Method for screening high-altitude adaptive cattle by SNP (Single Nucleotide Polymorphism) molecular marker, SNP molecular marker, kit and application

Abstract

The invention discloses a method for screening cattle with high altitude adaptability through an SNP molecular marker, the SNP molecular marker, a kit and application, and relates to the technical field of molecular markers, the SNP molecular marker for screening the cattle with high altitude adaptability has a sequence as shown in SEQ1, the SNP molecular marker is located at the 98502322nd site on a chromosome 11 of a common cattle, C / T base mutation exists on the site, and the SNP molecular marker is located at the 98502322nd site on the chromosome 11 of the common cattle. The corresponding point of the position on the sequence SEQ1 is that C / T mutation exists in the 31st basic group from the 5'terminus. The basic group mutation of the 98502322nd site on the 11 # chromosome of the common cattle is detected based on the Sequence SNP technology, the cattle with strong high-altitude adaptability is screened out through genotype judgment, and the method has the characteristics of high sensitivity, good accuracy and high cost performance.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a method for screening high-altitude adaptable cattle using SNP molecular markers, a SNP molecular marker, a kit and applications. Background Art

[0002] Specialized beef (dairy) cattle breeds (lines) have fast growth, good meat quality, and high milk production, and are often used as hybrid sires for producing yak cattle with good meat or milk production performance in plateau areas. However, since specialized beef (dairy) cattle breeds (lines) originate from low-altitude areas, they are prone to altitude sickness such as hypoxia when raised in high-altitude areas. Therefore, blindly selecting specialized beef (dairy) cattle for plateau breeding will result in their growth and reproductive performance not being fully utilized, or even completely unable to be utilized, which seriously affects the long-term stable and sustainable development of the plateau common cattle and yak industries. Summary of the invention

[0003] The purpose of the present invention is to overcome the deficiencies of the prior art and to provide a method for screening high-altitude adaptable cattle using SNP molecular markers, a SNP molecular marker, a kit and an application.

[0004] The objective of the present invention is achieved through the following technical solutions: A SNP molecular marker for screening cattle adaptable to high altitudes, wherein the sequence of the SNP molecular marker is shown in SEQ1.

[0005] The SNP molecular marker is located at position 98502322 on chromosome 11 of common cattle. There is a C / T base mutation at the position. The corresponding point of its position on sequence SEQ1 is that there is a C / T mutation at the 31st base from the 5' end.

[0006] A method for screening high-altitude adaptable cattle using SNP molecular markers comprises the following steps: The genomic DNA to be tested is used as a template, and PCR amplification is performed using amplification primers to obtain PCR products; the PCR products are digested with SAP enzyme to remove the remaining deoxyribonucleoside triphosphates and primers in the PCR products to obtain digestion products; the digestion products are used as templates, and extension primers are used to perform extension reactions to obtain extension products; the molecular weight difference between the extension product and the non-extended primer is detected to determine the genotype, and based on the genotype of the SNP molecular marker, when the genotype of the SNP molecular marker is TT, it is determined that the cattle have good high-altitude adaptability, when the genotype of the SNP molecular marker is CT, it is determined that the cattle have medium high-altitude adaptability; when the genotype of the SNP molecular marker is CC, it is determined that the cattle have the worst high-altitude adaptability.

[0007] The high-altitude adaptability of cattle with TT genotype is significantly better than that of CT and CC types, and can be used as a genetic marker in the screening and breeding of ordinary cattle for high-altitude adaptability.

[0008] The above-mentioned amplification primers are divided into an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ2, the sequence of the downstream primer is shown in SEQ3, and the sequence of the extension primer is shown in SEQ4. A kit for screening high-altitude adaptable cattle contains amplification primers and extension primers. The amplification primers include upstream primers and downstream primers. The sequence of the upstream primer is shown in SEQ2, and the sequence of the downstream primer is shown in SEQ3; the sequence of the extension primer is shown in SEQ4.

[0009] The above kit also includes dNTPs, Taq DNA polymerase, Mg 2+ , PCR reaction buffer, SAP enzyme and SNP molecular marker standard positive template.

[0010] The present invention also provides an application of a kit in screening high-altitude adaptable cattle, specifically an application in molecular marker-assisted selection of high-altitude adaptability of common cattle, wherein high-altitude adaptability mainly refers to the degree of hypoxia reaction.

[0011] The beneficial effects of the present invention are: The present invention detects the base mutation at the 98502322 position on chromosome 11 of common cattle based on Sequenom SNP technology, and screens cattle with strong high-altitude adaptability through genotype determination. The method has the characteristics of high sensitivity, good accuracy, and high cost performance, and can detect hundreds to thousands of samples at the same time. The operation is convenient, and the test results are true and reliable. It can provide a reference for continuous breeding and molecular marker-assisted selection of common cattle raised at high altitudes. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 is the mass spectrometry detection result of the extension product; DETAILED DESCRIPTION

[0013] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0014] Example 1 This embodiment provides a kit for screening cattle for high altitude adaptability, comprising: (1) Screening of SNP molecular markers for high-altitude adaptability in cattle. The SNP molecular marker is located at position 98502322 on chromosome 11 of common cattle, and there is a C / T base mutation at the position. The nucleotide sequence of the SNP molecular marker is shown in SEQ 1; the nucleotide sequence shown in SEQ1 has a C / T mutation at the 31st base from the 5' end. The SNP molecular marker is based on the ARS-UCD1.3 version of the international reference genome of common cattle. The specific SNP molecular markers are shown below, and the mutation sites are marked (black bold): CTGTGGCATG GAAGTGATGG AAAATGTGGTCAGTAACGAG GTAAGACCTG GAGTGGGAAAAAGGGATGGT GCCCCCTCCA GGTGCCTCCT GGATCTTCCA GGCAGAGAGG CTTTGGGGAGAGCGGGTGTGGTGCTAGTAG GAA Based on the genotype of the SNP molecular marker, when the genotype of the SNP molecular marker is TT, the cattle are judged to have good adaptability to high altitudes; when the genotype of the SNP molecular marker is CT, the cattle are judged to have medium adaptability to high altitudes; and when the genotype of the SNP molecular marker is CC, the cattle are judged to have the worst adaptability to high altitudes.

[0015] (2) A detection primer set for SNP molecular markers, which is used to implement SNP molecular marker screening for high-altitude adaptable cattle, including PCR amplification primers and extension primers.

[0016] The PCR amplification primers include an upstream primer (F) and a downstream primer (R). The nucleotide sequence of the upstream primer is shown in SEQ 2, and the nucleotide sequence of the downstream primer is shown in SEQ 3.

[0017] SEQ 2: ACGTTGGATG CTGTGGCATG GAAGTGATGG SEQ 3: ACGTTGGATG TTCCTACTAG CACCACACCC The nucleotide sequence of the extension primer is shown in SEQ4.

[0018] SEQ 4: TGATGG AAAA TGTGGT (3) Also includes dNTPs, Taq DNA polymerase, Mg 2+ , PCR reaction buffer, SAP enzyme.

[0019] The above-mentioned test kit for screening cattle with high altitude adaptability can be used in auxiliary selection of common cattle with high altitude adaptability.

[0020] Example 2 This embodiment provides a method for screening high-altitude adaptable cattle using SNP molecular markers, and the specific steps are as follows: 1. Extracting genomic DNA from the common cattle to be tested, and performing subsequent testing using the kit provided in Example 1; (1) Sample collection 30 Liangshan cattle were sourced from Leibo County, Liangshan Prefecture (m above sea level), 30 southern Sichuan mountain cattle were sourced from Junlian County, Yibin City (m above sea level), 30 Kongshan cattle were sourced from Tongjiang County, Bazhong City (m above sea level), 30 Simmental cattle were sourced from Hongya County, Meishan City (m above sea level), 20 Ganzi Tibetan cattle were sourced from Jiulong County, Ganzi Prefecture (m above sea level), and 11 Zhangmu cattle were sourced from Nyalam County, Shigatse City (m above sea level). 5 mL of blood was collected from the tail root of adult cattle, anticoagulated with EDTA, and stored in a refrigerator at -20°C for later use, with 151 samples to be tested.

[0021] (2) DNA extraction The genomic DNA in the blood sample was extracted using a ready-made kit. The OD value was detected using a NanoDrop2000 instrument and 1.25% agarose gel electrophoresis was performed. After the DNA quality inspection was qualified, it was transferred to a 96-well plate and stored at -20°C for future use.

[0022] 2. Using the genomic DNA of the common cattle to be tested as a template, use the PCR amplification primers in the primer set to perform a PCR amplification reaction to obtain a PCR product.

[0023] The PCR amplification reaction design is as follows: (1) The reaction system of PCR amplification reaction was 10 μL, including 1 μL of 30 ng / μL genomic DNA, 1.0 μL of 10× PCR reaction buffer, 0.20 μL of 10 mM dNTPs, 0.5 μL of 20 pmol upstream primer F and downstream primer R, 0.20 μL of 2U / μL Taq DNA polymerase, and 6.6 μL of deionized water; (2) The reaction procedure of PCR amplification reaction was as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 45 s, annealing at 59°C for 45 s, extension at 72°C for 60 s, 30 cycles; and hold at 72°C for 5 min.

[0024] 3. Use SAP enzyme to digest the PCR product to remove the remaining deoxyribonucleoside triphosphates (dNTPs) and primers in the PCR product to obtain the digestion product.

[0025] The design of SAP enzyme digestion reaction is as follows: (1) The reaction system of SAP reaction was 7 μL, 10×SAP Buffer 0.17 μL, 1U / μL SAP Enzyme 0.30 μL, deionized water 1.53 μL, and PCR product 5 μL.

[0026] (2) The reaction procedure of SAP reaction was: 37℃ 20 min; 85℃ 5 min.

[0027] 4. Using the digestion product as a template, use the single-base extension primer in the primer set to perform an extension reaction to obtain an extension product.

[0028] The extension reaction design is as follows: (1) The reaction system for the extension reaction was 9 μL, including 0.2 μL of iplex Buffer Plus, 0.2 μL of iplex Termination mix, 0.94 μL of 0.625-1.25 μmol / L primer mix, 0.041 μL of iplex Enzyme, 0.619 μL of deionized water, and 7 μL of SAP+PCR reaction.

[0029] (2) The reaction program of the extension reaction was: 94°C for 30 s; 94°C for 5 s, (52°C for 5 s, 80°C for 5 s, 5 cycles), 40 cycles; 72°C for 3 min.

[0030] The mass spectrometry results of the extension products are as follows Figure 1 As shown, all 151 samples were successfully typed, with a typing success rate of 100%, indicating that the Sequenom SNP technology has a high typing accuracy.

[0031] 5. The above products are detected by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) to detect the molecular weight difference between the extended product and the unextended primer, and the base at that point is determined, thereby determining the genotype, which is CC, CT or TT.

[0032] The distribution frequencies of different genotypes and alleles in all common cattle are shown in Table 1.

[0033] Table 1 Genotype and allele frequencies of the bovine endoglin gene polymorphic sites genotype Frequency Genotype frequency Allele Allele frequency Hardy-Weinberg equilibrium P value CC 107 0.709 C 0.748 CT 12 0.079 T 0.252 P<0.01 TT 32 0.212 The blood DNA samples of 151 common cattle were typed using Sequenom SNP technology, and it was found that there were three genotypes at the C4682T site of the endoglin gene of common cattle, namely wild homozygous CC, heterozygous CT, and mutant homozygous TT. The frequencies of the three genotypes were 0.709 (CC), 0.079 (CT), and 0.212 (TT). The results of the Hardy-Weinberg equilibrium test showed that the site did not reach the Hardy-Weinberg equilibrium state (P<0.05), and further breeding could be carried out for this mutation site.

[0034] Example 3 Based on Example 2, a correlation analysis is performed, as shown below: (1) Association analysis method Statistical analysis was performed using R4.3.3. The chi-square test and Fisher's exact probability method were used for comparison between groups. The unconditional logistic regression model was used to calculate the odds ratio (OR) and its 95% confidence interval ( CI ), P<0.05 was considered statistically significant.

[0035] (2) Results of association analysis The specific results are shown in Table 2. The analysis showed that the genotypes of the endoglin gene C4682T site (CC / TC / TT) were distributed in common cattle living at high and low altitudes. The correlation was calculated by unconditional Logistic regression. The individuals with the TT genotype had a significantly increased adaptability to high altitudes (OR=0.206, 95% CI =0.119-0.338, P<0.01). The statistical results intuitively reflect that the adaptability of common cattle with TT genotype to high altitude is significantly better than that of CC and CT genotypes, and can be used as a genetic marker in the screening and breeding of cattle with high altitude adaptability.

[0036] Table 2 Association analysis between the polymorphism of the C4682T locus of the cattle endoglin gene and the high-altitude adaptability of common cattle The above is only a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the form disclosed herein, and should not be regarded as excluding other embodiments, but can be used in various other combinations, modifications and environments, and can be modified within the scope of the concept described herein through the above teachings or the technology or knowledge of the relevant field. The changes and modifications made by those skilled in the art shall not deviate from the spirit and scope of the present invention, and shall be within the scope of protection of the claims attached to the present invention.

Claims

1. A SNP molecular marker for screening cattle for high altitude adaptability, characterized in that: The sequence of the SNP molecular marker is shown in SEQ1.

2. The SNP molecular marker according to claim 1, characterized in that: The SNP molecular marker is located at position 98502322 on chromosome 11 of common cattle, and there is a C / T base mutation at the position. The corresponding point of its position on the sequence SEQ1 is that there is a C / T mutation at the 31st base from the 5' end.

3. A method for screening cattle for high altitude adaptability using SNP molecular markers, characterized in that: The following steps are involved: Using the genomic DNA to be tested as a template, PCR amplification is performed using amplification primers to obtain PCR products; Digesting the PCR product with SAP enzyme to remove the remaining deoxyribonucleoside triphosphates and primers in the PCR product to obtain a digestion product; Using the digestion product as a template and an extension primer to perform an extension reaction to obtain an extension product; The molecular weight difference between the extended product and the unextended primer was detected to determine the genotype based on the genotype of the SNP molecular marker. When the genotype of the SNP molecular marker was TT, the cattle were judged to have good adaptability to high altitudes.

4. The method for screening high-altitude adaptable cattle using SNP molecular markers according to claim 3, characterized in that: The amplification primers are divided into an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ2, and the sequence of the downstream primer is shown in SEQ3.

5. The method for screening high-altitude adaptable cattle using SNP molecular markers according to claim 3, characterized in that: The sequence of the extension primer is shown in SEQ 4.

6. A kit for screening cattle for high altitude adaptability, characterized in that: It contains amplification primers and extension primers, wherein the amplification primers include an upstream primer and a downstream primer, the sequence of the upstream primer is shown in SEQ2, the sequence of the downstream primer is shown in SEQ3; the sequence of the extension primer is shown in SEQ4.

7. The kit according to claim 6, characterized in that: Also includes dNTPs, Taq DNA polymerase, Mg 2+ , PCR reaction buffer, SAP enzyme and SNP molecular marker standard positive template.

8. Use of the kit according to claim 6 or 7 in screening cattle adapted to high altitudes.

Images