Kit for absolute quantitative detection of KCNJ5 hotspot mutation based on ddPCR technology platform and detection method thereof

Abstract

The invention relates to a kit for absolutely and quantitatively detecting KCNJ5 hotspot mutation based on a ddPCR technical platform and a detection method of the kit. The kit comprises an upstream primer KCNJ5-451F, a downstream primer KCNJ5-503R, mutant probes KCNJ5-451P-MUT, mutant probes KCNJ5-451P-MUT, mutant probes KCNJ5-503P-MUT, wild probes KCNJ5-451P-WT, wild probes KCNJ5-451P-WT and wild probes KCNJ5-503P-WT. The invention further relates to a kit for absolutely and quantitatively detecting KCNJ5 hotspot mutation based on the ddPCR technical platform and a method for absolutely and quantitatively detecting KCNJ5 hotspot mutation based on the ddPCR technical platform. The kit is simple, convenient and rapid, absolute quantitative detection of KCNJ5 gene hotspot mutation can be completed only through a single-tube reaction system, the kit has good sensitivity and repeatability, the detection result is accurate and reliable, an important gene marker result is provided for prediction of the postoperative curative effect of an APA patient, and the kit has important clinical application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of postoperative efficacy prediction for primary aldosteronism, and particularly relates to a kit for absolutely quantitatively detecting KCNJ5 hotspot mutations based on a ddPCR technology platform and a detection method thereof. Background Art

[0002] Primary aldosteronism (PA) is an endocrine disease caused by excessive secretion of aldosterone by the adrenal cortex due to abnormal adrenal hyperplasia or adenoma, which leads to sodium retention, potassium excretion, increased blood volume, and inhibition of the activity of the renin-angiotensin system. The main clinical manifestations are hypertension and hypokalemia. The prevalence of PA in all hypertensive patients is 5%-7%, and the prevalence in patients with severe hypertension is as high as 20%. According to the different causes, PA can be divided into 6 types, namely aldosterone-producing adenoma (APA), idiopathic hyperaldosteronism (IHA), primary adrenal hyperplasia (also known as unilateral adrenal hyperplasia; primary or unilateral hyperplasia, PAH / UAH), familial hyperaldosteronism (FH), aldosterone-producing adrenocortical carcinoma and ectopic aldosterone-producing adenoma. Gene mutation is one of the important pathogenesis of PA.

[0003] In 2011, somatic mutations in KCNJ5 were first discovered in APA patients: KCNJ5 encodes the potassium channel GIRK4, and mutations lead to K + Selective loss and Na + Increased permeability, Na + Increased influx leads to cell membrane depolarization, and the opening of voltage-gated calcium channels stimulates intracellular calcium ion signal transduction, thereby increasing CYP11B2 expression and aldosterone synthesis. Somatic KCNJ5 mutations vary by race, gender, and age: they are found in approximately 40% of Caucasian APA patients and approximately 77% of East Asian APA patients; they are more common in females and younger patients.

[0004] There are two treatment methods for primary aldosteronism: surgery and medication. APA and PAH are treated with surgery first, with laparoscopic unilateral adrenalectomy, and patients are followed up regularly after surgery. If the patient is unwilling to undergo surgery or cannot undergo surgery, medication can be used. Special aldosteronism and glucocorticoid-suppressible primary aldosteronism are treated with medication first. The surgical efficacy of some APA patients is unsatisfactory. The 2017 Primary Aldosteronism Surgical Outcome (PASO) study counted the remission of 705 APA patients 6-12 months after surgery, and mainly classified them from two aspects: clinical remission and biochemical remission: complete clinical remission, partial clinical remission, no clinical remission, complete biochemical remission, partial biochemical remission, and no biochemical remission. The results showed that 37% of APA patients achieved complete clinical remission (blood pressure remained normal without taking antihypertensive drugs after surgery); 94% of APA patients achieved complete biochemical remission (blood potassium and aldosterone-renin ratio returned to normal after surgery). A clinical study published by the research team in 2021 explored the relationship between genotyping and surgical efficacy of PA patients: KCNJ5 mutation contributes to clinical complete remission in APA patients after surgery. The study included 458 APA patients who underwent adrenal surgery and were followed up for more than 6 months after surgery. Among them, 324 (70.7%) patients had somatic mutations in KCNJ5. Multivariate logistic regression analysis determined that KCNJ5 mutation was an independent predictor of clinical complete remission.

[0005] Droplet Digital PCR (ddPCR) is a technology for absolute quantitative analysis of nucleic acid molecules. Its core is to achieve absolute quantification of the copy number of the target molecule to be tested through large-scale parallel single-molecule amplification. It does not require reference standard samples and standard curves, and does not rely on cycle threshold (Ct value) to achieve absolute quantitative analysis. Its advantages include the following four aspects: (1) Ultra-high sensitivity: single-molecule PCR amplification, with a sensitivity of more than 1 / 10000; (2) Absolute quantification: independent of standards and standard curves, eliminating the effect of amplification efficiency on Ct value; (3) High specificity: generally using Taqman-MGB hydrolysis probes, which can easily distinguish single-base mutations; (4) High tolerance: high tolerance to background nucleic acids and PCR inhibitors, ensuring the correct and effective amplification of the target fragment.

[0006] Absolute quantitative detection of gene mutations based on ddPCR detection technology has been studied and applied in some malignant tumors, such as lung cancer, breast cancer, colorectal cancer, glioma and pancreatic tumors, but there is currently no research related to aldosterone-producing adenoma. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide a kit for absolute quantitative detection of KCNJ5 hotspot mutations based on the ddPCR technology platform and a detection method thereof. The kit is simple and fast, and only requires a single-tube reaction system to complete the absolute quantitative detection of KCNJ5 gene hotspot mutations. It has good sensitivity and repeatability, and the test results are accurate and reliable. It provides important gene marker results for the prediction of postoperative efficacy of APA patients, and has important clinical application value.

[0008] The present invention provides a kit for absolutely quantitatively detecting KCNJ5 hotspot mutations based on a ddPCR technology platform, the kit comprising:

[0009] Upstream primer KCNJ5-451F: CCGCTTTCCTGTTCTCCATTGA;

[0010] Downstream primer KCNJ5-503R: GCATTGACGATGGAGCCCA;

[0011] Mutation probe KCNJ5-451P-MUT: VIC-CCATACCTAATGGTTG-MGB;

[0012] Mutation probe KCNJ5-503P-MUT: Cy5-ACTCCGCTTGGTCC-MGB;

[0013] Wild-type probe KCNJ5-451P-WT: FAM-CCATACCCAATGGTT-MGB;

[0014] Wild-type probe KCNJ5-503P-WT: ROX-ACTCCTCTTGGTCCAGG-MGB.

[0015] Furthermore, the reaction system of the kit also includes DEPC water.

[0016] Furthermore, in the reaction system of the kit, the volume of primers is 0.15 μL, the volume of probes is 0.05 μL, and the volume of DEPC water is 0.5 μL, for a total of 1 μL.

[0017] Furthermore, the KCNJ5 hotspot mutations include c.451G>A and c.503T>G.

[0018] The present invention also provides a detection method of a kit for absolutely quantitatively detecting KCNJ5 hotspot mutations based on a ddPCR technology platform, comprising the following steps:

[0019] (1) preparing a reaction system;

[0020] (2) placing the chip loaded with the reaction system into a sample preparation instrument for droplet generation;

[0021] (3) placing the chip that has completed droplet generation into a PCR amplification instrument to amplify the single-molecule target gene in the droplet;

[0022] (4) The amplified chip is placed in a biochip reader for scanning, photographing and image analysis.

[0023] Furthermore, the amplification conditions of step (3) are: 95°C for 10 min; 95°C for 15 s×40; 63°C for annealing for 1 min; 25°C for 5 min.

[0024] Beneficial Effects

[0025] The present invention adopts ddPCR technology to establish a methodological platform for detecting KCNJ5 hotspot mutations (c.451G>A, c.503T>G) in APA patients. The detection results can predict the postoperative efficacy of APA patients. It is simple and fast, only a single-tube reaction system is required for each sample, and the absolute quantitative detection value of the KCNJ5 gene hotspot mutation can be obtained in 2 hours. It has good sensitivity and repeatability, and can detect mutation frequencies of less than one thousandth at the lowest. The detection results are accurate and reliable, providing important gene marker results for the prediction of postoperative efficacy of APA patients, and has important clinical application and promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the ddPCR technology route.

[0027] Figure 2 This is a one-dimensional result diagram of the ddPCR annealing temperature gradient test of the present invention.

[0028] Figure 3 FAM / ROX / VIC / Cy5 detection concentrations of KCNJ5-WT plasmid standard under five different annealing temperature conditions.

[0029] Figure 4 This is the linear correlation experimental result of ddPCR of the present invention.

[0030] Figure 5 This is the result of the ddPCR negative reference experiment of the present invention.

[0031] Figure 6 This is the ddPCR Yang Shen experimental result of the present invention.

[0032] Figure 7 It is the two-dimensional scatter plot result of ddPCR clinical samples of the present invention. DETAILED DESCRIPTION

[0033] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0034] Example 1

[0035] This embodiment provides a kit for absolute quantitative detection of KCNJ5 hotspot mutations based on a ddPCR technology platform, including the following experimental instruments and experimental reagents:

[0036] 1. Pilot Gene Droplet Digital PCR System (D3200);

[0037]

[0038]

[0039] 2. Droplet digital PCR reaction premix (5×mix PCR premix);

[0040] 3. Standards: WT plasmid and MUT plasmid with double mutations of KCNJ5 hotspot (c.451G>A, c.503T>G);

[0041]

[0042] 4. Primers and probes for detecting KCNJ5 hotspot (c.451G>A, c.503T>G) mutations

[0043]

[0044] This embodiment provides a method for detecting the above-mentioned KCNJ5 hotspot mutation, comprising the following steps:

[0045] 1. Preparation of reaction system

[0046] 1.1 Primer probe 15× master solution preparation plan (15μl system / sample)

[0047]

[0048]

[0049] 1.2 15μl system / sample preparation plan

[0050] Element 1 portion (μl) N portions (μl) Mother liquor 1 N 5×mix PCR premix 3 3N Plasmid template Range 1 to 11 / DEPC water Range 0~10 / Total volume 15μl /

[0051] 1.3 Components and concentrations of the final reaction system

[0052]

[0053] 1.4 System Storage

[0054] It is recommended to use the prepared reaction system immediately. If it is not used temporarily (less than 24 hours), it can be stored in a refrigerator at 4°C.

[0055] 2. Droplet generation

[0056] 2.1 Droplet Chip

[0057] A droplet chip has 4 channels and can detect 4 samples. Each channel includes a rectangular droplet scanning area, a sample injection cup, and an oil storage cup. The droplet chip has a unique microfluidic design that can quickly lay tens of thousands of independent, uniform, and stable single-layer droplets in the chip; at the same time, the generation, amplification, and scanning of droplets are all performed in the chip, greatly reducing pipetting operations and contamination risks.

[0058] 2.2 Loading reaction system

[0059] Use a low-adsorption pipette tip to draw 14 μl of the reaction system and slowly load it into the injection cup. Then draw 16 μl of the oil phase and fill the injection cup. Do not introduce bubbles during the process.

[0060] 2.3 Sample preparation instrument

[0061] The chip loaded with the reaction system is placed in the sample preparation instrument for droplet generation. The sample preparation instrument precisely controls the pressure difference between the injection cup and the oil storage cup to press the loaded reaction system into the microchannel to form monodisperse droplets. Each channel can form 20,000 to 30,000 monolayer dispersed droplets with a volume of less than 1 nl.

[0062] 3. PCR amplification

[0063] The chip that has completed droplet generation is placed in a PCR amplification instrument, and the following program is run to amplify the single-molecule target gene in the droplet.

[0064]

[0065] 4. Reading instrument analysis

[0066] The amplified chip is placed in a biochip reader for scanning, photographing and image analysis. Four fluorescence channels corresponding to the probes are selected: FAM-451WT; VIC-451MUT; ROX-503WT; Cy5--503MUT. FAM is set as the positioning channel. Image analysis can obtain one-dimensional, two-dimensional and three-dimensional images. Finally, the results are exported for further data processing.

[0067] Mutation rate: the proportion of the target gene in the total gene amount;

[0068] FAM / VIC / ROX / Cy5 concentration (copies / μl): the number of copies of the FAM / VIC / ROX / Cy5 signal gene per μl of sample;

[0069] Effective points / wells: The number of droplets effectively generated in the chip.

[0070] This example verifies the methodology of the ddPCR detection platform for KCNJ5 hotspot mutations through annealing temperature gradient experiments, blank detection limit experiments, minimum detection limit experiments, linear correlation experiments, repeatability experiments, and Yin and Yang experiments. Clinical sample detection application: Sample detection for a patient with primary aldosteronism with unilateral double nodules.

[0071] 1. Annealing temperature gradient experiment

[0072] If the annealing temperature is too low, non-specific primer or probe binding will occur, resulting in poor amplification specificity and an increase in false positive results. If the annealing temperature is too high, primers or probes will bind poorly to the template, resulting in poor amplification efficiency and an increase in false negative results. Ideally, the annealing temperature should be low enough to ensure effective binding of primers and probes to the target sequence, but high enough to reduce non-specific binding.

[0073] In order to determine the optimal annealing temperature for ddPCR amplification, an annealing temperature gradient experiment was performed using the KCNJ5-WT plasmid standard to verify the amplification specificity and efficiency when the annealing temperature was 61, 62, 63, 64, and 65°C.

[0074] Figure 2 This is a one-dimensional graph of FAM fluorescence (detection of 451WT) ddPCR of KCNJ5-WT plasmid standard under five different annealing temperature conditions. Each point represents a droplet, and the ordinate value represents the fluorescence intensity of the droplet. The pink line is the threshold for distinguishing FAM fluorescence positive droplets (blue) and negative droplets (gray). It can be seen that as the annealing temperature increases, the fluorescence intensity of the droplets decreases, and the number of WT positive droplets decreases, indicating that the amplification efficiency of the system decreases.

[0075] Figure 3 The FAM / ROX / VIC / Cy5 detection concentrations (copies / μl) of the KCNJ5-WT plasmid standard under five different annealing temperature conditions, where VIC and Cy5 are fluorescence channels for detecting two KCNJ5 mutation sites. It can be seen that at a lower annealing temperature (61°C), there are more non-specific primers or probes binding, thus detecting false positive KCNJ5 mutations in the KCNJ5-WT plasmid standard. As the annealing temperature increases, the false positive rate decreases and the detection specificity of the system increases.

[0076] Based on the above results, in order to ensure both the amplification specificity and efficiency of the system, we determined the optimal annealing temperature to be 63°C.

[0077] 2. Blank detection limit experiment

[0078] Limit of Blank (LOB): defined as the highest copy number concentration of 451MUT and 503MUT that can be detected in a constant concentration of KCNJ5-WT plasmid background.

[0079] LoB = Average 空白 +1.645(SD 空白 )

[0080] The test was repeated 10 times with a constant concentration of KCNJ5-WT plasmid, and was performed on two days. According to the formula, it was finally determined that when the annealing temperature was 63°C, LOB VIC =0.717775;LOB CY5 =0.346003 (unit: Copies / μl)

[0081] 3. Minimum detection limit experiment

[0082] Limit of Detection (LOD): LOD is the lowest analyte concentration that can be reliably distinguished from LOB and detection is feasible. LOD is determined by repeated testing using the measured LOB and samples known to contain low concentrations of the analyte.

[0083] LoD = LoB + 1.645 (SD 低浓度样品 )

[0084] Serially diluted KCNJ5-MUT plasmids were added to the constant concentration of KCNJ5-WT plasmid background, so that the mutation site frequency (Mutant Allel Frequency, MAF) was 2%, 1%, 0.5%, 0.2%, 0.1%, 0.05%, 0.025%, and 0.01%, respectively. Each concentration was tested 10 times on two days. The minimum detection limit of the two mutation sites was finally determined: LOD VIC =1.00647133(MAF=0.05%);LOD CY5 =0.88767197 (MAF=0.025%) (Unit: Copies / μl). The lowest detectable mutation frequency of c.451G>A site is 0.05%; the lowest detectable mutation frequency of c.503T>G site is 0.025%.

[0085] 4. Linear correlation experiment

[0086] Linearity: The ability to provide results that are proportional to the concentration (amount) of the analyte in the test sample (over a given range).

[0087] R 2 : Goodness of fit is the degree of fit of the linear regression line to the observed value. 2 >0.98, indicating strong linear correlation.

[0088] Mixed samples of KCNJ5-WT plasmid and KCNJ5-MUT plasmid at different concentrations were prepared for ddPCR test and verification. Each concentration was tested in quadruplicate, and the experiment was repeated twice on two days. The final result was averaged. The obtained verification data analysis results are shown in the figure below. Figure 4 As shown, the linear validation experimental results R2 of the four fluorescence channels are all greater than 0.98, indicating that the detection system has a strong linear correlation.

[0089] 5. Repeatability Experiment

[0090] A mixed sample containing KCNJ5-WT plasmid and KCNJ5-MUT plasmid was used for repetitive experiments, with duplicates and four experiments repeated on four days. The results are as follows:

[0091]

[0092] Coefficient of variation (CV) = (SD / MN) × 100% SD standard deviation; MN mean

[0093] The CV of the repeatability test results is less than 5%, indicating that the repeatability data results between chips are stable.

[0094] 6. Verification results of Yin ginseng and Yang ginseng

[0095] The DNA extracted from the blood samples of patients without KCNJ5 germline mutation was used for negative ginseng verification; the DNA extracted from the same clinical blood samples with KCNJ5-MUT plasmid added was used for positive ginseng verification. The results are as follows: Figure 5 and Figure 6 As shown in the validation results, no hotspot mutations of KCNJ5 were detected in Yin ginseng, while two hotspot mutations of KCNJ5 were detected in Yang ginseng.

[0096] Absolute quantification results of ddPCR clinical samples

[0097]

[0098] 7. Clinical sample testing

[0099] In a patient with primary aldosteronism with unilateral double nodules, the kit of the present invention was used to detect KCNJ5 hotspot mutations, and KCNJ5: c.451G>A mutation was found in 23TND005 (large nodule); while no KCNJ5 hotspot mutation was detected in 23TND006 (small nodule). Figure 7 shown.

[0100] Absolute quantification results of ddPCR clinical samples

[0101]

Claims

1. A kit for absolute quantitative detection of KCNJ5 hotspot mutations based on ddPCR technology platform, characterized in that: The kit comprises: Upstream primer KCNJ5-451F: CCGCTTTCCTGTTCTCCATTGA; Downstream primer KCNJ5-503R: GCATTGACGATGGAGCCCA; Mutation probe KCNJ5-451P-MUT: VIC-CCATACCTAATGGTTG-MGB; Mutation probe KCNJ5-503P-MUT: Cy5-ACTCCGCTTGGTCC-MGB; Wild-type probe KCNJ5-451P-WT: FAM-CCATACCCAATGGTT-MGB; Wild-type probe KCNJ5-503P-WT: ROX-ACTCCTCTTGGTCCAGG-MGB.

2. According to claim 1, it is characterized in that: The reaction system of the kit also includes DEPC water.

3. The detection system according to claim 1, characterized in that: The reaction system of the kit includes 0.15 μL of primers, 0.05 μL of probes, and 0.5 μL of DEPC water, for a total of 1 μL.

4. The detection system according to claim 1, characterized in that: The KCNJ5 hotspot mutations include c.451G>A and c.503T>G.

5. A detection method of a kit for absolute quantitative detection of KCNJ5 hotspot mutations based on the ddPCR technology platform as claimed in claim 1, comprising the following steps: (1) preparing a reaction system; (2) placing the chip loaded with the reaction system into a sample preparation instrument for droplet generation; (3) placing the chip that has completed droplet generation into a PCR amplification instrument to amplify the single-molecule target gene in the droplet; (4) The amplified chip is placed in a biochip reader for scanning, photographing and image analysis.

6. The detection method according to claim 5, characterized in that: The amplification conditions of step (3) are: 95°C for 10 min; 95°C for 15 s×40; 63°C for annealing for 1 min; 25°C for 5 min.

Images