Pathogenic microorganism detection method based on RPA-THz

Abstract

The invention discloses a pathogenic microorganism detection method based on RPA-THz (recombinase polymerase amplification-THz). The method comprises the following steps: constructing a rapid and efficient RPA reaction system and an enrichment method of main related pathogenic microorganism DNA (deoxyribonucleic acid); establishing a terahertz detection method for the RPA product of the main related pathogenic microorganism DNA; and a terahertz high-specificity, high-sensitivity and rapid detection normal form process of main related pathogenic microorganisms is established. The method can be used for rapidly, sensitively and specifically detecting pathogenic microorganisms threatening human safety. On the basis of the terahertz wave technology, RPA amplification and probe capture are combined, so that pathogenic microorganisms are recognized and detected through spectral information, possibility is provided for intelligent recognition of the pathogenic microorganisms, an important basis is provided for diagnosis and subsequent treatment of infectious diseases, and the method has important significance in treating patients, controlling epidemic situation development, reducing casualties and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogenic microorganism detection, and in particular to a pathogenic microorganism detection method based on RPA-THz. Background Art

[0002] Common detection methods for pathogenic microorganisms include: isolation and culture method, immunoassay method and nucleic acid detection method. Isolation and culture method is a relatively direct diagnostic method, but its results are affected by many factors (including sampling conditions, culture conditions, etc.), and there are also problems such as long time consumption (48 to 96 hours) and low sensitivity. Compared with the isolation and culture method, although immunoassay (eg. Enzyme-Linked Immunosorbent Assay, ELISA) and nucleic acid detection method (such as real-time fluorescence quantitative PCR) have greatly improved the detection sensitivity and specificity, and have been widely used in the field of pathogenic microorganism detection, ELISA detection takes about 5 to 24 hours, and qPCR detection takes about 1 to 4 hours, and the detection time is still relatively long.

[0003] Terahertz detection technology, such as terahertz time-domain spectroscopy (THz-TDS), brings a new rapid detection method to disease and health monitoring in the biomedical field. Terahertz waves (THz) are electromagnetic waves with a frequency of 0.1 to 10 THz and a wavelength of 30 to 300 μm. They have the characteristics of high resolution, high transmittance, low photon energy, high safety, and molecular "fingerprint spectrum". Since the THz frequency band is in the same range as the inherent weak interaction force between biological molecules such as nucleic acids and proteins, and the energy levels of skeleton vibration and rotation, information about the structure of biological macromolecules can be obtained by measuring the absorption and scattering of terahertz radiation. Studies have reported that terahertz detection technology has been applied to the rapid detection of biological molecules such as viruses, bacteria, nucleic acids, proteins, peptides, purines and pyrimidines, and amino acids, and their terahertz characteristic maps have been drawn, among which the sensitivity of proteins and DNA has reached the μg to ng level respectively. However, when using terahertz waves to directly detect pathogenic microorganisms, the terahertz absorption signal of the microorganism itself is weak and similar to the signal of water molecules, which may lead to insufficient detection sensitivity. In addition, the interference of impurities in complex biological samples will reduce the accuracy of pathogen detection. Some studies have proposed to use the specific binding principle of antibodies and antigens to capture pathogens and their antigens, and combined with terahertz detection technology to achieve new specific and sensitive detection, but there are shortcomings such as long screening and preparation cycle, high cost, complicated operation, and the need for low-temperature storage. The rational use of nucleic acid molecular probes is expected to solve this problem.

[0004] Recombinase polymerase amplification (RPA) is a method for rapid isothermal amplification of nucleic acids developed by Piepenburg et al. in 2006. It uses specific enzymes and primers to rapidly amplify target DNA or RNA sequences in vitro. Compared with qPCR, this method has comparable specificity, but has a faster amplification speed (20 min), a lower reaction temperature (37-42 ° C), and does not require high-temperature cycles. Compared with rolling circle amplification (RCA), its primer design is simpler and does not require special equipment. These characteristics make RPA perform well in field testing and low-resource environments, and it has been widely used in the detection of bacteria, fungi, parasites, viruses, and drug-resistant genes. At present, the commonly used detection methods for RPA products are agarose gel electrophoresis (RPA-GE), lateral flow banding (RPA-LFD), and real-time fluorescence (RT-RPA). RPA-GE and RPA-LFD are simple to operate, low cost, and intuitive results, but their quantitative ability is weak and their sensitivity is usually low. There is an urgent need to develop a method for rapid detection of RPA products with high sensitivity, high specificity, and high sensitivity. Among them, the use of terahertz detection technology to achieve rapid, specific, and sensitive detection of RPA products is a possible direction. Summary of the invention

[0005] The present invention provides an innovative detection method (RPA-THz) combining recombinase polymerase amplification (RPA) with terahertz time-domain spectroscopy (THz-TDS) technology, which is used for rapid, specific and highly sensitive detection of pathogenic microorganisms in the fields of food safety, medical health and animal husbandry.

[0006] The technical solution provided by the present invention is as follows:

[0007] A method for detecting pathogenic microorganisms based on RPA-THz, comprising the following steps:

[0008] Extracting genomic DNA of target pathogenic microorganisms to obtain genomic DNA of target pathogenic microorganisms;

[0009] According to the genomic DNA of the target pathogenic microorganism, an RPA amplification product system is constructed, and an RPA reaction is performed using a kit to obtain an RPA amplification product;

[0010] The capture probe and the streptavidin-coated magnetic beads are sequentially added to the RPA amplification product to obtain different types of magnetic beads through the reaction, wherein the different types of magnetic beads include blank magnetic beads, magnetic beads connected with the capture probe, and magnetic beads with the RPA amplification product;

[0011] Measuring the Zeta potential of the different types of MBs, and / or analyzing the obtained magnetic beads with the RPA amplification products by laser confocal microscopy;

[0012] Performing THz time-domain spectroscopy detection on the obtained blank magnetic beads and the magnetic bead solution with the RPA amplification product;

[0013] The target pathogenic microorganisms are prepared into sample solutions of different concentrations, and THz detection is performed on the sample solutions of each concentration to draw a standard curve of the pathogenic microorganism detection method based on RPA-THz; then the detection line of the pathogenic microorganism detection method based on RPA-THz is obtained according to the formula LOD=Blank+3SD, where Blank is the average absorbance value of the blank group and SD is the standard deviation;

[0014] By testing multiple other pathogenic microorganism samples, their absorbance values, extinction coefficients, refractive indices and transmittances are obtained, and then the corresponding coefficients of variation are calculated.

[0015] Furthermore, the target pathogenic microorganisms include Escherichia coli, Candida albicans, Staphylococcus aureus, new coronavirus, herpes zoster virus, and Leishmania.

[0016] Furthermore, if the target pathogenic microorganism is Escherichia coli, the RPA primers in the constructed RPA amplification product system are as follows:

[0017] Forward primer: AAAGGTACATATGTCGGAACATCTGGAGAT;

[0018] Reverse primer: AAAATCATCAGCTCGTTCTACCTAGGCTAA;

[0019] The RPA probes are as follows:

[0020] Biotin-(CH2)6-TGGAATGGAAGTCACCAACGACAAAACAC;

[0021] If the target pathogen is herpes zoster virus, the RPA primers in the constructed RPA amplification product system are as follows:

[0022] Forward primer: GGTGGTGCAGACGATAGCGACGATGATGGGT;

[0023] Reverse primer: GGTCTCTTTGGGGACACGGTTGTTGCACCCAT;

[0024] The RPA probes are as follows:

[0025] Biotin-(CH2)6-GTAATTGAATTTCCAGATTCCGACGCGGAATCATCGGACCGCCAAGACTT;

[0026] If the target pathogen is Candida albicans, the RPA primers in the constructed RPA amplification product system are as follows:

[0027] Forward primer: CCGGAGAACATGCCTGTAAGAGCGTCGT;

[0028] Reverse primer: TGAAGATAAAGTTTGAAGATACACGTGG;

[0029] The RPA probes are as follows:

[0030] Biotin-(CH2)6-TGCTTGTTAGACGGTAGAACTAAGGCGTTATCGCTTTGACAATGG;

[0031] If the target pathogen is Leishmania, the RPA primers in the constructed RPA amplification product system are as follows:

[0032] Forward primer: CCAACTGCATGCCATATTCTCAGTGTCGAA;

[0033] Reverse primer:GATGATATCGTTCAGCAAAATGTTGTCGAT;

[0034] The RPA probes are as follows:

[0035] Biotin-(CH2)6-CAACACGATAACTCCTCTCTTTCTGCACATATATATATTATACCAT.

[0036] Furthermore, before successively adding the capture probe and the streptavidin-coated magnetic beads to the RPA amplification product, the method further comprises:

[0037] The streptavidin-coated magnetic beads were washed with 1×B&W buffer, resuspended in 2×B&W buffer, and the concentration was adjusted to 5 μg / μL to obtain a streptavidin-coated magnetic bead suspension.

[0038] Furthermore, the capture probe and the streptavidin-coated magnetic beads are successively added to the RPA amplification product to obtain different types of magnetic beads through the reaction, specifically:

[0039] Take 4 μL of the RPA amplification product and put it into three centrifuge tubes, add 4 μL of capture probes into the three centrifuge tubes respectively, first carry out a metal bath at 45°C for 5 min, then carry out a metal bath at 27°C for 5 min, let it stand at room temperature for 5 min, then add 4 μL of the streptavidin-coated magnetic bead suspension, separate the magnetic beads bound to the RPA amplification product by magnetic separation, and wash 3 times with 1×B&W buffer to obtain different types of magnetic beads.

[0040] Further, the measuring of the Zeta potential of the different types of MBs and / or the analysis of the obtained magnetic beads with the RPA amplification products by laser confocal microscopy comprises the following steps:

[0041] 10 μL of each of the blank magnetic beads, the magnetic beads connected to the capture probes, and the magnetic beads with the RPA amplification products were washed twice and suspended in 1 mL of deionized water and shaken evenly;

[0042] Zeta potential measurements using a Malvern Zetasizer Nano-ZS90 particle size analyzer; and / or

[0043] Take 10 μL of the magnetic beads with the RPA amplification product, wash with deionized water, add to a 1.5 mL centrifuge tube, add deionized water for washing, add 10 μL of SYBR Green II dye, mix well, incubate at room temperature in the dark for 3 minutes, and perform laser confocal microscopy analysis using a confocal microscope.

[0044] Furthermore, the obtained blank magnetic beads and the magnetic bead solution with RPA amplification products are subjected to THz time-domain spectroscopy detection, specifically:

[0045] 10 μL of the blank magnetic bead solution and the magnetic bead solution with RPA reaction products were respectively taken and placed in a terahertz detection container, the moisture was removed, nitrogen was continuously filled, and a stable transmission scanning mode was used for analysis. Each spectrum was scanned 300 times and the experiment was repeated 3 times. Time domain and frequency domain data were collected and converted into absorption values, extinction coefficients, refractive indices and transmittances, and data analysis was performed at 0-5 THz.

[0046] Furthermore, the target pathogenic microorganisms were prepared into sample solutions with concentrations of 55 to 0.0055 ng / mL, and THz detection was performed three times on the sample solutions of each concentration.

[0047] Furthermore, by testing multiple other pathogenic microorganism samples, specifically: testing two other groups of pathogenic microorganism samples with concentrations of 0.22 ng / mL and 0.022 ng / mL 10 times, obtaining the average absorbance of the other two groups of pathogenic microorganism samples, and calculating the standard deviation of the other two groups of pathogenic microorganism samples, and obtaining the coefficient of variation based on the average value and the standard deviation.

[0048] Furthermore, the genomic DNA of the target pathogenic microorganism is extracted using methods including: CTAB method, glass bead method, ultrasonic method, grinding method, freeze-thaw method, guanidine isothiocyanate method, alkaline lysis method and enzyme method.

[0049] Compared with the prior art, the present invention has the following beneficial effects:

[0050] The RPA-THz-based pathogen detection method provided by the present invention can quickly, sensitively and specifically detect pathogens that threaten human safety. Based on terahertz wave technology, combined with RPA amplification and probe capture, pathogens can be identified and detected through spectral information, which makes it possible to intelligently identify pathogens. It provides an important basis for the diagnosis and subsequent treatment of infectious diseases, and is of great significance for treating patients, controlling the development of the epidemic, and reducing casualties.

[0051] The RPA-THz-based pathogenic microorganism detection method provided by the present invention is convenient and fast, and can identify Escherichia coli and various pathogenic microorganisms in a relatively short time, so as to timely discover problems and take corresponding measures. It does not require expensive instruments and equipment, and has the advantages of high sensitivity and good specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 A flow chart of the pathogenic microorganism detection method based on RPA-THz provided by the present invention;

[0053] Figure 2 A is the electrophoresis result of the extracted E. coli genomic DNA, and B is the result after RPA amplification of the E. coli DNA;

[0054] Figure 3 This is a Zeta potential result diagram in an embodiment of the present invention;

[0055] Figure 4 The fluorescence staining result diagrams in the embodiments of the present invention, wherein A is the CP-MB fluorescence result diagram, and B. is the RPA-MB fluorescence result diagram;

[0056] Figure 5 This is a terahertz detection diagram of the RPA product of Escherichia coli at six different concentrations in an embodiment of the present invention;

[0057] Figure 6 This is a graph showing the absorbance results of an Ecoli genomic DNA sample detected using a transmission terahertz time-domain spectroscopy system in an embodiment of the present invention;

[0058] Figure 7 Draw a graph of the absorbance value and the Log value of the concentration of E coli genomic DNA in the embodiment of the present invention;

[0059] Figure 8 Graphs showing the specificity and repeatability verification results of the RPA-MB-THz detection method in an embodiment of the present invention, wherein A is a graph showing the absorbance of the detected Ecoli and VZV samples, B is a graph showing the relative standard deviation (RSD) of one group of Ecoli samples, and C is a graph showing the relative standard deviation (RSD) of another group of Ecoli samples;

[0060] Fig. 9 This is a graph showing the absorbance results of detecting a VZV genomic DNA sample using a transmission terahertz time-domain spectroscopy system in an embodiment of the present invention;

[0061] Fig.10 A graph of the absorbance value and the Log value of the concentration of VZV genomic DNA is drawn in the embodiment of the present invention;

[0062] Fig.11 This is a graph showing the absorbance results of detecting a Candida albicans genomic DNA sample using a transmission terahertz time-domain spectroscopy system in an embodiment of the present invention;

[0063] Fig.12 Draw a Log value graph of the absorbance value and concentration of Candida albicans genomic DNA in the embodiment of the present invention;

[0064] Fig.13 This is a graph showing the absorbance results of detecting a Leishmania genomic DNA sample using a transmission terahertz time-domain spectroscopy system in an embodiment of the present invention;

[0065] Fig.14 A graph showing the absorbance value and the Log value of the concentration of Leishmania genomic DNA in the embodiment of the present invention. DETAILED DESCRIPTION

[0066] In order to make the purpose, technical scheme and advantages of the embodiments of the present application clearer, the technical scheme in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the embodiments described below are part of the embodiments of the present application, rather than all of the embodiments. The components of the embodiments of the present application described and shown in the drawings here can be arranged and designed in various different configurations.

[0067] See also Figure 1The present invention provides a method for detecting pathogenic microorganisms based on RPA-THz, comprising the following steps:

[0068] Step 1: Construct a fast and efficient RPA reaction system and enrichment method for target pathogenic microorganism DNA

[0069] Step 101: extract the genomic DNA of the target pathogenic microorganism to obtain the genomic DNA of the target pathogenic microorganism.

[0070] The DNA extraction methods used in step 101 include: CTAB method, glass bead method, ultrasonic method, grinding method, freeze-thaw method, guanidine isothiocyanate method, alkaline lysis method and enzyme method.

[0071] Step 102: construct an RPA amplification product system based on the genomic DNA of the target pathogenic microorganism, use a kit to perform an RPA reaction, and obtain an RPA amplification product.

[0072] Step 103, sequentially adding capture probes and streptavidin-coated magnetic beads to the RPA amplification product, and obtaining different types of magnetic beads through the reaction, the different types of magnetic beads including blank magnetic beads (Blank-MB), magnetic beads connected with capture probes (CP-MB) and magnetic beads with RPA amplification products (RPA-MB).

[0073] Step 2: Establish a terahertz detection method for RPA products of target pathogenic microorganism DNA

[0074] Step 201 : measuring the zeta potential of different types of MBs, and / or analyzing the obtained magnetic beads with RPA amplification products by laser confocal microscopy.

[0075] Step 202: Perform THz time-domain spectroscopy detection on the obtained blank magnetic beads and the magnetic bead solution containing the RPA amplification product.

[0076] Step 3: Establish a terahertz high-specificity, high-sensitivity, and rapid detection paradigm for major target pathogenic microorganisms

[0077] Step 301, prepare the target pathogenic microorganism into sample solutions of different concentrations, perform THz detection on the sample solution of each concentration, and draw a standard curve of the pathogenic microorganism detection method based on RPA-THz; then obtain the detection line of the pathogenic microorganism detection method based on RPA-THz according to the formula LOD=Blank+3SD, where Blank is the average absorbance value of the blank group and SD is the standard deviation.

[0078] Step 302: Detect multiple other pathogenic microorganism samples to obtain their absorbance values, extinction coefficients, refractive indices, and transmittances, and then calculate the corresponding coefficients of variation.

[0079] Target pathogenic microorganisms include but are not limited to bacteria such as Escherichia coli and Staphylococcus aureus, viruses such as the new coronavirus and varicella-zoster virus, fungi such as Candida albicans, and parasites such as Leishmania.

[0080] This application performs THz time-domain spectroscopy detection using a mode-locked titanium sapphire laser produced by Shanghai Langyan Optoelectronics Technology Co., Ltd., using a femtosecond laser with a wavelength of 780nm, emitting linearly polarized terahertz pulses of 0.1 to 3.5 GHz from a photoconductive gallium arsenide antenna, modulating the terahertz pulses of 780nm and terahertz amplitude with the time delay between the probe beam and the terahertz pulse to measure the time-resolved amplitude and phase. For a time scan range of 333.3ps, the spectral resolution obtained is about 3 GHz.

[0081] Optionally, if the target pathogen in step 101 is Escherichia coli, the RPA primers in the RPA amplification product system constructed in step 102 are as follows:

[0082] Forward primer: AAAGGTACATATGTCGGAACATCTGGAGAT;

[0083] Reverse primer: AAAATCATCAGCTCGTTCTACCTAGGCTAA;

[0084] The RPA probes are as follows:

[0085] Biotin-(CH2)6-TGGAATGGAAGTCACCAACGACAAAACAC;

[0086] If the target pathogen is herpes zoster virus, the RPA primers in the constructed RPA amplification product system are as follows:

[0087] Forward primer: GGTGGTGCAGACGATAGCGACGATGATGGGT;

[0088] Reverse primer: GGTCTCTTTGGGGACACGGTTGTTGCACCCAT;

[0089] The RPA probes are as follows:

[0090] Biotin-(CH2)6-GTAATTGAATTTCCAGATTCCGACGCGGAATCATCGGACCGCCAAGACTT;

[0091] If the target pathogen is Candida albicans, the RPA primers in the constructed RPA amplification product system are as follows:

[0092] Forward primer: CCGGAGAACATGCCTGTAAGAGCGTCGT;

[0093] Reverse primer: TGAAGATAAAGTTTGAAGATACACGTGG;

[0094] The RPA probes are as follows:

[0095] Biotin-(CH2)6-TGCTTGTTAGACGGTAGAACTAAGGCGTTATCGCTTTGACAATGG;

[0096] If the target pathogen is Leishmania, the RPA primers in the constructed RPA amplification product system are as follows:

[0097] Forward primer: CCAACTGCATGCCATATTCTCAGTGTCGAA;

[0098] Reverse primer:GATGATATCGTTCAGCAAAATGTTGTCGAT;

[0099] The RPA probes are as follows:

[0100] Biotin-(CH2)6-CAACACGATAACTCCTCTCTTTCTGCACATATATATATTATACCAT.

[0101] Specifically, according to the RPA primer and probe design principles, the required Ecoli (Escherichia coli) primers are shown in Table 1 and the probes are shown in Table 2. VZV (varicella-zoster virus) primers are shown in Table 3 and the probes are shown in Table 4. Candida albicans primers are shown in Table 5 and the probes are shown in Table 6. Leishmania primers are shown in Table 7 and the probes are shown in Table 8.

[0102] Table 1 Ecoli RPA primers

[0103]

[0104] As shown in Table 2 Ecoli RPA probe

[0105]

[0106] Table 3 VZV RPA primers

[0107]

[0108] Table 4 VZV RPA probes

[0109]

[0110] Table 5 Candida albicans RPA primers

[0111]

[0112] Table 6 Candida albicans RPA probes

[0113]

[0114] Table 7 Leishmania RPA primers

[0115]

[0116] Table 8 Leishmania RPA probes

[0117]

[0118] Optionally, in step 102, before successively adding the capture probe and the streptavidin-coated magnetic beads to the RPA amplification product, the process further includes:

[0119] The streptavidin-coated magnetic beads (MB) were washed with 1×binding and washing (B&W) buffer, and then resuspended in 2×binding and washing (B&W) buffer, and the concentration was adjusted to 5 μg / μL to obtain a streptavidin-coated magnetic bead suspension.

[0120] The cells were washed three times with 1× binding and washing (B&W) buffer (containing 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 2 M NaCl).

[0121] Optionally, in step 103, capture probes and streptavidin-coated magnetic beads are added to the RPA amplification product in sequence to obtain different types of magnetic beads through the reaction, specifically:

[0122] Take 4μL RPA amplification product and put it into three centrifuge tubes, add 4μL capture probe (CP) into three centrifuge tubes respectively, first carry out metal bath at 45℃ for 5min, then carry out metal bath at 27℃ for 5min, let stand at room temperature for 5min, then add 4μL streptavidin-coated magnetic bead suspension, separate the magnetic beads bound to the RPA amplification product by magnetic separation, and wash 3 times with 1×B&W buffer to obtain different types of magnetic beads (MBs).

[0123] The capture probe (CP) was 1 μM, and this step fixed the bio-coated CP on the MB through the interaction of streptavidin-biotin.

[0124] Optionally, in step 201, the zeta potential of different types of MBs is measured, and / or the obtained magnetic beads with RPA amplification products are analyzed by laser confocal microscopy, including the following steps:

[0125] Step 2011, take 10 μL each of blank magnetic beads, magnetic beads connected to capture probes and magnetic beads with RPA amplification products, wash twice and suspend in 1 mL of deionized water and shake evenly.

[0126] Step 2012: Use a Malvern Zetasizer Nano-ZS90 nanoparticle size potential analyzer to measure Zeta potential.

[0127] Step 2012 can be replaced by the following steps: take 10 μL of magnetic beads with RPA amplification products, wash them with deionized water, add them to a 1.5 mL centrifuge tube, add deionized water to wash, add 10 μL of SYBR Green II dye, mix well, incubate at room temperature in the dark for 3 minutes, and perform laser confocal microscopy analysis using a confocal microscope.

[0128] Alternatively, the method may further include step 2013, taking 10 μL of magnetic beads with RPA amplification products, washing them with deionized water, adding them to a 1.5 mL centrifuge tube, adding deionized water for washing, adding 10 μL of SYBR Green II dye, mixing well, incubating at room temperature in the dark for 3 minutes, and performing laser confocal microscopy analysis using a confocal microscope.

[0129] It should be noted that the purpose of measuring the Zeta potential in step 2012 is to verify the effectiveness of enriching the RPA amplification product in MBs. Step 2013 further verifies the effectiveness of enriching the RPA reaction product in MBs by using fluorescent staining combined with inverted fluorescent microscopy.

[0130] Optionally, THz time-domain spectroscopy detection is performed on the obtained blank magnetic beads and the magnetic bead solution with the RPA amplification product, specifically:

[0131] 10 μL of blank magnetic bead solution and magnetic bead solution with RPA reaction product were respectively taken and placed in a terahertz detection container. The moisture was removed and nitrogen was continuously filled in. The analysis was performed in a stable transmission scanning mode. Each spectrum was scanned 300 times and the experiment was repeated 3 times. The time domain and frequency domain data were collected and converted into absorption values, extinction coefficient, refractive index and transmittance, and the data were analyzed at 0-5 THz.

[0132] Optionally, the target pathogenic microorganisms are prepared into sample solutions with concentrations of 55 to 0.0055 ng / mL, and THz detection is performed three times on the sample solutions of each concentration.

[0133] Optionally, by testing multiple other pathogenic microorganism samples, specifically: testing two other groups of pathogenic microorganism samples with concentrations of 0.22 ng / mL and 0.022 ng / mL 10 times, obtaining the average absorbance of the other two groups of pathogenic microorganism samples, and calculating the standard deviation of the other two groups of pathogenic microorganism samples, and obtaining the coefficient of variation based on the average value and the standard deviation.

[0134] In step 101, the DNA extraction result is as follows Figure 2 As shown, Figure A is the electrophoresis result of the extracted Escherichia coli genomic DNA, and Figure B is the result after RPA amplification of the Escherichia coli DNA. The bands in the experimental group are clear and the product size is consistent, while the control group is a diffuse band.

[0135] In step 212, in order to further verify the effectiveness of enriching the RPA amplification products in MBs, the Zeta potential of all CP-MBs and RPA-MBs was measured. Figure 3 As shown in the figure, the Zeta potential of CP-MB (-33.5 mV) and the Zeta potential of RPA-MB (-39.2 mV) are significantly lower than those of CP-MB. Since nucleic acids are negatively charged, the decrease in the Zeta potential of RPA-MB indicates that the surface of RPA-MB is covered with amplified nucleic acids.

[0136] In step 213, the effectiveness of MBs enrichment of RPA reaction products was further verified by fluorescence staining combined with inverted fluorescence microscopy. Figure 4 As shown in B, the amplified nucleic acid carried by RPA-MB is stained green by SYBR Green II dye, but Figure 4 There is no obvious color on CP-MB in Figure A. The above results confirm the effectiveness of RCA reaction on MB surface.

[0137] The result of step 202 is as follows Figure 5As shown, these are six different concentrations of E. coli. Between 0 and 1.5 THz, as the sample concentration decreases, the terahertz absorption of the RPA amplification product also decreases accordingly. At 1.4 THz, there is an obvious gradient relationship between them, which shows that this method can detect E. coli of different concentrations with high specificity.

[0138] In step 3, in order to quantitatively detect the genomic DNA content of Ecoli based on RPA-THz, the genomic DNA of Ecoli was diluted 10 times from 55 to 0.00055 ng / mL. Subsequently, Ecoli genomic DNA of different concentrations was placed in a detection container, and its absorbance was detected using a transmission terahertz time-domain spectroscopy system. The absorbance of the sample decreased as the concentration of Ecoli genomic DNA decreased. Even if the concentration of Ecoli genomic DNA was as low as 0.00055 ng / mL, it could be detected. Figure 6 By plotting the absorbance value and the Log value of the Ecoli genomic DNA concentration, as shown in Figure 7 As shown, the limit of detection (LOD) was calculated to be 0.226 pg / mL using the International Union of Pure and Applied Chemistry (IUPAC) standard method.

[0139] The specificity of RPA-THz was evaluated by testing clinical samples containing other pathogenic microorganisms, including VZV. The absorbance value of VZV was 0.37. Figure 8 As shown in A, no significant absorbance values ​​were detected for the interfering pathogenic microorganisms; this finding was consistent with the results of the blank control group. In contrast, significant absorbance values ​​were measured in the Ecoli group, indicating that the established RPA-THz detection method has good selectivity and specificity for Ecoli detection. A series of 10 tests were conducted on two groups of samples (0.22 ng / mL and 0.022 ng / mL) to further study the repeatability of the method. Figure 8 B, C. The relative standard deviations (RSD) of the two groups of samples were estimated to be 8.9% and 9.8%, respectively. Therefore, the obtained method for detecting Ecoli genomic DNA based on RPA-MB-THz has good specificity and repeatability.

[0140] Table 9 Accuracy and precision results of detecting Ecoli genomic DNA

[0141]

[0142] As shown in Table 9, the accuracy and precision did not exceed 11% and 8.4%, respectively. These results met the experimental requirements, demonstrating that the accuracy and precision of the RPA-THz method for detecting pathogenic microorganisms are reproducible and reliable.

[0143] In order to quantitatively detect the genomic DNA content of VZV based on RPA-THz, the genomic DNA of VZV was diluted 10 times from 7.5 to 0.00075 ng / mL. Subsequently, different concentrations of VZV genomic DNA were placed in the detection container, and the absorbance was detected using a transmission terahertz time-domain spectroscopy system. The absorbance of the sample decreased as the concentration of VZV genomic DNA decreased. Even if the concentration of VZV genomic DNA was as low as 0.00075 ng / mL, it could be detected. Fig. 9 By plotting the absorbance value and the Log value of VZV genomic DNA concentration, Fig.10 The limit of detection (LOD) was calculated to be 0.528 pg / mL using the International Union of Pure and Applied Chemistry (IUPAC) standard method.

[0144] Table 10 Accuracy and precision results of detecting VZV genomic DNA

[0145]

[0146]

[0147] As shown in Table 10, the accuracy and precision did not exceed 7.2% and 8.3%, respectively. These results met the experimental requirements, demonstrating that the accuracy and precision of the RPA-THz method for detecting pathogenic microorganisms are reproducible and reliable.

[0148] In order to quantitatively detect the genomic DNA content of Candida albicans based on RPA-THz, the genomic DNA of Candida albicans was diluted 10 times from 46 to 0.00046 ng / mL. Subsequently, different concentrations of Candida albicans genomic DNA were placed in the detection container, and the absorbance was detected using a transmission terahertz time-domain spectroscopy system. The absorbance of the sample decreased with the decrease of the concentration of Candida albicans genomic DNA. Even if the concentration of Candida albicans genomic DNA was as low as 0.00046 ng / mL, it could be detected. Fig.11 By plotting the absorbance value and the Log value of the Candida albicans genomic DNA concentration, Fig.12 The limit of detection (LOD) was calculated to be 0.384 pg / mL using the International Union of Pure and Applied Chemistry (IUPAC) standard method.

[0149] Table 11 Accuracy and precision results of detecting Candida albicans genomic DNA

[0150]

[0151] As shown in Table 11, the accuracy and precision did not exceed 10% and 7.9%, respectively. These results met the experimental requirements, demonstrating that the accuracy and precision of the RPA-THz method for detecting pathogenic microorganisms are reproducible and reliable.

[0152] In order to quantitatively detect the genomic DNA content of Leishmania based on RPA-THz, the genomic DNA of Leishmania was diluted 10 times from 6.8 to 0.00068 ng / mL. Subsequently, different concentrations of Leishmania genomic DNA were placed in the detection container, and the absorbance was detected using a transmission terahertz time-domain spectroscopy system. The absorbance of the sample decreased as the concentration of Leishmania genomic DNA decreased. The absorbance was as low as 0.00068 ng / mL, so it could be detected. Fig.13 By plotting the absorbance value and the Log value of the Leishmania genomic DNA concentration, Fig.14 The limit of detection (LOD) was calculated to be 0.327 pg / mL using the International Union of Pure and Applied Chemistry (IUPAC) standard method.

[0153] Table 12 Accuracy and precision results of detecting Leishmania genomic DNA

[0154]

[0155] As shown in Table 12, the accuracy and precision did not exceed 4.7% and 5.6%, respectively. These results met the experimental requirements, demonstrating that the accuracy and precision of the RPA-THz method for detecting pathogenic microorganisms are reproducible and reliable.

[0156] The linear range of the RPA-THz method for Escherichia coli O157:H7 is 5.5×10 -7 ~5.5×10 -2 μg / mL, the linear range of VZV was 7.5×10 -7 ~7.5×10 -3 μg / mL, the linear range of Candida albicans was 4.6×10 -7 ~4.6×10 -2 μg / mL, the linear range of Leishmania is 6.8×10 -7 ~6.8×10 -3μg / mL; for bacteria, viruses, fungi and detection limits are 0.226pg / mL, 0.528pg / mL, 0.384pg / mL, 0.327pg / mL, the sensitivity is higher than that of qPCR method (550pg / mL, 750pg / mL, 460pg / mL and 680pg / mL, respectively), and the precision meets the requirements. The amplification and detection time is less than 40min. The established RPA-THz method has high accuracy, good reproducibility, short detection time, and can achieve high-sensitivity and high-specificity rapid detection of pathogenic microorganisms. The present invention provides a theoretical basis and application demonstration for the rapid and accurate detection of pathogenic microorganisms, and lays an important research foundation for the further development of RPA-THz sensors, promoting technological progress in the field of public health.

[0157] The pathogenic microorganism detection method based on RPA-THz provided by the present invention can be applied to the following fields:

[0158] Food safety: Rapidly detect E. coli and other bacteria in food to ensure food quality and safety.

[0159] Clinical diagnosis: used for rapid detection of pathogens such as VZV and Candida albicans in patient samples so that patients can receive early diagnosis and timely treatment.

[0160] Public health surveillance: Detection of viruses and parasites in epidemiological investigations helps monitor the development of epidemics.

[0161] The RPA-THz-based pathogen detection method provided by the present invention can quickly, sensitively and specifically detect pathogens that threaten human safety. Based on terahertz wave technology, combined with RPA amplification and probe capture, pathogens can be identified and detected through spectral information, which makes it possible to intelligently identify pathogens. It provides an important basis for the diagnosis and subsequent treatment of infectious diseases, and is of great significance for treating patients, controlling the development of the epidemic, and reducing casualties.

[0162] The method provided by the present invention is convenient and quick, and can identify Escherichia coli and various pathogenic microorganisms in a relatively short time, so as to timely discover problems and take corresponding measures, and does not require expensive instruments and equipment, and has the advantages of high sensitivity, good specificity, etc.

[0163] The above is only the best specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions within the technical scope disclosed in the present application shall be included in the protection scope of the present application. Therefore, the protection scope of the present application shall be based on the protection scope of the claims.

Claims

1. A method for detecting pathogenic microorganisms based on RPA-THz, characterized in that: The following steps are involved: Extracting genomic DNA of target pathogenic microorganisms to obtain genomic DNA of target pathogenic microorganisms; According to the genomic DNA of the target pathogenic microorganism, an RPA amplification product system is constructed, and an RPA reaction is performed using a kit to obtain an RPA amplification product; The capture probe and the streptavidin-coated magnetic beads are sequentially added to the RPA amplification product to obtain different types of magnetic beads through the reaction, wherein the different types of magnetic beads include blank magnetic beads, magnetic beads connected with the capture probe, and magnetic beads with the RPA amplification product; Measuring the zeta potential of the different types of MBs, and / or analyzing the obtained magnetic beads with the RPA amplification products by fluorescence microscopy; Performing THz time-domain spectroscopy detection on the obtained blank magnetic beads and the magnetic bead solution with the RPA amplification product; Prepare target pathogenic microorganisms into sample solutions of different concentrations, perform THz detection on sample solutions of each concentration, analyze the data of 0-5THz, calculate the absorbance value, extinction coefficient, refractive index and transmittance, and draw a standard curve of the pathogenic microorganism detection method based on RPA-THz; then proceed to the detection limit of the pathogenic microorganism detection method based on RPA-THz; By testing multiple other pathogenic microorganism samples, their absorbance values, extinction coefficients, refractive indices and transmittances are obtained, and then the corresponding coefficients of variation are calculated.

2. The method for detecting pathogenic microorganisms based on RPA-THz according to claim 1, characterized in that: The target pathogenic microorganisms include Escherichia coli, Candida albicans, Staphylococcus aureus, new coronavirus, herpes zoster virus, and Leishmania.

3. The method for detecting pathogenic microorganisms based on RPA-THz according to claim 1, characterized in that: If the target pathogenic microorganism is Escherichia coli, the RPA primers in the constructed RPA amplification product system are as follows: Forward primer: AAAGGTACATATGTCGGAACATCTGGAGAT; Reverse primer: AAAATCATCAGCTCGTTCTACCTAGGCTAA; The RPA probes are as follows: Biotin-(CH2)6-TGGAATGGAAGTCACCAACGACAAAACAC; If the target pathogen is herpes zoster virus, the RPA primers in the constructed RPA amplification product system are as follows: Forward primer: GGTGGTGCAGACGATAGCGACGATGATGGGT; Reverse primer: GGTCTCTTTGGGGACACGGTGTGCACCCAT; The RPA probes are as follows: Biotin-(CH2)6-GTAATTGAATTTCCAGATTCCGACGCGGAATCATCGGACCGCCAAGACTT; If the target pathogen is Candida albicans, the RPA primers in the constructed RPA amplification product system are as follows: Forward primer: CCGGAGAACATGCCTGTAAGAGCGTCGT; Reverse primer: TGAAGATAAAGTTTGAAGATACACGTGG; The RPA probes are as follows: Biotin-(CH2)6-TGCTTGTTAGACGGTAGAACTAAGGCGTTATCGCTTTGACAATGG; If the target pathogen is Leishmania, the RPA primers in the constructed RPA amplification product system are as follows: Forward primer: CCAACTGCATGCCATATTCTCAGTGTCGAA; Reverse primer:GATGATATCGTTCAGCAAAATGTTGTCGAT; The RPA probes are as follows: Biotin-(CH2)6-CAACACGATAACTCCTCTCTTTCTGCACATATATATATTATACCAT.

4. The method for detecting pathogenic microorganisms based on RPA-THz according to claim 1, characterized in that: Before successively adding the capture probe and the streptavidin-coated magnetic beads to the RPA amplification product, the method further comprises: The streptavidin-coated magnetic beads were washed with 1×B&W buffer, and then resuspended in 2×B&W buffer, and the concentration was adjusted to 5 μg / μL to obtain a streptavidin-coated magnetic bead suspension.

5. The method for detecting pathogenic microorganisms based on RPA-THz according to claim 4, characterized in that: The capture probe and the streptavidin-coated magnetic beads are successively added to the RPA amplification product to obtain different types of magnetic beads through the reaction, specifically: Take 4 μL of the RPA amplification product and put it into three centrifuge tubes, add 4 μL of capture probes into the three centrifuge tubes respectively, first carry out a metal bath at 45°C for 5 min, then carry out a metal bath at 27°C for 5 min, let it stand at room temperature for 5 min, then add 4 μL of the streptavidin-coated magnetic bead suspension, separate the magnetic beads bound to the RPA amplification product by magnetic separation, and wash 3 times with 1×B&W buffer to obtain different types of magnetic beads.

6. The method for detecting pathogenic microorganisms based on RPA-THz according to any one of claims 1 to 5, characterized in that: The step of measuring the zeta potential of the different types of MBs and / or analyzing the obtained magnetic beads with the RPA amplification products by laser confocal microscopy comprises the following steps: 10 μL of each of the blank magnetic beads, the magnetic beads connected to the capture probes, and the magnetic beads with the RPA amplification products were washed twice and suspended in 1 mL of deionized water and shaken evenly; Zeta potential measurements using a Malvern Zetasizer Nano-ZS90 particle size analyzer; and / or Take 10 μL of the magnetic beads with the RPA amplification product, wash with deionized water, add to a 1.5 mL centrifuge tube, add deionized water for washing, add 10 μL of SYBR Green II dye, mix well, incubate at room temperature in the dark for 3 minutes, and perform laser confocal microscopy analysis using a fluorescence microscope.

7. The method for detecting pathogenic microorganisms based on RPA-THz according to claim 6, characterized in that: The THz time-domain spectroscopy detection is performed on the blank magnetic beads and the magnetic bead solution with the RPA amplification product, specifically: 10 μL of the blank magnetic bead solution and the magnetic bead solution with the RPA reaction product were respectively taken and placed in a terahertz detection container, the moisture was removed, nitrogen was continuously filled, and a stable transmission scanning mode was used for analysis. Each spectrum was scanned 300 times and the experiment was repeated 3 times. Time domain and frequency domain data were collected and converted into absorbance values, extinction coefficient, refractive index and transmittance, and data analysis was performed at 0-5 THz.

8. The method for detecting pathogenic microorganisms based on RPA-THz according to claim 6, characterized in that: The target pathogenic microorganisms were prepared into sample solutions with concentrations of 55 to 0.0055 ng / mL, and THz detection was performed three times for each concentration of the sample solution.

9. The method for detecting pathogenic microorganisms based on RPA-THz according to claim 7 or 8, characterized in that: The method of testing multiple other pathogenic microorganism samples includes testing two other groups of pathogenic microorganism samples with concentrations of 0.22 ng / mL and 0.022 ng / mL 10 times to obtain the average absorbance of the other two groups of pathogenic microorganism samples, and calculating the standard deviation of the other two groups of pathogenic microorganism samples, and obtaining the coefficient of variation based on the average and the standard deviation.

10. The method for detecting pathogenic microorganisms based on RPA-THz according to claim 9, characterized in that: The genomic DNA of the target pathogenic microorganisms was extracted using the following methods: CTAB method, glass bead method, ultrasonic method, grinding method, freeze-thaw method, guanidine isothiocyanate method, alkaline lysis method and enzyme method.

Images