centrifuged at 15,000×g for 5 min to collect the supernatant and use it for subsequent purification of the target protein.

[0230] Specifically, in step (B-3), 10 column volumes of pH 7.4 PBS buffer are used to wash the impurities, 10 mM imidazole-containing PBS buffer is used to wash the impurities, and 200 mM imidazole-containing PBS buffer is used for gradient elution of the target protein; and an ultrafiltration tube with a molecular weight cutoff of 10 kDa is used to remove imidazole in the eluate.

[0231] In the second aspect of the present invention, a multi-branched oligosaccharide compound is provided, which is as shown in the general formula IV and V of the first aspect of the present invention.

[0232] In one embodiment of the present invention, the multi-branched oligosaccharide compound has a structure as shown in Formula V, wherein m=2, n=2.

[0233] In some embodiments of the present invention, the multi-branched oligosaccharide compound has the following structure:

[0234]

[0235]

[0236] In the third aspect of the present invention, there is provided use of the method described in the first aspect and the oligosaccharides prepared therefrom in the preparation of a sugar chip.

[0237] Specifically, the sugar chip comprises the oligosaccharides prepared by the method of the first aspect and a chemically modified matrix, and the oligosaccharide molecules are fixed on the chemically modified matrix through covalent or non-covalent interaction.

[0238] In a fourth aspect of the present invention, a sugar chip is provided, comprising the oligosaccharides prepared by the method of the first aspect and a chemically modified matrix, wherein the oligosaccharide molecules are fixed on the chemically modified matrix by covalent or non-covalent interaction.

[0239] In particular, the sugar chip comprises the oligosaccharide described in the second aspect of the present invention.

[0240] In a fifth aspect of the present invention, a method for preparing GCNT1 is provided, comprising integrating the GCNT1 gene (GenBank: BC074885.2) into Pichia pastoris (eg, P. pastoris GS115) and expressing the target protein.

[0241] Specifically, the method comprises the following steps:

[0242] (G-1) Linearizing the recombinant expression vector containing the GCNT1 gene;

[0243] (G-2) Transforming the linearized recombinant expression vector into yeast competent cells;

[0244] (G-3) Screening and verification of transformed strains;

[0245] (G-4) induced expression;

[0246] Optionally, (G-5) purifying the protein.

[0247] Specifically, the nucleotide sequence of the GCNT1 gene is shown in SEQ ID NO:1.

[0248] In some embodiments of the present invention, the expression vector is a plasmid, such as pPIC9K.

[0249] Specifically, in step (G-1), the recombinant expression vector is linearized by restriction endonuclease SacⅠ.

[0250] Specifically, in step (G-2), the linearized expression vector is transformed into competent cells by electroporation; in one embodiment of the present invention, the electroporation conditions include: voltage 1.5 kV, capacitance 25 F, resistance 200 Ω.

[0251] Specifically, the screening in step (G-3) includes: culturing the strain transformed in step (G-2) in a screening medium for screening.

[0252] Specifically, the selection medium contains Geneticin (G418).

[0253] Specifically, the verification in step (G-3) includes: picking a single colony on the screening culture medium, preparing a bacterial suspension, lysing the bacteria, and verifying by colony PCR.

[0254] Specifically, the PCR amplification verification of the target gene was carried out according to the conditions of denaturation at 94°C for 30s, annealing at 55°C for 1min, extension at 72°C for 30s, and further extension at 72°C for 5min after 35 cycles.

[0255] Specifically, step (G-4) comprises: inoculating the screened strain into a BMGY liquid culture medium, culturing at 25-35° C. (preferably 30° C.) and shaking (for example, at 250 rpm) until OD600 = 2-6, to obtain a seed solution;

[0256] Centrifuge the seed solution to collect the bacteria;

[0257] The cells are resuspended in BMMY medium, cultured at 20-30°C (preferably 25°C) with shaking (for example, at 250 rpm), and methanol is added (for example, every 24 hours) to induce expression of the target protein.

[0258] In some embodiments of the present invention, step (G-5) comprises: separating and purifying the protein in the fermentation broth of step (G-4) by using a Ni column.

[0259] Specifically, the separation and purification step comprises:

[0260] (P-1) flushing and balancing the Ni column;

[0261] (P-2) diluting, calibrating, centrifuging and collecting the culture supernatant in sequence;

[0262] (P-3) Wash, elute and remove impurities from foreign proteins.

[0263] Specifically, step (P-1) includes loading a proper amount of Ni Sepharose 6 Fast Flow filler into the gravity column, washing the filler with 10 column volumes of double distilled water to remove impurities in the medium, and then balancing the column with 5 column volumes of pH 7.5 PBS buffer.

[0264] Specifically, step (P-2) includes using pH 7.5 PBS buffer to dilute the collected bacterial culture supernatant 5 times, then adjusting the pH to 7.5, and centrifuging to collect the diluted sample.

[0265] Specifically, step (P-3) includes washing the impurities with 10 column volumes of pH 7.5 PBS buffer, and then gradient eluting the impurities and the target protein with PBS buffer containing 25 mM and 500 mM imidazole, respectively; collecting the eluted fractions and removing the high concentration of imidazole in the eluate using an ultrafiltration tube with a molecular weight cutoff of 10 kDa.

[0266] In the sixth aspect of the present invention, a recombinant yeast strain is provided, which uses Pichia pastoris (e.g., P. pastoris GS115) as a vector and functionally expresses a heterologous nucleic acid sequence (GenBank: BC074885.2), which encodes a glycosyltransferase GCNT1, and its nucleotide sequence is shown in SEQ ID NO:1.

[0267] In a seventh aspect of the present invention, a method for constructing the recombinant yeast strain according to the sixth aspect is provided, comprising the following steps:

[0268] (G-1) Linearizing the recombinant expression vector containing the GCNT1 gene;

[0269] (G-2) Transforming the linearized recombinant expression vector into yeast competent cells;

[0270] (G-3) Screening and verification of transformed strains.

[0271] In some embodiments of the present invention, the expression vector is a plasmid, such as pPIC9K.

[0272] Specifically, in step (G-1), the recombinant expression vector is linearized by restriction endonuclease SacⅠ.

[0273] Specifically, in step (G-2), the linearized expression vector is transformed into competent cells by electroporation; in one embodiment of the present invention, the electroporation conditions include: voltage 1.5 kV, capacitance 25 F, resistance 200 Ω.

[0274] Specifically, the screening in step (G-3) includes: culturing the strain transformed in step (G-2) in a screening medium for screening.

[0275] Specifically, the selection medium contains Geneticin (G418).

[0276] Specifically, the verification in step (G-3) includes: picking a single colony on the screening culture medium, preparing a bacterial suspension, lysing the bacteria, and verifying by colony PCR.

[0277] Specifically, the PCR amplification verification of the target gene was carried out according to the conditions of denaturation at 94°C for 30s, annealing at 55°C for 1min, extension at 72°C for 30s, and further extension at 72°C for 5min after 35 cycles.

[0278] In an eighth aspect of the present invention, there is provided use of the recombinant yeast strain described in the sixth aspect in producing glycosyltransferase GCNT1.

[0279] In the ninth aspect of the present invention, a method for preparing GCNT2 is provided, which comprises integrating the GCNT2 gene (Uniprot: Q8N0V5-2) into Pichia pastoris (eg, Pichia pastoris GS115) and expressing the target protein, as specifically described in the first aspect of the present invention.

[0280] Specifically, the nucleotide sequence of the GCNT2 gene is shown in SEQ ID NO:2.

[0281] Compared with the traditional chemical synthesis method, the present invention has the following advantages:

[0282] 1. The Pichia pastoris protein expression system was used to achieve the active expression of GCNT1, a key enzyme element responsible for catalyzing the 1-6GlcNAc branch structure in the biosynthesis of O-GalNAc sugar chains. The Pichia pastoris expression system can also be used to achieve the active expression of humanized glycosyltransferases, providing a reference for the in vitro synthesis of complex oligosaccharides and glycoconjugates.

[0283] 2. The present invention synthesized Core 2 trisaccharide with 1-6GlcNAc branches in vitro at the gram level.

[0284] 3. The present invention develops an in vitro enzymatic synthesis strategy for multi-branched sugar chains. By studying the properties of the catalytic reaction of GCNT2, a sequential reaction system is constructed to achieve the synthesis of three-branched, four-branched and other multi-branched O-GalNAc oligosaccharides. The enzymatic synthesis of these branched sugar chains broadens the application scope of glycosyltransferases and provides a reference for the synthesis of oligosaccharides and glycoconjugates with more complex structures. BRIEF DESCRIPTION OF THE DRAWINGS

[0285] Figure 1 The figure shows the results of SDS-PAGE analysis of each component of GCNT1 purification. The detection objects in each lane are: M: pre-stained protein molecular weight standard; Lane 1: fermentation supernatant; Lane 2: PBS rinse; Lane 3: 20mM imidazole eluate; Lane 4: 500mM imidazole eluate.

[0286] Figure 2 Shown are the results of SDS-PAGE analysis of purified GCNT2.

[0287] Figure 3 Shown are the results of Western blotting detection of purified GCNT2.

[0288] Figure 4 The figure shows a schematic diagram of the synthesis route of compound 5. The yellow squares represent N-acetylgalactosamine (GalNAc) residues, the yellow circles represent galactose (Gal) residues, and the blue squares represent N-acetylglucosamine (GlcNAc) residues.

[0289] Figure 5 Shown is a schematic diagram of the synthetic route of compound 6.

[0290] Figure 6 Shown is the MS spectrum of Core2 trisaccharide synthesized in Example 4.

[0291] Figure 7 Shown is the MS spectrum of compound 1 synthesized in Example 5.

[0292] Figure 8 Shown is the MS spectrum of compound 2 synthesized in Example 5.

[0293] Fig. 9 Shown is the MS spectrum of compound 3 synthesized in Example 5.

[0294] Fig.10 Shown is the MS spectrum of compound 4 synthesized in Example 5.

[0295] Fig.11 Shown is the MS spectrum of compound 5 synthesized in Example 5.

[0296] Fig.12 Shown is the MS spectrum of compound 6 synthesized in Example 6. DETAILED DESCRIPTION

[0297] Unless otherwise defined, all scientific and technical terms used in the present invention have the same meanings as commonly understood by one of ordinary skill in the art to which the present invention relates.

[0298] In the present invention, "oligosaccharide", also known as oligosaccharide, is a straight-chain or branched carbohydrate compound composed of a small number (eg, 2-20) of monosaccharide molecules.

[0299]

[00136] Various publications, patents, and published patent specifications are cited herein, the disclosures of which are incorporated by reference in their entireties.

[0300] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0301] The names and sources of the partzymes used in the examples are as follows:

[0302] BlNahK: Bifidobacterium.longum (see Cai, L., Guan, W., Kitaoka, M., Shen, J., Xia, C., Chen, W., & Wang, PG (2009). A chemoenzymatic route to N-acetylglucosamine-1-phosphate analogues: substrate specificity investigations of N-acetylhexosamine 1-kinase. Chemical communications 20,2944-2946.)

[0303] AGX1: Homo sapiens (See, Guan, W., Cai, L., & Wang, PG (2010). Highly efficient synthesis of UDP-GalNAc / GlcNAc analogues with promiscuousrecombinant human UDP-GalNAc pyrophosphorylase AGX1. Chemistry, 16(45), 13343-13345.)

[0304] BiGalK: B. infantis (See, Li, L., Liu, Y., Wang, W., Cheng, J., Zhao, W., & Wang, P. (2012). A highly efficient galactokinase from Bifidobacterium infantis with broad substrate specificity. Carbohydr Research, 355, 35-39.)

[0305] AtUSP: Arabidopsis thaliana (See, Liu, J., Zou, Y., Guan, W., Zhai, Y., Xue, M., Jin, L., Chen, M. (2013). Biosynthesis of nucleotide sugars by a promiscuous UDP-sugar pyrophosphorylase from Arabidopsis thaliana (AtUSP). Bioorganic & Medicinal Chemistry Letters, 23(13), 3764-3768.)

[0306] PmPpA: Pasteurella multocida (See, Lau, K., Thon, V., Yu, H., Ding, L., Chen, Y., Muthana, M.M., Chen, X. (2010). Highly efficient chemoenzymatic synthesis of beta1-4-linked galactosides with promiscuous bacterial beta1-4-galactosyltransferases. Chemical communications, 46(33), 6066-6068.)

[0307] HpLgtA: Helicobacter pylori (See, Li, Y., Xue, M., Sheng, X., Yua, H., Zeng, J., Thon, V., Chen, X. (2016). Donor substrate promiscuity of bacterial beta1-3-N-acetylglucosaminyltransferases and acceptor substrate flexibility of beta1-4-galactosyltransferases. Bioorg Med Chem, 24(8), 1696-1705.)

[0308] NmLgtB: Neisseria meningitidis (see, Li, Y., Xue, M., Sheng, X., Yua, H., Zeng, J., Thon, V., Chen, X. (2016). Donor substrate promiscuity of bacterial beta1-3-N-acetylglucosaminyltransferases and acceptor substrate flexibility of beta1-4-galactosyltransferases. Bioorg Med Chem,24(8),1696-1705.)

[0309] BiGalHexNAcP:Bifidobacteriuminfantis

[0310] Example 1: Expression of glycosyltransferase GCNT1

[0311] The GCNT1 gene (GenBank: BC074885.2) is shown as SEQ ID NO:1.

[0312] The gene was synthesized and constructed into the pPIC9K vector by BGI and stored in Escherichia coli DH5. According to the characteristics of the pPIC9K plasmid multiple cloning site, EcoRⅠ and NotⅠ restriction enzyme sites were selected as the insertion sites of the target gene.

[0313] The E. coli DH5 positive colonies transformed with the pPIC9K-GCNT1 recombinant plasmid were activated by streaking on LB plates and cultured at 37°C for 12 hours; a single colony was picked and inoculated into 5 mL LB liquid culture medium, cultured at 37°C, 220 rpm for 12 hours, and the recombinant plasmid was extracted using a plasmid mini-extraction kit.

[0314] According to the Pichia pastoris operation manual, after the recombinant plasmid sequencing is verified to be correct, the recombinant plasmid needs to be linearized before the subsequent target gene can be integrated into the yeast genome. The pPIC9K-GCNT1 recombinant plasmid was linearized using restriction endonuclease SacⅠ, and the restriction endonuclease reaction process was detected using agarose gel electrophoresis; after the reaction was terminated, the linearized plasmid fragment was recovered using a DNA recovery kit.

[0315] The exogenous gene electrotransformation of Pichia pastoris GS115 was carried out under the conditions of voltage 1.5 kV, capacitance 25 F, and resistance 200 Ω.

[0316] Take 200L of bacterial solution and spread it on MD solid plate, invert and culture at 30℃ for 2-3 days. Pick single colonies and streak them on YPD plates containing different concentrations of Geneticin (G418), invert and culture at 30℃ for 3-4 days to screen the number of recombinant copies.

[0317] Randomly pick a single colony with good growth status on the YPD plate with the highest G418 concentration and suspend it in 40L sterile water; take 20L of bacterial solution, heat at 100℃ for 20min to lyse the bacteria, centrifuge at 15,000×g for 1min, and take the supernatant for colony PCR. The target gene PCR amplification verification was carried out according to the conditions of 94℃ denaturation for 30s, 55℃ annealing for 1min, 72℃ extension for 30s, and 72℃ extension for 5min after 35 cycles. Use agarose gel to verify the PCR product.

[0318] The PCR-positive bacterial suspension was inoculated into YPD medium and cultured overnight at 30°C with shaking at 250 rpm. The strain was preserved in 20% glycerol and stored at -80°C.

[0319] The recombinant bacterial liquid of P. pastoris GS115 integrated with the GCNT1 gene was inoculated into 50 mL of BMGY liquid medium at a 1% inoculation rate, and cultured at 30°C and 250 rpm with shaking until OD600 = 2-6 (about 16-18 h);

[0320] Take 12.5-25mL of bacterial solution, centrifuge at 25°C, 15,000×g for 5 min to collect the bacteria; resuspend the bacteria in 50mL BMMY medium to OD600=1.0, shake and culture at 25°C, 250rpm, and add 500L of methanol every 24h to induce the expression of the target protein;

[0321] 1 mL of sample was taken every 24 hours, and the supernatant and bacteria were collected by centrifugation at 15,000×g for 5 minutes. During the synthesis of the target protein GCNT1, a 6×His protein purification tag was constructed at the C-terminus of the target gene to facilitate the subsequent purification of the target protein GCNT1 using Ni-NTA affinity medium. The protein purification steps are as follows:

[0322] 1) Load an appropriate amount of Ni Sepharose 6 Fast Flow filler into the gravity column, rinse the filler with 10 column volumes of double distilled water to remove impurities in the medium, and then use 5 column volumes of pH 7.5 PBS buffer to balance the column;

[0323] 2) Dilute the collected bacterial culture supernatant 5 times with pH 7.5 PBS buffer, adjust the pH to 7.5 with 5 M NaOH, and collect the diluted sample by centrifugation at 15,000 × g for 5 min;

[0324] 3) First, use 10 column volumes of pH 7.5 PBS buffer to wash the impurities, and then use PBS buffer containing 25mM and 500mM imidazole to gradient elute the impurities and target protein; collect the eluted fractions and use an ultrafiltration tube with a molecular weight cutoff of 10kDa to remove the high concentration of imidazole in the eluate;

[0325] 4) The affinity column was balanced with 10 column volumes of pH 7.5 PBS buffer, and the buffer solution in the purification column was rinsed with 10 column volumes of double distilled water, and the solution was replaced with 20% ethanol solution and the Ni-NTA filler was stored at 4°C.

[0326] 5) Use SDS-PAGE to detect the elution of the target protein in each step of protein purification.

[0327] The results are as follows Figure 1 As shown, the detection objects in each lane are: M: marker; Lane 1: fermentation supernatant; Lane 2: PBS rinse; Lane 3: 20mM imidazole eluate; Lane 4: 500mM imidazole eluate. The band of about 60kDa in Lane 4 is the target protein.

[0328] In order to explore whether GCNT1 can be expressed soluble in other commonly used strains such as P. pastoris KM71, the constructed pPIC9K-GCNT1 was used for soluble expression in P. pastoris KM71, but the results showed that the expressed GCNT1 was inactive. Therefore, pPIC9K-GCNT1 is most suitable for expression in P. pastoris GS115.

[0329] Example 2: Expression of glycosyltransferase GCNT2

[0330] The human GCNT2 (Uniprot: Q8N0V5-2) gene (as shown in SEQ ID NO: 2, encoding amino acids 26-400) was synthesized and constructed into the pET-32a vector by Suzhou Jinweizhi Biotechnology Co., Ltd. According to the characteristics of the pPIC9K multiple cloning site, upstream and downstream primers for target gene amplification with EcoRI and NotI restriction enzyme sites were designed (upstream primer: 5'-CGGAATTCAATTTCGGAGGAGATCCTTCTTTCCA-3' and downstream primer: 5'-ATTTGCGGCCGCTCAATGATGATGATGATGATGATGATGATGATGGAAGTACCAAGAT GGTTGGATG-3) for target gene amplification.

[0331] PCR amplification was performed according to the procedure of denaturation at 95°C for 30s, annealing at 60°C for 1min, extension at 68°C for 1min 20s, and extension at 68°C for 5min after 32 cycles. After PCR amplification, the target gene was recovered, double-digested with EcoRI and NotI, and ligated with T4 DNA ligase at 16°C overnight. The ligation product was transformed into E. coli DH5α, and positive clones were screened on ampicillin plates and sequenced.

[0332] The recombinant plasmid pPIC9K-GCNT2 was extracted using a plasmid mini-extraction kit, and the pPIC9K-GCNT2 recombinant plasmid was linearized using restriction endonuclease SacⅠ according to the Pichia pastoris operation manual. After complete enzyme digestion, the linearized plasmid fragment was recovered using a DNA purification recovery kit. Subsequently, Pichia pastoris was electrotransformed under the conditions of voltage 1.5 kV, capacitance 25 μF, and resistance 200 Ω.

[0333] The bacterial solution was spread on MD plates to screen for His + Transformants were then transferred to YPD plates containing different concentrations of G418 (0.5 mg / mL, 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL) and inverted at 30°C for 3-4 days to screen for high copy number recombinants, and positive colonies were identified by colony PCR. The bacterial suspension identified by colony PCR was inoculated into YPD medium, shaken and cultured at 30°C, 250 rpm overnight, and the strains were preserved in 20% glycerol and stored at -80°C.

[0334] Inoculate 1% of the P. pastoris GS115 glycerol bacteria with the GCNT2 gene into 50mL BMGY liquid medium, shake and culture at 30°C, 250rpm until OD600=2-6; take 12.5-25mL of bacterial solution, centrifuge at 1500×g for 5min to collect the bacteria; resuspend the bacteria in 50mL BMMY medium to OD600=1.0, shake and culture at 25°C, 250rpm, and add 500μL 100% methanol every 24h to induce expression. After 96h, centrifuge at 15,000×g for 8min to collect the fermentation supernatant. The target protein has a 6×His protein purification tag at the C-terminus, and Ni Sepharose 6Fast Flow is used to purify the target protein GCNT2:

[0335] 1) Load an appropriate amount of Ni Sepharose 6 Fast Flow filler into the gravity column, wash the filler with 10 column volumes of ddH2O, and then balance the purification column with 10 column volumes of pH 7.4 PBS buffer;

[0336] 2) The culture supernatant was diluted 5 times with pH 7.4 PBS buffer, then adjusted to pH 7.4 with 5 M NaOH, and centrifuged at 15,000 × g for 5 min to collect the supernatant and use it for subsequent purification of the target protein;

[0337] 3) Wash the impurities with 10 column volumes of pH 7.4 PBS buffer, wash the impurities with PBS buffer containing 10 mM imidazole, and gradient elute the target protein with PBS buffer containing 200 mM imidazole; use an ultrafiltration tube with a molecular weight cutoff of 10 kDa to remove the imidazole in the eluate, and the purified product is detected by SDS-PAGE and Western blotting. The detection results are as follows: Figure 2 and Figure 3 shown.

[0338] Example 3: One-pot multienzyme synthesis of Core 1 disaccharide

[0339]

[0340] Galactose (Gal), adenosine triphosphate (ATP), GalNAcproN3 monosaccharide, MgCl2, and Tris-HCl were prepared into an aqueous solution, the final concentration of Gal in the reaction system was 300 mM, the final concentration of MgCl2 was 20 mM, the final concentration of ATP and GalNAcproN3 monosaccharide was 75 mM, the final concentration of Tris-HCl was 50 mM, and the pH of the reaction system was 7.5. Then, galactokinase (BiGalK) and D-galactose-1,3-N-acetyl-D-hexosamine phosphorylase (BiGalHexNAcP) were added at 1 mg / mL, and the reaction was carried out at 37°C for 30 hours. After the detection reaction was completed, ice ethanol was added to terminate the reaction; the reaction solution was centrifuged for 10-20 minutes, the supernatant was desalted by Bio-Gel P2 molecular sieve, and then separated and purified using a strong alkaline anion exchange resin medium, and desalted again using Bio-Gel P2 molecular sieve to obtain Core1 disaccharide.

[0341] Example 4: One-pot multi-enzyme synthesis of Core 2 trisaccharide

[0342]

[0343] N-acetylglucosamine (GlcNAc), Core 1 disaccharide, adenosine triphosphate (ATP), uridine triphosphate (UTP), MgCl2, and Tris-HCl were prepared into an aqueous solution. The final concentrations of GlcNAc, ATP, and UTP in the reaction system were 150 mM, the final concentration of MgCl2 was 20 mM, and the final concentration of Core 1 was 10 mM. 1 disaccharide has a final concentration of 100 mM, a final concentration of Tris-HCl is 50 mM, and the pH of the reaction system is 7.5. Then, BlNahK, GlcNAc-1-P uridine transferase (AGX1), and pyrophosphatase (PmPpA) are added to catalyze the generation of uridine diphosphate N-acetylglucosamine (UDP-GlcNAc). Glycosyltransferase GCNT1 (prepared in Example 1) is added to catalyze the synthesis of Core2 trisaccharide using Core2 disaccharide as a substrate and UDP-GlcNAc as a glycosyl donor. The reaction is carried out at 37° C. for 7 days. After the reaction is completed (the substrate disappears completely), ice ethanol is added to terminate the reaction. The reaction solution is centrifuged for 10-20 min, the supernatant is desalted by Bio-Gel P2 molecular sieve, and then separated and purified by a strongly basic anion exchange resin medium. After desalting again by Bio-Gel P2 molecular sieve, Core2 trisaccharide (yield: 771 mg, yield: 77%) is obtained.

[0344] Example 5: Enzymatic Synthesis of Compound 1 and Compound 2

[0345]

[0346] Synthesis route such as Figure 1 As shown, where R represents

[0347] Core 2 trisaccharide, uridine diphosphate galactose (UDP-Gal), MgCl2, and Tris-HCl were prepared into an aqueous solution. The final concentration of UTP-Gal in the reaction system was 150mM, the final concentration of MgCl2 was 20mM, the final concentration of Core 2 trisaccharide was 110mM, the final concentration of Tris-HCl was 100mM, the pH of the reaction system was 7.5, and an appropriate amount of β-1,4-galactosyltransferase (NmLgtB) was added. The reaction was carried out at 37°C for 36h. TLC was used to detect the consumption of the reaction substrate and the generation of products and by-products during the reaction. After the reaction was completed, ice ethanol was added to terminate the reaction; the reaction solution was centrifuged for 10-20min, the supernatant was desalted by Bio-Gel P2 molecular sieve, and then separated and purified by a strong alkaline anion exchange resin medium, and desalted by Bio-Gel P2 molecular sieve again to obtain compound 1 (yield: 143.7mg, yield: 52%).

[0348] Compound 1, uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), MgCl2, and Tris-HCl were prepared into an aqueous solution. The final concentration of UDP-GlcNAc in the reaction system was 40mM, the final concentration of MgCl2 was 20mM, the final concentration of compound 1 was 20mM, the final concentration of Tris-HCl was 100mM, the pH of the reaction system was 7.5, and an appropriate amount of β-1,3-N-acetylhexosamine transferase (HpLgtA) was added, and the reaction was carried out at 37°C for 24h. TLC was used to detect the consumption of the reaction substrate and the generation of products and by-products during the reaction. After the detection reaction was completed, ice ethanol was added to terminate the reaction; the reaction solution was centrifuged for 10-20min, the supernatant was desalted by Bio-Gel P2 molecular sieve, and then separated and purified by using a strong alkaline anion exchange resin medium, and desalted again by Bio-Gel P2 molecular sieve to obtain compound 2 (yield: 128mg, yield: 62%).

[0349] according to Figure 1 The synthetic route shown is that compound 3 (yield: 72%), 4 (yield: 55%), and 5 (yield: 60%) are obtained by stepwise reaction of compound 2.

[0350] Example 6: Synthesis of multi-branched O-GalNAc oligosaccharides

[0351]

[0352] according to Figure 2 The synthetic route shown is as follows: Compound 5, uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), and Tris-HCl are prepared into an aqueous solution. The final concentration of compound 5 in the reaction system is 10 mM, the final concentration of UDP-GlcNAc is 50 mM, the final concentration of Tris-HCl is 100 mM, the pH of the reaction system is 7.5, an appropriate amount of glycosyltransferase GCNT2 (prepared in Example 2) is added, and the reaction is carried out at 37° C. for 2 days. Compound 5 is used as a substrate and UDP-GlcNAc is used as a glycosyl donor to catalyze the synthesis of multi-branched O-GalNAc oligosaccharides. The overall reaction lasts for two days. TLC is used to detect the consumption of the reaction substrate and the generation of products and by-products during the reaction. After the detection reaction is completed, ice ethanol is added to terminate the reaction; the reaction solution is centrifuged for 10-20 minutes, the supernatant is desalted by Bio-Gel P2 molecular sieve, and then separated and purified by a strong alkaline anion exchange resin medium, and desalted again by Bio-Gel P2 molecular sieve to obtain compound 6 (yield: 83%).

[0353] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

[0354] The aforementioned embodiments and methods described in the present invention may be varied based on the ability, experience and preference of those skilled in the art.

[0355] In the present invention, merely listing the steps of the method in a certain order does not constitute any limitation on the order of the method steps.

Claims

1. A method for synthesizing GalNAc oligosaccharides, comprising the following steps: (1) Preparation of core 1 disaccharide: Galactose (Gal), the monosaccharide shown in formula Ⅰ, and enzyme Ⅰ react to obtain core 1 disaccharide; in, R is -LX; X is selected from the group consisting of: an azido group, an alkyne group, a sulfhydryl group, an amino acid residue, a lipid residue, a carbohydrate residue, and a protein residue; L is any suitable linking group, such as a single bond, an alkylene group, an oligopeptide residue or a is an integer from 1 to 10; Enzyme I includes: galactokinase (BiGalK), D-galactose-1,3-N-acetyl-D-hexosamine phosphorylase (BiGalHexNAcP); (2) Preparation of core 2 trisaccharide: N-acetylglucosamine (GlcNAc), Core 1 disaccharide, and enzyme II react to obtain core 2 trisaccharide; Enzyme II includes: glycosyltransferase GCNT1; Optionally, (3) extending: Core 2 trisaccharide, galactose (Gal), and glycosyltransferase III react to obtain double-branched oligosaccharide compound 1; Enzyme III includes: β-1,4 galactosyltransferase (NmLgtB); Optionally, (4) extending: The double-branched oligosaccharide compound 1, N-acetylglucosamine (GlcNAc), and glycosyltransferase IV react to obtain the double-branched oligosaccharide compound 2; Enzyme IV includes: β-1,3-N-acetylglucosaminyltransferase (HpLgtA); Optionally, repeating steps (3) and / or (4) to obtain double-branched oligosaccharides of different lengths; (5) Branching: Double-branched oligosaccharides, N-acetylglucosamine (GlcNAc), and enzyme V reaction to obtain multi-branched oligosaccharides; Enzyme V includes: β1,6-N-acetylhexosaminyltransferase (GCNT2).

2. The method according to claim 1, characterized in that The reaction system in step (1) further comprises ATP; Preferably, the molar ratio of the monosaccharide represented by formula I to galactose (Gal) is 1:1-5; Preferably, the molar ratio of the monosaccharide represented by formula I to ATP is 1:1-5; Preferably, the pH of the reaction system in step (1) is 4.5-8.5; Preferably, the reaction temperature in step (1) is 35-40°C; More preferably, step (1) comprises: (1-1) preparing an aqueous solution of galactose (Gal), adenosine triphosphate (ATP), monosaccharide, MgCl2, and Tris-HCl; (1-2) adding galactokinase (BiGalK) and D-galactose-1,3-N-acetyl-D-hexosamine phosphorylase (BiGalHexNAcP) for reaction; (1-3) Termination of the reaction; (1-4) The reaction solution is centrifuged, the supernatant is desalted by Bio-Gel P2 molecular sieve, and then separated and purified by a strong alkaline anion exchange resin medium. After desalting again by Bio-Gel P2 molecular sieve, Core1 disaccharide is obtained.

3. The method according to claim 1, characterized in that Step (2) comprises: reacting uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), Core 1 disaccharide, and enzyme II to obtain core 2 trisaccharide; preferably, in step (2), the molar ratio of Core 1 disaccharide to UDP-GlcNAc is 1:1-5; or, the reaction system in step (2) further comprises nucleoside triphosphates, such as one or two of adenosine triphosphate (ATP), uridine triphosphate (UTP), guanosine triphosphate (GTP), and cytidine triphosphate (CTP), especially ATP and UTP; Preferably, the molar ratio of Core 1 disaccharide to N-acetylglucosamine (GalNAc) is 1:1-5; Preferably, the molar ratio of Core 1 disaccharide to ATP is 1:1-5; Preferably, the molar ratio of Core 1 disaccharide to UTP is 1:1-5; Preferably, enzyme II includes: N-acetylglucosamine 1-site kinase (BlNahK), GlcNAc-1-P uridyltransferase (AGX1), pyrophosphatase (PmPpA), glycosyltransferase GCNT1; Preferably, the pH of the reaction system in step (2) is 4.5-8.5; Preferably, the reaction temperature in step (2) is 35-40°C; More preferably, step (2) comprises: (2-1) preparing an aqueous solution of N-acetylglucosamine (GlcNAc), Core 1 disaccharide, adenosine triphosphate (ATP), uridine triphosphate (UTP), MgCl2, and Tris-HCl; (2-2) Add BlNahK, AGX1, PmPpA, and glycosyltransferase GCNT1, and react; (2-3) Termination of the reaction; (2-4) centrifuging the reaction solution, desalting the supernatant through a Bio-Gel P2 molecular sieve, separating and purifying the supernatant using a strong alkaline anion exchange resin medium, and desalting the supernatant again using a Bio-Gel P2 molecular sieve to obtain Core2 trisaccharide; or, Step (2) comprises: (2-1) preparing an aqueous solution of uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), Core 1 disaccharide, MgCl2, and Tris-HCl; (2-2) Add glycosyltransferase GCNT1 and react; (2-3) Termination of the reaction; (2-4) The reaction solution is centrifuged, the supernatant is desalted by Bio-Gel P2 molecular sieve, and then separated and purified by a strongly basic anion exchange resin medium. The Core2 trisaccharide is obtained after desalting again by Bio-Gel P2 molecular sieve.

4. The method according to claim 1, characterized in that Step (3) comprises: reacting Core 2 trisaccharide, uridine diphosphate galactose (UDP-Gal) and glycosyltransferase III to obtain a double-branched oligosaccharide compound 1; preferably, in step (3), the molar ratio of Core 2 trisaccharide to uridine diphosphate galactose (UDP-Gal) is 1:1-5; or, the reaction system in step (3) further comprises nucleoside triphosphates, such as one or two of adenosine triphosphate (ATP), uridine triphosphate (UTP), guanosine triphosphate (GTP) and cytidine triphosphate (CTP), especially ATP and UTP; Preferably, in step (3), the molar ratio of Core 2 trisaccharide to galactose (Gal) is 1:1-5; Preferably, in step (3), the molar ratio of Core 2 trisaccharide to UTP is 1:1-5; Preferably, in step (3), the molar ratio of Core 2 trisaccharide to ATP is 1:1-5; Preferably, enzyme III includes: galactokinase (BiGalK), UDP-sugar pyrophosphorylase (AtUSP), pyrophosphatase (PmPpA) and β-1,4-galactosyltransferase (NmLgtB); Preferably, the pH of the reaction system in step (3) is 4.5-8.5; Preferably, the reaction temperature in step (3) is 35-40°C; More preferably, step (3) comprises: (3-1) Core 2 trisaccharide, galactose (Gal), adenosine triphosphate (ATP), uridine triphosphate (UTP), MgCl2, and Tris-HCl are prepared into an aqueous solution; (3-2) Add BiGalK, AtUSP, PmPpA, and NmLgtB, and react; (3-3) Termination of the reaction; (3-4) centrifuging the reaction solution, desalting the supernatant through a Bio-Gel P2 molecular sieve, separating and purifying the supernatant using a strong alkaline anion exchange resin medium, and desalting the supernatant again using a Bio-Gel P2 molecular sieve to obtain a double-branched oligosaccharide compound 1; or Step (3) includes: (3-1) Core 2 trisaccharide, uridine diphosphate galactose (UDP-Gal), MgCl2, and Tris-HCl are prepared into an aqueous solution; (3-2) Add NmLgtB and react; (3-3) Termination of the reaction; (3-4) The reaction solution was centrifuged, and the supernatant was desalted by Bio-Gel P2 molecular sieve, separated and purified by strong alkaline anion exchange resin medium, and desalted again by Bio-Gel P2 molecular sieve to obtain the double-branched oligosaccharide compound 1.

5. The method according to claim 1, characterized in that Step (4) comprises: reacting a double-branched oligosaccharide compound 1, uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), and glycosyltransferase IV to obtain a double-branched oligosaccharide compound 2; preferably, in step (4), the molar ratio of the double-branched oligosaccharide compound 1 to uridine diphosphate N-acetylglucosamine (UDP-GlcNAc) is 1:1-5; or, the reaction system in step (4) further comprises nucleoside triphosphates, such as one or two of adenosine triphosphate (ATP), uridine triphosphate (UTP), guanosine triphosphate (GTP), and cytidine triphosphate (CTP), especially ATP and UTP; Preferably, in step (4), the molar ratio of the double-branched oligosaccharide compound 1 to N-acetylglucosamine (GlcNAc) is 1:1-5; Preferably, in step (4), the molar ratio of the double-branched oligosaccharide compound 1 to UTP is 1:1-5; Preferably, in step (4), the molar ratio of the double-branched oligosaccharide compound 1 to ATP is 1:1-5; Preferably, in step (4), the enzyme IV comprises: N-acetylglucosamine 1-position kinase (BlNahK), GlcNAc-1-P uridyltransferase (AGX1), pyrophosphatase (PmPpA), β-1,3-N-acetylglucosamine transferase (HpLgtA); Preferably, the pH of the reaction system in step (4) is 4.5-8.5; Preferably, the reaction temperature in step (4) is 35-40°C; More preferably, step (4) comprises: (4-1) preparing an aqueous solution of the double-branched oligosaccharide compound 1, N-acetylglucosamine (GlcNAc), adenosine triphosphate (ATP), uridine triphosphate (UTP), MgCl2, and Tris-HCl; (4-2) Add BlNahK, AGX1, PmPpA, add HpLgtA, and react; (4-3) Termination of the reaction; (4-4) centrifuging the reaction solution, desalting the supernatant through Bio-Gel P2 molecular sieve, separating and purifying using a strong alkaline anion exchange resin medium, and desalting again using Bio-Gel P2 molecular sieve to obtain a double-branched oligosaccharide compound 2; or, Step (4) comprises: (4-1) preparing a double-branched oligosaccharide compound 1, uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), MgCl2, and Tris-HCl into an aqueous solution; (4-2) Add HpLgtA and react; (4-3) Termination of the reaction; (4-4) The reaction solution was centrifuged, and the supernatant was desalted by Bio-Gel P2 molecular sieve, separated and purified by strong alkaline anion exchange resin medium, and desalted again by Bio-Gel P2 molecular sieve to obtain double-branched oligosaccharide compound 2.

6. The method according to any one of claims 1 to 5, characterized in that: Step (5) comprises: reacting a double-branched oligosaccharide, uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), and enzyme V to obtain a multi-branched oligosaccharide; preferably, in step (5), the molar ratio of the double-branched oligosaccharide to uridine diphosphate N-acetylglucosamine (UDP-GlcNAc) is 1:1-5; or, the reaction system in step (5) further comprises nucleoside triphosphates, such as one or two of adenosine triphosphate (ATP), uridine triphosphate (UTP), guanosine triphosphate (GTP), and cytidine triphosphate (CTP), especially ATP and UTP; Preferably, in step (5), the molar ratio of the double-branched oligosaccharide to N-acetylglucosamine (GlcNAc) is 1:1-5; Preferably, in step (5), the molar ratio of the double-branched oligosaccharide to UTP is 1:1-5; Preferably, in step (5), the molar ratio of the double-branched oligosaccharide to ATP is 1:1-5; Preferably, in step (5), the enzyme V comprises: N-acetylglucosamine 1-position kinase (BlNahK), GlcNAc-1-P uridyltransferase (AGX1), pyrophosphatase (PmPpA), β1,6-N-acetylglucosamine transferase (GCNT2); Preferably, the pH of the reaction system in step (5) is 4.5-8.5; Preferably, the reaction temperature in step (5) is 35-40°C; More preferably, step (5) comprises: (5-1) preparing a double-branched oligosaccharide, N-acetylglucosamine (GlcNAc), adenosine triphosphate (ATP), uridine triphosphate (UTP), and Tris-HCl into an aqueous solution; (5-2) Add BlNahK, AGX1, PmPpA, add GCNT2, and react; (5-3) Termination of the reaction; (5-4) centrifuging the reaction solution, desalting the supernatant through a Bio-Gel P2 molecular sieve, separating and purifying the supernatant using a strong alkaline anion exchange resin medium, and desalting the supernatant again using a Bio-Gel P2 molecular sieve to obtain a multi-branched oligosaccharide; or, Step (5) comprises: (5-1) preparing a double-branched oligosaccharide, uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), and Tris-HCl into an aqueous solution; (5-2) Add GCNT2 and react; (5-3) Termination of the reaction; (5-4) The reaction solution is centrifuged, and the supernatant is desalted by Bio-Gel P2 molecular sieve, separated and purified by strong alkaline anion exchange resin medium, and desalted again by Bio-Gel P2 molecular sieve to obtain multi-branched oligosaccharides.

7. The method according to claim 1, characterized in that The method also includes a step of preparing glycosyltransferase GCNT1, which includes integrating the GCNT1 gene into Pichia pastoris GS115 and expressing the target protein.

8. A multi-branched oligosaccharide compound having the following structure: in, m is an integer from 0 to 5, and n is an integer from 0 to 5; Preferably, the multi-branched oligosaccharide compound has a structure as shown in general formula V, wherein m=2, n=2; More preferably, the multi-branched oligosaccharide compound has the following structure:

9. Use of the oligosaccharide prepared by the method according to any one of claims 1 to 7 or the multi-branched oligosaccharide compound according to claim 8 in the preparation of a sugar chip.

10. A method for preparing GCNT1, comprising integrating the GCNT1 gene into Pichia pastoris GS115 and expressing the target protein; Preferably, the method comprises the following steps: (G-1) Linearizing the recombinant expression vector containing the GCNT1 gene; (G-2) Transforming the linearized recombinant expression vector into yeast competent cells; (G-3) Screening and verification of transformed strains; (G-4) induced expression; Optionally, (G-5) purifying the protein; Preferably, the expression vector is pPIC9K; Preferably, in step (G-1), the recombinant expression vector is linearized by restriction endonuclease SacⅠ.

Images