A method for screening and rational engineering of riboswitches that specifically recognize doxycycline

Abstract

The present invention discloses a method for screening a riboswitch that specifically recognizes doxycycline, as well as its rational modification and application, relating to the field of gene expression regulation. The invention provides a doxycycline-specific riboswitch and establishes a high-throughput screening method based on flow cytometry. Computer-assisted prediction of riboswitch binding sites and calculation of mutation sites are used to obtain a doxycycline riboswitch with a further enhanced activation factor. Dose-response curves show that the riboswitch exhibits a linear correlation at 40-100 μg / L. The constructed whole-cell sensor is low-cost, highly stable, and simple to operate, making it suitable for rapid on-site detection.

Description

Technical Field

[0001] The present invention belongs to the field of gene expression regulation, and particularly relates to a method for screening a riboswitch that specifically recognizes doxycycline, and its rational transformation and application. Background Art

[0002] Doxycycline, a tetracycline derivative, is a broad-spectrum antibiotic with highly effective antibacterial properties. It is widely used to prevent and treat certain bacterial infections and as an additive to improve the quality of animal products. However, excessive doxycycline use can lead to residual accumulation in the body, severely impacting both human and animal health. With the development of society, demands for product quality and environmentally friendly production processes are increasing, and efforts to reduce the impact of residual doxycycline on human health are attracting increasing attention to the detection of doxycycline.

[0003] Existing methods for detecting doxycycline include high-performance liquid chromatography, high-performance liquid chromatography-tandem mass spectrometry, infrared spectroscopy, and gas chromatography-tandem mass spectrometry. However, these methods are relatively expensive, have long detection cycles, and are inefficient, making them unsuitable for rapid on-site doxycycline detection. In recent years, sensors have gained widespread popularity due to their high detection efficiency and low cost.

[0004] Riboswitches are a novel regulatory mechanism that has been developed in recent years. They can specifically sense and recognize small molecule ligands without the need for additional cofactors (such as proteins, enzymes, or metal compounds), regulating downstream gene expression during transcription and translation. Compared to other regulatory mechanisms (such as protein regulation and ribozyme regulation), riboswitches are more sensitive and responsive to small molecule ligands, and can rapidly recognize them at low concentrations. Therefore, riboswitches are essentially sensors.

[0005] In recent years, riboswitches have gained widespread research interest as an emerging component, but they also face numerous challenges. Compared to the development of other regulatory elements, riboswitch development is still in its infancy, with a limited number of riboswitches developed, and the technology for converting riboswitches into biosensors is also in its infancy. The traditional method for screening artificial riboswitches is the System for Evolution by Exponential Enrichment (SELEX) technique, which has been around for over 30 years and is relatively mature. However, using this technique to screen riboswitches requires first in vitro enrichment to identify high-affinity aptamers, followed by in vivo high-throughput screening to select sequences that can adapt to the intracellular environment. This entire process is relatively time-consuming and labor-intensive.

[0006] Therefore, it is urgent to screen out doxycycline riboswitches in order to transform them into biosensors that can monitor doxycycline residues in food and other environments in real time. Summary of the Invention

[0007] In response to the above-mentioned deficiencies in the prior art, the present invention provides a riboswitch that specifically recognizes doxycycline and a method for screening and rationally modifying the same. A riboswitch that specifically recognizes doxycycline is obtained by flow cytometry screening. The riboswitch can specifically recognize doxycycline.

[0008] The first technical solution provided by the present invention is a method for screening a riboswitch that specifically recognizes doxycycline, comprising the following steps:

[0009] (1) Construction of a doxycycline riboswitch library using doxycycline RNA aptamers;

[0010] (2) Construction of a riboswitch reporter platform by fusing the SacB gene to the EGFP gene;

[0011] (3) constructing a plasmid library using the doxycycline riboswitch library of step (1) and the riboswitch reporter platform of step (2);

[0012] (4) Transforming the plasmid library from step (3) into Escherichia coli and incubating with the substrate; collecting cells with high fluorescence using a flow cytometer, i.e., positive cells;

[0013] (5) The positive cells in step (4) are plated and cultured, and single white colonies without fluorescence are selected as positive colonies;

[0014] (6) The positive colonies in step (5) were cultured in a well plate, and the fluorescence intensity was measured at an excitation wavelength of 488 nm and an emission wavelength of 520 nm, and the OD was measured using a spectrophotometer. 600 , calculate the fluorescence value per unit cell, and screen out cells with larger fluorescence values ​​per unit cell, which contain riboswitches that specifically recognize doxycycline.

[0015] In certain embodiments, in step (1), the nucleotide sequence of the RNA aptamer of doxycycline is as follows:

[0016] GGGAGACGCGAAAGCGUUACGAAUGCGAUGACUCGUCGAAAGACGAACAGUUCCUUUGGAUCCGAAUUCGCCGC (SEQ ID NO. 2).

[0017] In certain embodiments, a doxycycline riboswitch library is constructed by inserting 10 random bases N into the 3′ end of the doxycycline DNA sequence through the doxycycline RNA aptamer design. The doxycycline riboswitch library is shown in SEQ ID NO. 3.

[0018] GGGAGACGCGAAAGCGTTACGAATGCGATGACTCGTCGAAAGACGAACAGTTCCTTTGGATCCGAATTCGCCGCNNNNNNNNNN (SEQ ID NO. 3).

[0019] In certain embodiments, in step (2), a 21 bp fragment of the SacB gene with a nucleotide sequence such as that shown in SEQ ID NO. 4 is fused to the EGFP gene to construct a SacB-21-EGFP fusion protein, which is a riboswitch reporter platform.

[0020] In certain embodiments, in step (3), a doxycycline riboswitch library is inserted between the promoter and the ribosome binding site of a recombinant plasmid containing a riboswitch reporter platform to construct a plasmid library.

[0021] In certain embodiments, the promoter is a strong T7 promoter and the ribosome binding site is AAGGAG.

[0022] In certain embodiments, the recombinant plasmid uses PET-Duet-1 as an expression vector.

[0023] In certain embodiments, in step (4), the Escherichia coli includes Escherichia coli JM109 and Escherichia coli BL21.

[0024] In certain embodiments, in step (4), the concentration of IPTG used to induce expression in the E. coli is 0.5 mM.

[0025] In certain embodiments, in step (4), the substrate is doxycycline at a concentration of 100 μg / L.

[0026] In certain embodiments, the temperature of the fermentation culture is always maintained at 37° C. and the rotation speed is 220 rpm.

[0027] In certain embodiments, the culture medium is LB medium.

[0028] In certain embodiments, the pH of the culture medium is 6-7.

[0029] The second technical solution provided by the present invention is a riboswitch (DOX-3-4) that specifically recognizes doxycycline, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0030] DOX-3-4 (SEQ ID NO: 1):

[0031] GGGAGACGCGAAAGCGUUACGAAUGCGAUGACUCGUCGAAAGACGAACAGUUCCUUUGGAUCCGAAUUCGCCGC-CACGAUUUGU.

[0032] The third technical solution provided by the present invention is a biosensor, which carries the ribosome switch described in the second technical solution.

[0033] The fourth technical solution provided by the present invention is a method for modifying a doxycycline riboswitch, wherein the method comprises mutating nucleotides 26, 47, 51, and / or 53 of a parent riboswitch, wherein the nucleotide sequence of the parent is shown in SEQ ID NO: 1.

[0034] In certain embodiments, the mutant is obtained by subjecting the parent to any one of the mutations (1) to (6):

[0035] (1) mutate cytosine C at position 26 to guanine G;

[0036] (2) mutating adenine A at position 47 to uracil U;

[0037] (3) mutating adenine A at position 49 to guanine G;

[0038] (4) mutating uracil U at position 51 to cytosine C;

[0039] (5) mutating cytosine C at position 53 to guanine G;

[0040] (6) Mutate cytosine C at position 26 to guanine G and mutate adenine A at position 47 to uracil U.

[0041] The fifth technical solution provided by the present invention is the use of the above-mentioned riboswitch, the above-mentioned biosensor or the above-mentioned method in the synthesis of doxycycline.

[0042] The technical effects of the present invention are as follows:

[0043] 1. The present invention is an invention for screening doxycycline riboswitches based on flow cytometry. A large number of literatures were consulted to find aptamers for doxycycline. Only 10 random bases were attached to the aptamer, which reduced the library capacity and improved the screening success rate.

[0044] 2. The host for screening doxycycline riboswitches in the present invention is Escherichia coli, and the gene is expressed under the control of the strong T7 promoter and the AAGGAG strong ribosome binding site, and an appropriate IPTG concentration is selected to greatly reduce the probability of false positives;

[0045] 3. The entire process of this invention is based on the in vivo screening process, and the riboswitches screened out have strong adaptability in the organism;

[0046] 4. The riboswitches screened by the present invention were subjected to dose-response curves and molecular docking to verify the interaction between the riboswitch and the ligand;

[0047] 5. The riboswitches screened by the present invention have a strong ability to sense doxycycline, but have no recognition effect on other small molecule ligands;

[0048] 6. The mutant riboswitch constructed in the present invention can further increase the activation multiple of the riboswitch. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Map of riboswitch library plasmid construction;

[0050] Figure 2 To verify the substrate tolerance of doxycycline;

[0051] Figure 3 Optimized for IPTG concentration;

[0052] Figure 4 The fusion EGFP result graph is retained for SacB;

[0053] Figure 5 This is the positive control image for flow cytometry;

[0054] Figure 6 collected results for flow cytometry;

[0055] Figure 7 This is a diagram of high-throughput screening results;

[0056] Figure 8 is the riboswitch dose-response curve and activation fold;

[0057] Figure 9 Predict secondary and tertiary structures for riboswitches;

[0058] Figure 10 Direct molecular docking of the riboswitch with doxycycline;

[0059] Figure 11 This is the result of a single-point mutation in the riboswitch;

[0060] Figure 12 Combinatorial mutation results for riboswitches;

[0061] Figure 13 is the mutant riboswitch dose-response curve;

[0062] Figure 14 Molecular docking of mutant riboswitches. DETAILED DESCRIPTION

[0063] The following describes preferred embodiments of the present invention. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0064] Test method:

[0065] Fluorescence intensity measurement: 200 μL of the fermented bacterial solution was placed in a black 96-well plate and the fluorescence intensity of the bacteria was measured under the conditions of an excitation wavelength of 488 nm and an emission wavelength of 520 nm.

[0066] OD600 determination: Take 20 μL of the fermented bacterial solution and place it in a white 96-well plate, then add 180 μL of deionized water to dilute the bacterial solution 10 times, and measure the absorbance at 600 nm.

[0067] The raw materials used in the embodiment are:

[0068] 1. PET-Duet-1 vector was obtained from our laboratory;

[0069] 2. Escherichia coli BL21(DE3) was obtained from our laboratory;

[0070] 3. LB liquid medium formula: 10g peptone, 5g yeast powder, 10g sodium chloride, dilute to 1L.

[0071] 4. LB solid medium formula: 10g peptone, 5g yeast powder, 10g sodium chloride, dilute to 1L, divide equally into 5 shake flasks, and add 3.5g agar powder.

[0072] Example 1 Establishment of high-throughput screening protocol

[0073] (1) Establishing a high-throughput screening program

[0074] (1) Expression of fluorescent reporter gene EGFP

[0075] The laboratory-preserved EGFP fluorescent protein gene (SEQ ID NO. 4) was ligated into the PET-Duet-1 vector via homologous recombination using the primers listed in the table below. The plasmid was extracted and sequenced to obtain the recombinant plasmid PET-Duet-EGFP. The recombinant plasmid PET-Duet-EGFP was transformed into Escherichia coli BL21(DE3) to obtain the recombinant strain BL21 / PET-Duet-EGFP.

[0076]

[0077] (2) Verification of doxycycline substrate tolerance

[0078] Prepare doxycycline solution with a concentration of 50 mg / L. Add different volumes of pre-prepared substrate when pouring the plate to prepare different concentration gradients. After culturing the recombinant bacteria BL21 / PET-Duet-EGFP for 12 hours, dilute it 10,000 times, dispense 30 μL, and evenly spread it on the pre-prepared plates. After culturing for 12 hours, observe the growth of the bacteria to determine the screening concentration.

[0079] like Figure 2 As shown in the figure, the substrate tolerance of doxycycline was verified. When the concentration was greater than 100 μg / L, the bacteria grew slowly or did not grow. This was because doxycycline could bind to ribosomes, thereby inhibiting protein synthesis and causing the bacteria to be unable to grow. Therefore, 100 μg / L was selected as the subsequent high-throughput screening concentration.

[0080] (3) Optimization of IPTG concentration

[0081] The IPTG concentration was optimized by the well plate fermentation method. The recombinant plasmid PET-Duet-EGFP was transferred into Escherichia coli BL21 (DE3) to obtain the recombinant bacteria BL21 / PET-Duet-EGFP. 0, 0.25, 0.5, 0.75, 1, 1.5, 1.75, and 2 mM IPTG were selectively added to the culture medium. The cells were cultured at 37°C and 220 rpm for 12 h. The fluorescence value was determined using a multifunctional microplate reader at an excitation wavelength of 488 nm and an emission wavelength of 520 nm. The OD600 of the cells was also determined, and the unit cell fluorescence value = fluorescence value / OD600 was recorded. The unit cell fluorescence values ​​of the experimental and control groups were calculated to determine the IPTG concentration.

[0082] like Figure 3 As shown in the figure, the IPTG concentration was optimized and it was found that under 0.5 mM IPTG induction, the fluorescence value per unit cell was the highest, so 0.5 mM was selected as the subsequent induction concentration.

[0083] (4) Fusion sequence optimization

[0084] In order to fully express the fluorescent reporter gene, we tried to retain some bases of the SacB gene (SEQ ID NO.5) for ligation and measured the fluorescence value. The number of bases of the retained SacB gene was set to 9, 21, 30, 42, and 60 (SEQ ID NO.6-10). Using the primers in the table below, they were connected to the PET-Duet-EGFP plasmid by homologous recombination to construct five plasmids: PET-Duet-SacB-9-EGFP, PET-Duet-SacB-21-EGFP, PET-Duet-SacB-30-EGFP, PET-Duet-SacB-42-EGFP, and PET-Duet-SacB-60-EGFP. After the above plasmids were transformed into Escherichia coli BL21 (DE3), recombinant bacteria BL21 / PET-Duet-SacB-9-EGFP, recombinant bacteria BL21 / PET-Duet-SacB-21-EGFP, recombinant bacteria BL21 / PET-Duet-SacB-30-EGFP, recombinant bacteria BL21 / PET-Duet-SacB-42-EGFP, and recombinant bacteria BL21 / PET-Duet-SacB-60-EGFP were obtained. Subsequently, the recombinant bacteria were fermented at 37°C and 220 rpm for 12 h. After the culture was completed, the fluorescence value was measured using a multifunctional microplate reader at an excitation wavelength of 488 nm and an emission wavelength of 520 nm. The OD600 of the bacteria was also measured, and the unit bacterial fluorescence value = fluorescence value / OD600 was recorded. The unit bacterial fluorescence values ​​of the experimental group and the control group were calculated.

[0085] like Figure 4 As shown in the figure, the result of SacB retention fusion with EGFP shows that when the number of fusion bases is 21, the fluorescence value per cell increases significantly. This fusion method (i.e., plasmid PET-Duet-SacB-21-EGFP) can be selected for high-throughput screening.

[0086]

[0087]

[0088] (5) Flow cytometry positive control design

[0089] 1 mL of recombinant BL21 / PET-Duet-SacB-21-EGFP was added to 4 mL of LB medium (containing ampicillin and 0.5 mM IPTG) and cultured at 37°C and 220 rpm for 16 h. The culture was washed twice with PBS buffer and diluted to an OD of 0.3. Fluorescence intensity was measured using a flow cytometer.

[0090] like Figure 5As shown, the positive control graph of flow cytometry serves as a subsequent positive reference. When sample cells are subsequently collected, only cells with a fluorescence value greater than the positive control value are collected.

[0091] (II) Construction of riboswitch library

[0092] (1) Design of riboswitch plasmid library:

[0093] Random ssDNA library and primers (synthesized by Shanghai Sangon Biotechnology Co., Ltd.):

[0094] 5'-GGGAGACGCGAAAGCGTTACGAATGCGATGACTCGTCGAAAGACGAACAGTTCCTTTGGATCCGAATTCGCCGC-N10- aaggag catctccatgaaca-3', where N10 represents a sequence formed by connecting 10 arbitrary nucleotide bases, and the underline represents the ribosome binding site.

[0095] Upstream primer: 5'-aaggagcatctccatgaacatcaaaaagtttgcaggtaag-3'

[0096] Downstream primer: 5'-GCGGCGAATTCGGATCCAAAGGAACTGTTCGTCTTTCGAC-3'

[0097] The random ssDNA library and primers were prepared into 100 μM storage solution in BB buffer (Tris-HCl: 20 Mm, MgCl2: 50 mM, KCl: 5 mM, CaCl2: 2 Mm, pH 7.6) and stored at -20°C until use.

[0098] (2) PCR amplification to construct a riboswitch plasmid library

[0099] Insert the riboswitch plasmid library:

[0100] GGGAGACGCGAAAGCGTTACGAATGCGATGACTCGTCGAAAGACGAACAGTTCCTTTGGATCCGAATTCGCCGC-N10 was inserted between the promoter and ribosome binding site of the recombinant plasmid PET-Duet-SacB-21-EGFP by homologous recombination, and the riboswitch plasmid library was constructed by PCR amplification using the upstream and downstream primers in (1), as shown in FIG. Figure 1 shown.

[0101] PCR system:

[0102] Components volume 2×Phanta Max Master Mix 25 μL Upstream primer 2μL (100μM) Downstream primer 2μL (100μM) Ultrapure water 20 μL Template DNA 1 μL

[0103] PCR procedure:

[0104]

[0105] Polyacrylamide gel electrophoresis verification: PCR products were electrophoresed using 2% agarose gel.

[0106] The plasmid library was transformed into Escherichia coli BL21 (DE3) to construct recombinant Escherichia coli containing the plasmid library.

[0107] Example 2: High-throughput screening of doxycycline riboswitches

[0108] 1 mL of the recombinant E. coli containing the plasmid library in Example 1 was added to 4 mL of LB (containing ampicillin, 0.5 mM IPTG, and 100 μg / L doxycycline) liquid medium and cultured at 37°C and 220 rpm for 16 h. The cultured bacteria were washed twice with PBS buffer and diluted to an OD of 0.3. The resulting bacteria were collected using a flow cytometer to collect highly fluorescent cells. The collected highly fluorescent cells were spread on LB (containing ampicillin and 0.5 mM IPTG) solid medium and cultured at 37°C for 12 h.

[0109] like Figure 6 As shown, the flow cytometer collected the results, and only collected the fluorescence values ​​greater than 3*10 4 cells.

[0110] Subsequently, under ultraviolet irradiation, white bacteria were selected and placed in a new LB (containing ampicillin) solid culture medium, cultured at 37°C for 12 h, and the cultured bacteria were inoculated into a 48-well plate (control group: containing ampicillin, 0.5 mM IPTG, experimental group: containing ampicillin, 0.5 mM IPTG, 100 μg / L doxycycline), and cultured at 37°C, 12 h, and 220 rpm. After the culture was completed, the fluorescence value was determined using a multifunctional microplate reader at an excitation wavelength of 488 nm and an emission wavelength of 520 nm. At the same time, the bacterial OD600 was determined, and the unit bacterial fluorescence value = fluorescence value / OD600 was recorded. The unit bacterial fluorescence value of the experimental group and the control group was calculated.

[0111] like Figure 7 As shown in the figure, the high-throughput screening results showed that the fluorescence values ​​per cell of the DOX-3-4 riboswitch in the experimental group and the control group were quite different, and it can be used as an alternative riboswitch.

[0112] DOX-3-4 bacteria were selected and transferred to a new LB (containing ampicillin) solid medium, cultured at 37 ° C for 12 h, and the cultured bacteria were inoculated into a 48-well plate (control group: containing ampicillin, 0.5 mM IPTG, experimental group: containing ampicillin, 0.5 mM IPTG, 100 μg / L doxycycline). Three parallels were set up for the experimental group and the control group respectively. After the completion of the culture, the fluorescence value was measured under the conditions of excitation wavelength 488 nm and emission wavelength 520 nm. At the same time, the OD600 of the bacteria was measured. DOX-3-4 bacteria were transferred to a new LB (containing ampicillin) liquid medium and cultured at 37 ° C and 220 rpm for 12 h. After the completion of the culture, the plasmid DOX-3-4-PET-Duet-SacB-21-EGFP was extracted and sent for sequencing. The correct sequence was the riboswitch sequence (GGGAGACGCGAAAGCGUUACGAAUGCGAUGACUCGUCGAAAGACGAACAGUUCCU UUGGAUCCGAAUUCGCCGC-CACGAUUUGU).

[0113] Example 3: Riboswitch Dose-Response Curve Analysis

[0114] A dose-response curve for the riboswitch was determined using a well plate fermentation assay, with concentrations of 0, 25, 50, and 100 μg / L set for determination. DOX-3-4 bacteria were cultured in 48-well plates. The control group contained ampicillin and 0.5 mM IPTG, while the experimental group contained ampicillin, 0.5 mM IPTG, and different concentrations of doxycycline. After culture, fluorescence intensity was measured at an excitation wavelength of 488 nm and an emission wavelength of 520 nm, and the OD was measured using a spectrophotometer. 600 , calculate the unit bacterial fluorescence value; use GraphPadPrism 8.0 software to make a dose-response curve.

[0115] like Figure 8 As shown, the riboswitch dose-response curve and activation fold were measured, respectively. Under the action of 100 μg / L doxycycline, the riboswitch was activated 1.99-fold.

[0116] Example 4: Computer-aided design of mutation sites

[0117] The secondary structure of riboswitch RNA was predicted using Mfold (RNAFolding Form (unafold.org)) online software. The prediction principle of this software is based on the principle of minimum free energy. After decades of continuous development, it is relatively mature. The tertiary structure of riboswitch RNA was predicted using 3d RNA (Xiao Lab (hust.edu.cn)) online software developed by Huazhong University of Science and Technology. This software can accurately predict the tertiary structure of RNA or DNA in a relatively short time. Figure 9 shown.

[0118] Autodock4 is used to dock the macromolecule riboswitch with the small molecule ligand. Before docking, the PDB files of the macromolecule and the small molecule need to be prepared. The macromolecule can be directly predicted and saved in PDB format using online software, and the secondary structure of the small molecule can be saved in sdf format. Finally, it is converted into PDB format using Open Bable software. The overall steps of this software are: preparation of macromolecules and small molecules; pre-treatment of macromolecules and small molecules; setting up the docking box; running Autogrid; running Autodock. Generally, the results of 50 dockings are relatively accurate. After the docking is completed, view the docking results in the Analze box, select the one with the lowest binding free energy and save it, and open it in the pymol software to visualize the image and display the binding pocket. The direct molecular docking of riboswitch and doxycycline is as follows. Figure 10 shown.

[0119] Example 5: Modifying riboswitch performance by combining single-point mutations with combined mutations

[0120] In the binding site region, the hotspot bases within the range are found, and single-point saturation mutations are performed (including any nucleotide at positions 22 to 30, nucleotide 41, nucleotide 42, or any nucleotide at positions 45 to 55). Mutants that are beneficial to single-point saturation mutations are subjected to iterative combination mutations, and whether the mutants are beneficial is determined by the activation multiple.

[0121] Table 1 Single point mutation primer design

[0122]

[0123]

[0124] Table 2 Design of combined mutagenesis primers

[0125]

[0126] The specific method is as follows:

[0127] The DOX-3-4-PET-Duet-SacB-21-EGFP plasmid was PCR-generated and site-directed mutagenesis was performed using the above primers to obtain a mutant plasmid (mutant DOX-3-4-PET-Duet-SacB-21-EGFP). The above plasmid was transformed into Escherichia coli BL21 (D3) to determine the activation fold of the riboswitch.

[0128] The above-mentioned recombinant strains were cultured in a 48-well plate (control group: containing ampicillin, 0.5 mM IPTG, experimental group: containing ampicillin, 0.5 mM IPTG, 100 μg / L doxycycline) at 37°C, 12 h, and 220 rpm. After the culture was completed, the fluorescence value was measured using a multifunctional microplate reader at an excitation wavelength of 488 nm and an emission wavelength of 520 nm. At the same time, the bacterial OD600 was measured, and the unit bacterial fluorescence value = fluorescence value / OD600 was recorded. The unit bacterial fluorescence values ​​of the experimental and control groups were calculated.

[0129] like Figure 11 、 12 As shown in the figure, the results of single-point mutation and combined mutation of riboswitch were obtained. Single-point mutation was performed first, and five mutant riboswitches with increased single-point mutation effects were found, namely C26G, A47U, A49G, U51C, and C53G. Subsequently, these five mutants were subjected to combined mutation, and it was found that the C26G / A47U mutant had a larger activation fold after combination.

[0130] Example 6: Dose-response curve analysis based on mutant riboswitches

[0131] First, the dose-response curve of the C26G / A47U mutant riboswitch obtained in Example 5 was determined by a well plate fermentation method. A control group containing ampicillin and 0.5 mM IPTG and an experimental group containing ampicillin, 0.5 mM IPTG, and different concentrations of doxycycline were set up. Then, a shake flask fermentation method was used to determine the dose-response curve of the C26G / A47U mutant riboswitch. Figure 13 As shown in the dose-response curve of the mutant riboswitch, the riboswitch activation fold increased from 1.99 to 2.78.

[0132] Molecular docking was performed according to the method of Example 4, and the results were as follows: Figure 14 As shown, it was found that the binding energy changed from the original -3.11kcal / mol to -6.48kcal / mol, forming a more stable complex system.

[0133] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A method for screening a riboswitch that specifically recognizes doxycycline, characterized in that: The following steps are involved: (1) Construction of a doxycycline riboswitch library using doxycycline RNA aptamers; (2) Construction of a riboswitch reporter platform by fusing the SacB gene to the EGFP gene; (3) constructing a plasmid library using the doxycycline riboswitch library from step (1) and the riboswitch reporter platform from step (2); (4) The plasmid library from step (3) is transformed into Escherichia coli and incubated with the substrate; cells with high fluorescence are collected by flow cytometry, which are positive cells; (5) The positive cells in step (4) are plated and cultured, and single white colonies without fluorescence are selected as positive colonies; (6) The positive colonies in step (5) were cultured in a well plate, and the fluorescence intensity was measured at an excitation wavelength of 488 nm and an emission wavelength of 520 nm. The OD was measured using a spectrophotometer. 600 , calculate the unit fluorescence value of the bacteria, and screen out the bacteria with larger unit fluorescence value, that is, those carrying the riboswitch that specifically recognizes doxycycline.

2. The method according to claim 1, characterized in that In step (1), the nucleotide sequence of the RNA aptamer of doxycycline is shown in SEQ ID NO.2, The doxycycline RNA aptamer was designed to insert 10 random bases N into the 3' end of the doxycycline DNA sequence to construct a doxycycline riboswitch library, and the doxycycline riboswitch library is shown in SEQ ID NO.

3.

3. The method according to claim 1, characterized in that In step (2), the 21 bp fragment of the SacB gene is fused with the EGFP gene to construct a SacB-21-EGFP fusion protein, which is a riboswitch reporter platform. The nucleotide sequence of the 21 bp fragment of the SacB gene is shown in SEQ ID NO.4, and the nucleotide sequence of the EGFP gene is shown in SEQ ID NO.

5.

4. The method according to claim 1, wherein In step (3), the doxycycline riboswitch library is inserted between the promoter and the ribosome binding site of a recombinant plasmid containing a riboswitch reporter platform to construct a plasmid library; the promoter is a strong T7 promoter, and the ribosome binding site is AAGGAG; the recombinant plasmid uses PET-Duet-1 as an expression vector.

5. The method according to claim 4, characterized in that In step (4), the Escherichia coli includes Escherichia coli JM109 and Escherichia coli BL21; The IPTG concentration for inducing the expression in the E. coli was 0.5 mM; The substrate was doxycycline at a concentration of 100 μg / L.

6. A riboswitch that specifically recognizes doxycycline, screened using the method of any one of claims 1 to 5, characterized in that: The nucleotide sequence of the riboswitch is shown in SEQ ID NO:

1.

7. A biosensor, characterized in that: The biosensor carries the riboswitch according to claim 6.

8. A method for modifying a doxycycline riboswitch, characterized in that: The method comprises mutating nucleotide 26, nucleotide 47, nucleotide 51 and / or nucleotide 53 of the riboswitch parent according to claim 6.

9. The method according to claim 8, characterized in that The parent is subjected to a mutation as shown in any one of (1) to (6): (1) Mutate cytosine C at position 26 to guanine G; (2) Mutate adenine A at position 47 to uracil U; (3) Mutate adenine A at position 49 to guanine G; (4) Mutation of uracil U at position 51 to cytosine C; (5) mutating cytosine C at position 53 to guanine G; (6) Mutate cytosine C at position 26 to guanine G and mutate adenine A at position 47 to uracil U.

10. Use of the method of any one of claims 1 to 5, the riboswitch of claim 6, the biosensor of claim 7, or the method of claim 8 or 9 in the synthesis of doxycycline.

Images