Lung cancer screening miRNA combination and kit thereof

Abstract

The invention discloses a miRNA (micro Ribonucleic Acid) combination for screening lung cancer and a kit of the miRNA combination. The miRNA combination comprises hsa-miR-628-3p, hsa-miR-605, hsa-miR-1204, hsa-miR-4443, hsa-miR-940, hsa-miR-4728-3p, hsa-miR-296-5p, hsa-miR-3130-5p and hsa-miR-216b-5p, and is characterized in that the miRNA combination is prepared from the following raw materials in parts by weight: 20-30% of miRNA, 20-30% of miRNA, 20-30% of miRNA, 20-30% of miRNA and 20-30% of miRNA. The kit further comprises a reverse transcription reaction solution, an amplification detection solution, a nucleic acid extraction reagent, a washing solution, an eluent, a buffer solution, a positive control, a negative control and a blank control. The product is small and exquisite in design and convenient to carry, detection can be completed only by obtaining a blood sample from veins of a patient, and the screening accuracy can be effectively improved while the cost of the patient is reduced by screening lung cancer through blood miRNA. And omission and reduction of quality are avoided.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular diagnosis, and in particular to a miRNA combination for screening lung cancer and a kit thereof. Background Art

[0002] At present, the diagnosis of early lung cancer mostly uses imaging and biomarker diagnosis. Imaging methods include low-dose CT scans, MRI, PET-CT and other methods. Imaging can analyze lung lesions from a macroscopic perspective, but it is difficult to observe microscopic pathological changes. Its sensitivity is low and may not meet the demand for "early screening". In addition, there are many other diseases in the lungs that may produce nodules or masses, such as tuberculosis and pulmonary sarcoidosis. The specificity of imaging diagnosis for these lesions is also low; furthermore, when nodules or masses visible in the lungs have appeared, the disease may no longer be in the early stage, and it is even more difficult to control its progression and metastasis.

[0003] Biomarker screening includes serum tumor marker detection and DNA methylation. Serum tumor marker detection can observe changes in indicators in the body, reveal pathological changes in the patient's body from a microscopic perspective, and provide a basis for the diagnosis of lung cancer. However, there are problems such as low sensitivity and specificity, and the dynamic changes of markers are not stable enough. DNA methylation also has the problem of low sensitivity and specificity in the diagnosis of lung cancer, which can easily lead to missed diagnosis or misdiagnosis of patients. In addition, the role of circulating tumor DNA indicators in lung cancer screening is still unclear, which is also a challenge for the application of DNA methylation.

[0004] In addition to the above-mentioned commonly used diagnostic methods, some miRNAs have been used for the diagnosis of early lung cancer, such as miRNA-19b. However, most miRNA kits are still imperfect, with problems such as low detection rate and high missed diagnosis rate. In view of the above-mentioned defects of current diagnostic equipment and diagnostic reagents, the present invention aims to establish a low-cost, high-quality, sensitive and specific, highly accepted by patients, lung cancer detection reagent and kit for early screening. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a lung cancer miRNA screening kit. In order to achieve the above object, the present invention adopts the following technical scheme:

[0006] A screening lung cancer miRNA panel includes hsa-miR-628-3p, hsa-miR-605, hsa-miR-1204, hsa-miR-4443, hsa-miR-940, hsa-miR-4728-3p, hsa-miR-296-5p, hsa-miR-3130-5p and hsa-miR-216b-5p.

[0007] Preferably, the hsa-miR-628-3p, hsa-miR-605, and hsa-miR-1204 are indicators of lung adenocarcinoma; the hsa-miR-4443 and hsa-miR-940 are indicators of lung squamous cell carcinoma; the hsa-miR-4728-3p and hsa-miR-296-5p are indicators of non-small cell lung cancer; and the hsa-miR-3130-5p and hsa-miR-216b-5p are indicators of small cell lung cancer.

[0008] Preferably, the kit is used to detect the risk of lung cancer, and the kit is used to detect the level of the miRNA combination, and the miRNA combination is hsa-miR-628-3p, hsa-miR-605, hsa-miR-1204, hsa-miR-4443, hsa-miR-940, hsa-miR-4728-3p, hsa-miR-296-5p, hsa-miR-3130-5p, and hsa-miR-216b-5p as described in claim 1.

[0009] Preferably, the kit further comprises a reverse transcription reaction solution, an amplification detection solution, a nucleic acid extraction reagent, a washing solution, an elution solution, a buffer solution, a positive control, a negative control and a blank control.

[0010] Preferably, the kit is used to detect the level of the miRNA combination in a sample, and the sample is any one of serum, blood, urine or saliva.

[0011] Preferably, the amplification detection solution includes a primer pair and / or a probe.

[0012] Preferably, the primer pair is selected from the following: a primer pair for amplifying hsa-miR-1204: SEQ ID NO.1, SEQ ID NO.2; a primer pair for amplifying hsa-miR-605: SEQ ID NO.3, SEQ ID NO.4; a primer pair for amplifying hsa-miR-628-3p: SEQ ID NO.5; a primer pair for amplifying hsa-miR-4443: SEQ ID NO.6, SEQID NO.7; a primer pair for amplifying hsa-miR-940: SEQ ID NO.8, SEQ ID NO.9; a primer pair for amplifying hsa-miR-4728-3p: SEQ ID NO.10; a primer pair for amplifying hsa-miR-296-5p: SEQ ID NO.11; a primer pair for amplifying hsa-miR-3130-5p: SEQ ID NO.12; Primer pair used to amplify hsa-miR-216b-5p: SEQID NO.13.

[0013] Preferably, the reverse transcription reaction solution includes dNTPs, reverse transcriptase and primers, and the content is 1×1mL; the amplification detection solution is 1-20, including dNTPs, DNA Taq polymerase, primers and fluorescent probes, and the content of each is 1×1mL; the nucleic acid extraction reagent includes magnetic beads and target capture probes, and the content is 1×10mL; the washing solution contains SDS, and the content is 2×30mL; the elution solution includes TWEEN-20, and the content is 1×2mL.

[0014] Preferably, the method of using the kit is as follows: by collecting a patient's blood sample, acquiring the miRNA target, reverse transcribing the miRNA, polymerase chain amplification of the miRNA complementary cDNA, and detecting, whether the patient has lung cancer.

[0015] Using multi-center high-throughput data screening, we accurately identified nine miRNAs that are significantly differentially expressed in lung cancer and normal tissues based on big data. In clinical practice, we only need to collect blood samples from patients to capture these nine miRNAs, and then go through multiple steps such as reverse transcription, fluorescent chain amplification, and detection to finally determine whether the patient has lung cancer.

[0016] In this way, it brings good news to patients - early screening of potential tumors, reducing fear, alleviating economic burden, and improving cure and survival rates; it brings good news to medical workers - high-specificity and high-sensitivity detection methods assist doctors in making accurate clinical diagnoses, improving detection efficiency, reducing work pressure, and helping to understand the progression and treatment results of lung cancer; it brings good news to scientific researchers - promoting them to continuously develop new screening and detection methods, and promoting the implementation of scientific research results in the field of medicine.

[0017] In summary, since the present invention adopts the above technical solution, the present invention has the following technical effects:

[0018] The present invention detects the levels of multiple miRNAs in the patient's body fluids to perform early screening and diagnosis of the patient's lung cancer, and diagnoses and treats the lung cancer as early as possible to improve the cure rate and survival rate.

[0019] The miRNA of the present invention is of many types and can effectively reduce the missed diagnosis rate: the kit contains 9 miRNAs, including lung adenocarcinoma indicators: hsa-miR-628-3p, hsa-miR-605, hsa-miR-1204; lung squamous cell carcinoma indicators: hsa-miR-4443, hsa-miR-940; non-small cell lung cancer indicators: hsa-miR-4728-3p, hsa-miR-296-5p; small cell lung cancer indicators: hsa-miR-3130-5p, hsa-miR-216b-5p, which far exceeds the number of miRNAs in similar patents at present, and also comprehensively covers several cancer subtypes, which can provide more accurate and comprehensive detection results and reduce the missed diagnosis rate of early lung cancer patients.

[0020] The product of the present invention is compact and easy to carry. It can complete the test by simply obtaining a blood sample from the patient's vein. Its appearance can not only reduce the fear of patients when undergoing painful screening methods such as biopsy, but also reduce their psychological pressure when undergoing the examination, and effectively reduce the cost of testing and the economic burden on patients. At the same time, the use of blood miRNA to screen lung cancer can not only reduce the cost of patients, but also effectively increase the accuracy of screening, ensuring that there is no omission or reduction in quality.

[0021] The product of the present invention uses three core technologies, namely, miRNA target acquisition, miRNA reverse transcription, and polymerase chain amplification of miRNA complementary cDNA, to accurately determine the index level of the sample. The product of the present invention combines big data with medical technology, collects patient blood, mainly screens lung adenocarcinoma, incorporates small cell lung cancer and lung squamous cell carcinoma related indicators, extracts and captures 9 miRNAs for the first time, performs miRNA reverse transcription to obtain cDNA, and finally performs fluorescent chain amplification and detection, thereby mastering the most comprehensive, high-precision, low-miss rate, and low-cost miRNA detection technology for early lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1-Figure 5 Highly sensitive and specific miRNA maps for LUAD and LUSC; Figure 1 .hsa-miR-1204; Figure 2 .hsa-miR-605; Figure 3 .hsa-miR-628-3p; Figure 4 .hsa-miR-4443; Figure 5 .hsa-miR-940.

[0023] Figure 6-Figure 7 This is a high-sensitivity and high-specificity miRNA map for NSCLC; Figure 6 .hsa-miR-4728-3p; Figure 7 .hsa-miR-296-5p.

[0024] Figure 8 Differential analysis and volcano plot of SCLC blood miRNA dataset. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and preferred embodiments. However, it should be noted that many details listed in the specification are only for the purpose of enabling the reader to have a thorough understanding of one or more aspects of the present invention, and these aspects of the present invention can be implemented even without these specific details.

[0026] (1) Obtain miRNA expression profiles by collecting multi-center high-throughput data: Multi-center data are obtained through multiple high-throughput databases to obtain the miRNA expression profiles of peripheral blood samples of lung cancer patients.

[0027] (2) Batch screening to obtain highly specific miRNAs: The peripheral blood miRNA data collected from lung cancer patients were screened using R language and other software, and 9 highly specific miRNAs were selected, including lung adenocarcinoma indicators: hsa-miR-628-3p, hsa-miR-605, and hsa-miR-1204; lung squamous cell carcinoma indicators: hsa-miR-4443 and hsa-miR-940; non-small cell lung cancer indicators: hsa-miR-4728-3p and hsa-miR-296-5p; small cell lung cancer indicators: hsa-miR-3130-5p and hsa-miR-216b-5p. For the 7 indicators of lung adenocarcinoma, lung squamous cell carcinoma and non-small cell lung cancer, multiple data sets in the GEO database were used (the specific databases selected are as follows: hsa-miR-1204: GSE68951, GSE55993, GSE40738, GSE27486, GSE152702; hsa-miR-605: GSE68951, GSE55993, GSE40738, GSE2 7486, GSE171517; hsa-miR-628-3p: GSE68951, GSE55993, GSE40738, GSE27486, GSE240757 , GSE152702; hsa-miR-4443: GSE40738, GSE240757, GSE171517, GSE152702; hsa-miR-940: G SE40738, GSE240757, GSE171517, GSE152702; hsa-miR-4728-3p: GSE171517, GSE40738, GS E40738, GSE204950, GSE171517; hsa-miR-296-5p: GSE68951, GSE55993, GSE40738, GSE407 38, GSE27486, GSE240757, GSE240757, GSE204950, GSE17681, GSE171517, GSE171517-, GSE152702, GSE152702) formed a sample set, and the normal tissue in the data set was used as the control to analyze the sensitivity and specificity of the indicator in tumor tissue samples, and the SMD graph was drawn to show the results (see the results). Figure 1-Figure 7 ). For the two indicators of small cell lung cancer: hsa-miR-3130-5p and hsa-miR-216b-5p, the data set cannot accurately display the results using the SMD graph, so the method of drawing the difference volcano graph is used to show the significant difference in expression in tumor tissue (see see Figure 8). Overall, after analyzing the 9 peripheral blood miRNAs, it was found that their expression levels in lung cancer patients were significantly different from those in the healthy control group, which means that they have high specificity. This difference suggests that these miRNAs may become biomarkers for the diagnosis of lung cancer. On the other hand, the high difference suggests that the above miRNAs have high sensitivity in the diagnosis of lung cancer, and the miRNA itself has high tissue specificity. At the same time, each lung cancer subtype contains more than one miRNA, which greatly improves the sensitivity of the kit; not only that, this kit covers all lung cancer subtypes, which means that the kit can be used for early screening of all lung cancers and has wide applicability. Therefore, these 9 miRNAs not only have high sensitivity and high specificity, but also have important value for the clinical diagnosis of lung cancer.

[0028] 2. Experimental detection methods of blood miRNA

[0029] Compared with traditional detection methods, the present invention uses miRNA molecules as targets. MiRNA (microRNA) is a type of short non-coding RNA molecule that can regulate the expression of one or more mRNAs, thereby regulating the expression of human proteins. Therefore, they play an important role in regulating gene expression. The expression patterns of miRNA vary in different types of tumors, which makes miRNA have certain specificity and can be used to distinguish different types of diseases or disease subtypes, so it can be used for the diagnosis of various cancers. Compared with other molecular markers, miRNA has the following advantages: miRNA exists in body fluids (such as blood, urine, saliva) and is relatively stable, and is not easily affected by external factors. This makes miRNA have advantages in non-invasive detection and can be easily detected from patient's body fluid samples. In addition, miRNA is widely present in various tissues and cells of the human body, and its expression pattern changes under different disease states. Therefore, miRNA can be used as a potential biomarker for the diagnosis and prognosis of diseases. Furthermore, miRNA detection technology has been continuously developed, including quantitative PCR, miRNA chips and deep sequencing, etc. These technologies have high sensitivity and can detect trace changes in miRNA expression, which is helpful for early diagnosis and disease monitoring. In summary, as a potential biomarker, miRNA has many advantages in disease diagnosis. Its stability, widespread existence, specificity and high sensitivity make it have broad prospects in clinical applications.

[0030] Example 1

[0031] 1. Selection of miRNA targets in peripheral blood samples of lung cancer patients

[0032] (1) Obtain miRNA expression profiles by collecting multi-center high-throughput data: Multi-center data are obtained through multiple high-throughput databases to obtain the miRNA expression profiles of peripheral blood samples of lung cancer patients.

[0033] (2) Batch screening to obtain highly specific miRNAs: Using R language and other software, the collected peripheral blood miRNA data of lung cancer patients were screened, and 9 highly specific miRNAs were selected, including lung adenocarcinoma indicators: hsa-miR-628-3p, hsa-miR-605, hsa-miR-1204; lung squamous cell carcinoma indicators: hsa-miR-4443, hsa-miR-940; non-small cell lung cancer indicators: hsa-miR-4728-3p, hsa-miR-296-5p; small cell lung cancer indicators: hsa-miR-3130-5p, hsa-miR-216b-5p. By analyzing the 9 peripheral blood miRNAs, it was found that their expression levels in lung cancer patients were significantly different from those in the healthy control group, which means that they have high specificity. This difference suggests that these miRNAs may become biomarkers for diagnosing lung cancer. On the other hand, the high variability suggests that the above miRNAs have high sensitivity in diagnosing lung cancer, and the miRNAs themselves have high tissue specificity. At the same time, each lung cancer subtype contains more than one miRNA, which greatly improves the sensitivity of the kit; not only that, this kit covers all lung cancer subtypes, which means that the kit can be used for early screening of all lung cancers and has wide applicability. Therefore, these 9 miRNAs are not only highly sensitive and specific, but also of great value for the clinical diagnosis of lung cancer.

[0034] The following are the specific sequences of the 9 miRNAs:

[0035] hsa-miR-628-3p:MIMAT0003297:UCUAGUAAGAGUGGCAGUCGA

[0036] hsa-miR-605:

[0037] hsa-miR-605-5p:MIMAT0003273:16-UAAAUCCCAUGGUGCCUUCUCCU-38hsa-miR-605-3p:MIMAT0026621:51-AGAAGGCACUAUGAGAUUUAGA-72

[0038] hsa-miR-1204:MIMAT0005868:UCGUGGCCUGGUCUCCAUUAU

[0039] hsa-miR-4443:MIMAT0018961:UUGGAGGCGUGGGUUUU

[0040] hsa-miR-940: MIMAT0004983: AAGGCAGGGCCCCCGCUCCCC

[0041] hsa-miR-4728-3p: MIMAT0019850: CAUGCCUGACCUCCCUCCUGCCCCAG hsa-miR-296-5p: MIMAT0000690: AGGGCCCCCCCUCAAUCCUGU

[0042] hsa-miR-3130-5p:MIMAT0014995:ACCCAGUCUCCGGUGCAGCCU

[0043] hsa-miR-216b-5p:MIMAT0004959:AAAUCUCUGCAGGCAAAUGUGA

[0044] 2. Experimental detection methods of blood miRNA

[0045] The diagnosis of lung cancer using 9 peripheral blood miRNAs mainly includes several steps: preparing appropriate reagents, extracting patient miRNA, performing reverse transcription and amplification, and obtaining results through fluorescence analysis. Throughout the process, we rely on high-precision instruments for operation. Each step is strictly carried out in accordance with quality control standards to ensure the accuracy of the screening results and effectively reduce the risk of missed diagnosis and misdiagnosis.

[0046] Reagent preparation

[0047] Reagent A

[0048]

[0049]

[0050] Reagent B

[0051]

[0052] Balance the reverse transcription reaction solution, amplification detection solution, nucleic acid extraction reagent, washing solution, elution solution, buffer, positive control, negative control, and blank control to room temperature. Mix the reagents: Mix the nucleic acid extraction reagent, reverse transcription reaction solution, and amplification detection solution in the reagent preparation area. Drip the reagents into the corresponding well plates: Pipette the corresponding doses of the above reagents and drip them into the corresponding well plates. The nucleic acid extraction reagent is dripped into each well of the 96-well deep well plate (TP), the reverse transcription reaction solution is dripped into the 96-well PCR plate (RP), and the amplification detection solution is dripped into another 96-well PCR plate (PP). The primer sequences are as follows:

[0053] Tailing method (only forward primer needs to be designed)

[0054] hsa-miR-1204

[0055] F:ACCUCGUGGCCUGGUCUCCAUU (SEQ ID NO.1) R:ACCACGAGGCACGTCCTCACCT (SEQ ID NO.2) hsa-miR-605

[0056] F:GCCCUAGCUUGGUUCUAAAUC (SEQ ID NO.3) R:CCTAACTTGATTCTAAATCTCAT (SEQ ID NO.4) hsa-miR-628-3p 5'-GTCGTATCCAGTGCGTTGTCGTGGAGTCGGCAATTGCACTGGATACGACUCUAGU-3'

[0057] (SEQ ID NO.5) hsa-miR-4443

[0058] F:GGUGGGGGGUUGGAGGCGUGGGU (SEQ ID NO.6) R:TGCTCAGGGCTAGAAAGGGATA (SEQ ID NO.7) hsa-miR-940

[0059] F:GUGAGGUGUGGGCCCGGCCCCA (SEQ ID NO.8) R:GTGGGGTCAGGCCCGGGGAGCG (SEQ ID NO.9) hsa-miR-4728-3p 5'-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCAUGCU-3'

[0060] (SEQ ID NO.10) hsa-miR-296-5p 5'-AGGGCCCCCCCUCAAUCCUGU-3'

[0061] (SEQ ID NO.11) hsa-miR-3130-5p 5'-GTCGTATCCAGTGCGTTGTCGTGGAGTCGGCAATTGCACTGGATACGACACCCAG-3'

[0062] (SEQ ID NO.12) hsa-miR-216b-5p 5'-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAAAUCU-3'

[0063] (SEQ ID NO.13)

[0064] (2) Extraction of miRNA targets from peripheral blood

[0065] After collecting peripheral venous blood from patients, store it at low temperature. Subsequently, the positive control, negative control, blank control and blood samples were placed in a 96-well deep-well plate (TP). The magnetic beads were collected using a KingFisher 96-well deep-well magnetic head with washing solution added, and the magnetic beads were transferred to a 96-well deep-well plate (WP1) containing 500 μL washing solution. After that, the magnetic head was removed, the magnetic beads were washed off, and the operation was repeated until all the magnetic beads were transferred to the 96-well deep-well plate (WP1). The 96-well deep-well plate magnetic head and magnetic head cover were used again to transfer the magnetic beads to the 96-well KingFisher plate (WP2), and the operation was the same as before. Subsequently, the magnetic beads in the 96-well KingFisher plate (WP2) were transferred to the 96-well PCR plate (EP) containing the eluent using a 96-well PCR magnetic head cover, and the operation was the same as before. After the PCR plate was sealed, the thermal cycler was started and the temperature was set to 70°C. Collect the beads from the 96-well PCR plate (EP), pipette 5 μL of the eluted product, and add it to the 96-well PCR plate (RP) containing 10 μL of reverse transcription reaction solution. After the sample is added, seal the RP plate with a sealing film.

[0066] (3) Reverse transcription of miRNA into cDNA

[0067] In the amplification detection area, the 96-well PCR plate (RP) liquid is mixed, centrifuged at low speed, and placed in a thermal cycler for reverse transcription.

[0068] (4) PCR amplification

[0069] In the amplification detection area, first add the dilution buffer to the 96-well PCR plate (RP), then dilute the reverse transcription product and gently mix it with a pipette. Subsequently, add the diluted reverse transcription product to the corresponding reaction wells in the PCR plate (PP). After the sample is added, seal the PCR plate (PP) with a sealing film, mix it on a mixer, then centrifuge it at a low speed, and finally place the PCR plate in a PCR thermal cycler for amplification and fluorescence detection.

[0070] (5) High-precision instrument testing

[0071] After the reaction is completed, the data is collected and compared with the positive control, negative control and blank control groups to calculate the comprehensive evaluation value of the detected gene. At the same time, in the process of using miRNA for diagnosis, precision instruments such as thermal cyclers, centrifuges, and fluorescence detectors are required. The team's experimental staff have all received professional training and are proficient in the use of various instruments to ensure precise control of each link, thereby improving the accuracy of the test.

[0072] (6) Strictly follow the testing requirements

[0073] During the testing process, the team strictly followed all operating requirements, including but not limited to adjusting temperature, mixing reagents, washing samples, reverse transcription and amplification, and analyzing results. For each operation, the prescribed time intervals, operating techniques, temperature control, and analysis indicators were strictly followed. This rigorous implementation ensured the accuracy of the test and effectively improved the success rate.

[0074] Test results such as Figure 1-Figure 2 As shown, the results show that:

[0075] To investigate the expression of hsa-miR-1204; hsa-miR-605; hsa-miR-628-3p; hsa-miR-4443; and hsa-miR-940 in lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC), multicenter diversified microarray and RNA-Seq data were collected from multiple databases, including ArrayExpress, Gene Expression Omnibus, The Cancer Genome Atlas (TCGA), and Genotype-Tissue Expression. We used the following specific criteria for data selection: (1) datasets using both microarray and RNA-Seq technologies, (2) human tissue, cell, or body fluid samples, and (3) datasets containing miRNA expression data. Exclusion criteria included (1) duplicate datasets and (2) merged datasets of less than three LUAD, LUSC, or control samples. The pROC package was used to calculate indicators including TF, FP, TN, and FN. Stata16.0 was used to draw sensitivity and specificity plots (see Figure 1 ).

[0076] Figure 2 This is a highly sensitive and specific miRNA map for non-small cell lung cancer (NSCLC).

[0077] The SCLC blood miRNA dataset was downloaded from the NCBI website. The inclusion criteria were (1) datasets using both microarray and RNA-Seq technologies, (2) human tissue, cell or body fluid samples, and (3) datasets containing miRNA expression data. Exclusion criteria included (1) duplicate datasets and (2) merged datasets of less than three SCLC or control samples. Differential analysis was performed using the edgeR package, and a volcano plot of differentially expressed genes between small cell lung cancer and normal samples was created (see Figure 3 ). Red dots are up-regulated genes, blue dots are down-regulated genes, and gray dots are genes with no differential expression (P<0.05, |logFC|>1.0).

[0078] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A miRNA combination for screening lung cancer, characterized in that: Including hsa-miR-628-3p, hsa-miR-605, hsa-miR-1204, hsa-miR-4443, hsa-miR-940, hsa-miR-4728-3p, hsa-miR-296-5p, hsa-miR-3130-5p and hsa-miR-216b-5p.

2. A miRNA combination for screening lung cancer according to claim 1, characterized in that: The hsa-miR-628-3p, hsa-miR-605, and hsa-miR-1204 are indicators of lung adenocarcinoma; the hsa-miR-4443 and hsa-miR-940 are indicators of lung squamous cell carcinoma; the hsa-miR-4728-3p and hsa-miR-296-5p are indicators of non-small cell lung cancer; and the hsa-miR-3130-5p and hsa-miR-216b-5p are indicators of small cell lung cancer.

3. The miRNA kit for screening lung cancer according to claim 1, characterized in that: The kit is used to detect the risk of lung cancer, and the kit is used to detect the level of the miRNA combination, and the miRNA combination is hsa-miR-628-3p, hsa-miR-605, hsa-miR-1204, hsa-miR-4443, hsa-miR-940, hsa-miR-4728-3p, hsa-miR-296-5p, hsa-miR-3130-5p, and hsa-miR-216b-5p as described in claim 1.

4. A miRNA kit for screening lung cancer according to claim 3, characterized in that: The kit also includes a reverse transcription reaction solution, an amplification detection solution, a nucleic acid extraction reagent, a washing solution, an elution solution, a buffer solution, a positive control, a negative control and a blank control.

5. A miRNA kit for screening lung cancer according to claim 3 or 4, characterized in that: The kit is used to detect the level of the miRNA combination in a sample, and the sample is any one of serum, blood, urine or saliva.

6. The miRNA kit for screening lung cancer according to claim 4, characterized in that: The amplification detection solution includes a primer pair and / or a probe.

7. A miRNA kit for screening lung cancer according to claim 6, characterized in that: The primer pair is selected from the following: a primer pair for amplifying hsa-miR-1204: SEQ ID NO.1, SEQ ID NO.2; a primer pair for amplifying hsa-miR-605: SEQ ID NO.3, SEQ ID NO.4; a primer pair for amplifying hsa-miR-628-3p: SEQ ID NO.5; a primer pair for amplifying hsa-miR-4443: SEQ ID NO.6, SEQ ID NO.7; a primer pair for amplifying hsa-miR-940: SEQ ID NO.8, SEQ ID NO.9; a primer pair for amplifying hsa-miR-4728-3p: SEQ ID NO.10; a primer pair for amplifying hsa-miR-296-5p: SEQ ID NO.11; a primer pair for amplifying hsa-miR-3130-5p: SEQ ID NO.12; Primer pair used to amplify hsa-miR-216b-5p: SEQ ID NO.

13.

8. The miRNA kit for screening lung cancer according to claim 4, characterized in that: The reverse transcription reaction solution includes dNTPs, reverse transcriptase and primers, with a content of 1×1 mL; the amplification detection solution is 1-20, including dNTPs, DNA Taq polymerase, primers and fluorescent probes, each with a content of 1×1 mL; the nucleic acid extraction reagent includes magnetic beads and target capture probes, with a content of 1×10 mL; the washing solution contains SDS, with a content of 2×30 mL; the elution solution includes TWEEN-20, with a content of 1×2 mL.

9. The miRNA kit for screening lung cancer according to claim 5, characterized in that: The method of using the kit is as follows: by collecting a patient's blood sample, obtaining the miRNA target, reverse transcribing the miRNA, polymerase chain amplification of the miRNA complementary cDNA, and detecting, whether the patient has lung cancer.

Images