A dsRNA targeting the BcMucin gene and its application in preparing a preparation for preventing and treating gray mold

Abstract

The present invention provides a dsRNA targeting the BcMucin gene and its use in the preparation of a preparation for preventing and treating gray mold. The dsRNA is obtained by artificial design and in vitro synthesis using the coding sequence of the target gene BcMucin as a template. The use of dsRNA targeting BcMucin can effectively inhibit the occurrence of gray mold in tomatoes. The present invention has proved through experiments that the deletion of the target gene BcMucin provided by the present invention will lead to slow growth of gray mold hyphae and complete loss of pathogenicity to tomatoes. It is a key gene for the growth and pathogenicity regulation of gray mold. The dsRNA provided by the present invention can effectively interfere with the expression of the target gene BcMucin in gray mold, thereby inhibiting the growth and development of gray mold and its infection of host plants, and reducing the biomass of gray mold on lesions. The dsRNA provided by the present invention can be used for the development of RNA pesticides based on RNAi, and is applied to the effective prevention and treatment of gray mold, with good market application prospects.

Description

Technical Field

[0001] The present invention belongs to the technical field of crop disease prevention and control genes, and particularly relates to a dsRNA targeting the BcMucin gene and an application thereof in preparing a preparation for preventing and controlling gray mold. Background Art

[0002] Gray mold is a common fungal disease caused by Botrytis cinerea. Botrytis cinerea has a wide host range, infecting over 1,000 plant species, including over 200 crops. It can infect crops both in the field and after harvest. Widespread outbreaks can lead to reduced or even complete crop failure, resulting in significant economic losses. Currently, chemical control remains the primary method for gray mold prevention. However, due to the broad host range, short life cycle, and genetic variability of Botrytis cinerea, coupled with the irrational use of chemical pesticides, Botrytis cinerea has developed multidrug resistance to nearly all currently used chemical fungicides, significantly reducing their effectiveness. Furthermore, with increasing awareness of food safety and environmental safety, and the implementation of the national "Reduce and Reduce Chemical Use" initiative, the use of chemical pesticides has faced significant challenges. To reduce chemical pesticide use while preventing significant declines in grain yields caused by pathogens, alternatives to traditional chemical pesticides are urgently needed to ensure the safe, green, and sustainable development of agricultural production in my country.

[0003] RNA interference (RNAi) technology is a cutting-edge post-transcriptional gene regulation technique. It targets mRNA through double-stranded RNA (dsRNA), leading to the silencing of target genes and possessing potential applications in medicine and agriculture. RNA pesticides developed using RNAi technology use dsRNA that specifically targets key genes in pests as their active ingredient. They offer advantages such as strong targeting, excellent efficacy, high environmental and ecological safety, and resistance to resistance. They are considered the "third revolution" in pesticide development. RNA pesticides are highly promising new biopesticides that cater to future agricultural development trends, offering broad application prospects and enormous value. Promoting the creation and development of RNA pesticides is of great significance to the development of green and ecological agriculture in China. Identifying key genes regulating growth, development, and pathogenicity in pests and designing effective dsRNA targeting these key genes is a key factor in the successful development of RNA pesticides. However, the current limited number of key target genes in Botrytis cinerea suitable for RNAi makes it difficult to develop and apply RNA pesticides for the control of Botrytis cinerea. Summary of the Invention

[0004] In response to the technical problem of insufficient key target genes of Botrytis cinerea that can be used for the development of RNA pesticides, the present invention aims to provide a dsRNA targeting the BcMucin gene and its use in the preparation of preparations for preventing and controlling Botrytis cinerea. The dsRNA targeting the BcMucin gene is used for the prevention and control of Botrytis cinerea, with significant prevention and control effects.

[0005] To achieve the above object of the invention, the present invention is implemented through the following technical solutions:

[0006] The present invention provides an application of the BcMucin gene in regulating the pathogenicity of gray mold. The coding nucleotide sequence of the BcMucin gene is shown in SEQ ID No. 2.

[0007] Furthermore, the BcMucin gene encodes an extracellular protein carrying an exocrine signal peptide, and its amino acid sequence is shown in SEQ ID No. 3.

[0008] Furthermore, the deletion of the target gene BcMucin results in slow growth of Botrytis cinerea hyphae.

[0009] Furthermore, the deletion of the target gene BcMucin results in the loss of pathogenicity of gray mold to tomato leaves.

[0010] The present invention also provides a dsRNA targeting the BcMucin gene. The nucleic acid sequence of the dsRNA synthesis template is shown as SEQ ID No. 4, and the sequence of the dsRNA is shown as SEQ ID No. 6.

[0011] Furthermore, the dsRNA is synthesized in vitro using the target gene BcMucin as a template; the template is obtained by adding a T7 promoter to the 5' end of the upstream primer and the downstream primer and amplifying the result by PCR.

[0012] The present invention also provides the use of the dsRNA in preparing a preparation for preventing and treating gray mold, and the dsRNA can target the BcMucin gene.

[0013] Furthermore, the dsRNA can reduce the mRNA level of the BcMucin gene by RNA interference.

[0014] Furthermore, the application is that the dsRNA can effectively inhibit the occurrence of tomato gray mold.

[0015] Furthermore, during application, the dsRNA is used at a concentration of 100 mg / L to 500 mg / L, and the dsRNA is applied by leaf spraying.

[0016] Compared with existing technologies, the present invention has the following advantages and beneficial effects: Experiments have demonstrated that the BcMucin gene is a key gene regulating hyphal growth and pathogenicity of Botrytis cinerea and can serve as an RNAi target gene. The present invention has designed a dsRNA targeting BcMucin, and experiments have demonstrated that the dsRNA can effectively interfere with BcMucin, thereby effectively preventing and controlling the occurrence of gray mold with significant control effects. The dsRNA provided by the present invention can be used in the development of new biopesticides and has promising market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the signal peptide prediction result of the protein encoded by the BcMucin gene of the present invention.

[0018] Figure 2 The BcMucin gene knockout transformants (△BcMucin) were verified by PCR.

[0019] Figure 3 The present invention discloses the mycelial growth and colony diameter statistics of the BcMucin gene knockout mutant (△BcMucin), complemented mutant (△BcMucin-C) and wild-type B05.10 strain of Botrytis cinerea on PDA plates.

[0020] Figure 4 This is an analysis of the pathogenicity of various gray mold strains (B05.10, △BcMucin, △BcMucin-C) to tomato leaves.

[0021] Figure 5 This is the electrophoresis detection result of BcMucin-dsRNA and GFP-dsRNA of the present invention.

[0022] Figure 6 This is a test of the control effect of the BcMucin-dsRNA of the present invention on tomato gray mold, with GFP-dsRNA as a control.

[0023] Figure 7 The BcMucin-dsRNA of the present invention can significantly reduce the biomass of gray mold on the host, with GFP-dsRNA as a control.

[0024] Figure 8 This is a test of the interference effect of the BcMucin-dsRNA of the present invention on the target gene BcMucin of Botrytis cinerea, with GFP-dsRNA as a control. DETAILED DESCRIPTION

[0025] The technical solutions of the present invention are further described in detail below with reference to the accompanying drawings and specific examples. The experimental methods in the following examples are all conventional methods unless otherwise specified and are not described in detail. For non-conventional experimental operations, the specific steps are described in detail below. The experimental materials, drugs, instruments, etc. used in the following examples are all commercially available products unless otherwise specified. The quantitative statistics in the following examples are all based on three replicates, and the average value is taken.

[0026] Example 1: Knockout of the BcMucin gene of Botrytis cinerea

[0027] 1. Obtaining the gene sequence of BcMucin and constructing the knockout fragment

[0028] The present invention obtained the gene sequence of BcMucin (Bcin05g01970) from the fungal genome database (EnzemblFungi, http: / / fungi.ensembl.org / index.html). The total length is 1216 bp, and the sequence is shown in SEQ ID No. 1; the coding sequence (CDS) is 750 bp long, and the sequence is shown in SEQ ID No. 2; it encodes 249 amino acids, and the amino acid sequence is shown in SEQ ID No. 3. The SignalP-5.0 (https: / / services.healthtech.dtu.dk / services / SignalP-5.0 / ) online server predicted that amino acids 1-18 are a protein exocytosis signal peptide sequence, as shown in Figure 1 As shown, it shows that BcMucin protein is a secreted protein.

[0029] DNA from Botrytis cinerea was extracted using the CTAB method and used as a template. The primers listed in Table 1 were used to amplify the up and down fragments of BcMucin. The hygromycin gene (HPH) was amplified from the pSilent-1 plasmid using the HPH-F / R primers listed in Table 1. The up and down fragments of BcMucin were ligated to the 5' and 3' ends of HPH, respectively, using fusion PCR to construct the large-fragment up-HPH-down construct. PCR amplification was performed using the large-fragment amplification primers. The PCR product was subjected to agarose gel electrophoresis and gel recovery to obtain the large fragment, which could be used directly or stored at -20°C until further use.

[0030] Table 1 Primers used for vector construction

[0031]

[0032] 2. Construction and identification of BcMucin knockout mutants of Botrytis cinerea

[0033] The BcMucin gene was knocked out by PEG-mediated protoplast transformation technology. Collect the mycelium of Botrytis cinerea, use cell wall degrading enzymes to enzymatically hydrolyze the cell wall of the mycelium to obtain the protoplast cells of Botrytis cinerea, add the large fragments obtained by PCR amplification and PEG and other reagents to complete the protoplasm transformation. The transformation product of the double-wall culture is added to the PDA medium containing hygromycin resistance to prepare the screening plate. After 3-5 days of culture, pick a single colony from the plate and inoculate it on a new PDA plate containing hygromycin, which is a positive transformant. Extract the transformant genome, and verify the presence of the target gene BcMucin in the transformant by PCR technology. The results are as follows Figure 2 As shown, the target gene can be detected in the wild-type strain B05.10, but no corresponding band is detected in the transformant, indicating that the BcMucin gene is successfully knocked out.

[0034] Example 2: Growth and Pathogenicity Analysis of BcMucin-deficient Botrytis cinerea

[0035] The selected transformants were cultured on PDA medium without antibiotics, and the colony growth of the transformants was observed and counted. The results are as follows: Figure 3 After 3 days of culture, the colony diameters of the wild type (B05.10) and the complemented transformant (△BcMucin-C) exceeded 5 cm, while the colony diameter of the BcMucin-deficient strain (△BcMucin) was only 3 cm, which was significantly smaller than those of the wild type and complemented strains.

[0036] Each strain of Botrytis cinerea was cultured on PDA medium without antibiotics for about 3 days. A 5 mm diameter punch was used to punch holes at the edge of the colony. A bacterial cake was inoculated in the center of a plant leaf. After 3 days of moisturizing and culturing, photos were taken and the diameter of the lesions was measured. The specific results are as follows: Figure 4 B05.10 and △BcMucin-C can normally infect tomato leaves and produce more than 1cm 2 lesions, while leaves inoculated with knockout transformants △BcMucin-1 and △BcMucin-2 showed no disease at all.

[0037] The above results indicate that the BcMucin gene is a key gene for the regulation of hyphal growth and pathogenicity of Botrytis cinerea, and can therefore be used as a target for the design and development of dsRNA.

[0038] Example 3: Design and preparation of dsRNA fragments encoding BcMucin gene

[0039] The coding sequence of the BcMucin gene (shown in SEQ ID No. 2) was submitted to the siDirect version 2.1 server (http: / / sidirect2.rnai.jp / ) for small interfering RNA (siRNA) prediction. The region within the 200-500 bp sequence that produced the most siRNA was selected as a dsRNA template. Upstream and downstream primers were designed for the dsRNA template, and the T7 promoter sequence (TAATACGACTCACTATAGGGAGA) was added to the 5' end of each primer. The primers are listed in Table 2. PCR amplification was performed using cDNA from Botrytis cinerea as a template. The PCR product was electrophoresed on agarose gel and the DNA was recovered. This served as the dsRNA synthesis template. The sequence is shown in SEQ ID No. 4. Using the same method, a dsRNA synthesis template for green fluorescent protein (GFP) was amplified from a plasmid containing the gene encoding GFP. The sequence is shown in SEQ ID No. 5. The primers used are listed in Table 2. The template can be used immediately to synthesize dsRNA or stored at -20°C until needed.

[0040] Table 2 dsRNA synthesis template amplification primers

[0041]

[0042] dsRNA of BcMucin and GFP were synthesized using a dsRNA in vitro synthesis kit. The in vitro transcription system of dsRNA was: NTPMix 8μL, 10×Transcription Buffer 2μL, T7 Enzyme Mix 2μL, template 8μL, and ddH2O was added to 20μL. Incubate in a 37℃ PCR instrument for 6 hours. After the reaction, add ice ethanol to a final concentration of 75% to crudely extract the dsRNA. Add 40μL of sterile ddH2O to dissolve the crude extract to obtain dsRNA of genes BcMucin and GFP, which were respectively recorded as BcMucin-dsRNA and GFP-dsRNA. The concentration of dsRNA was determined by spectrophotometer, and the purity of dsRNA was detected by agarose gel electrophoresis. The dsRNA agarose gel electrophoresis diagram is shown as follows: Figure 5 According to the instructions in the kit, the T7 promoter initiates transcription from the first guanine (G) after the core recognition sequence. That is, the BcMucin-dsRNA sequence obtained by in vitro transcription is shown in SEQ ID No. 6, and the GFP-dsRNA sequence is shown in SEQ ID No. 7.

[0043] Example 4: Application of dsBcMucin in the prevention and treatment of gray mold

[0044] Select 4-week-old tomato seedlings with uniform growth. Take 20 leaves and randomly divide them into 2 groups, 10 leaves in each group, and place them on moist filter paper. According to the concentration of dsRNA, dilute BcMucin-dsRNA and GFP-dsRNA with ddH2O to a final concentration of 200ug / ml and spray them evenly on the above 2 groups of leaves using a small spray bottle. Collect conidia from PDA plates with gray mold, count and dilute to a conidia concentration of 10 6 After the solution on the leaf surface dried naturally, 6 μl of the above spore solution was inoculated onto the leaves. The leaves were kept moist for 60-96 hours, and the infection of gray mold was observed. The diameter of the lesions was measured using the cross-hatch method, and the area of ​​the lesions on the two groups of leaves was statistically analyzed.

[0045] The results are as follows Figure 6 As shown in Figure 2, the lesions on leaves treated with BcMucin-dsRNA were significantly smaller than those on leaves treated with GFP-dsRNA. Total DNA was extracted from leaves containing lesions of the same size, and the biomass of Botrytis cinerea in the leaves was detected by fluorescent quantitative PCR. Figure 7 As shown in the figure, the biomass of gray mold on the lesions of leaves in the group treated with BcMucin-dsRNA was significantly lower than that in the group treated with GFP-dsRNA. These results indicate that BcMucin-dsRNA has a significant control effect on gray mold.

[0046] Mycelia of Botrytis cinerea were collected from the lesions, total RNA was extracted, and cDNA was obtained by reverse transcription. The mRNA level of the target gene BcMucin was detected by fluorescence quantitative PCR. Figure 8 As shown, after treatment with BcMucin-dsRNA, the mRNA level of the target gene BcMucin of Botrytis cinerea was significantly reduced, indicating that BcMucin-dsRNA can interfere with the expression of BcMucin.

[0047] Taken together, these results indicate that BcMucin gene deletion leads to slowed growth and loss of pathogenicity in Botrytis cinerea, demonstrating its importance as a key gene for Botrytis cinerea pathogenicity. dsRNA designed targeting BcMucin effectively interferes with BcMucin gene expression in Botrytis cinerea, thereby effectively controlling Botrytis cinerea and potentially being developed into an RNA pesticide.

[0048] SEQ ID No. 6: BcMucin-dsRNA sequence GAGAGAAGCAAGAGAUUCCUUGCAAGCUCGCGAGCCAACCAAGCUCAAGGUUGAUCGCAACGCCGAGCCAGAACCCACUAAGCUUAAGGUUGACCGUCGCACCAAGCUCAAGGUUGAUAGAAACGCCGAAGCCGAGCCAACAAAGCUUAAGGUUGACCGUCGCACCAAGCUCAAGGUCGAUCGCAACGCUGAGCCAGAACCUACAAAACUUAAAGUUGACAGAAGCGCUGAAGCCGAGCCAACUCUC

[0049] SEQ ID No. 7: GFP-dsRNA sequence GAGAUCGAACUCGAUGGUGACGUCAAUGGCCAUAAGUUCUCAGUCAGCGGAGAGGGUGAGGGAGACGCUACAUAUGGUAAAUUGACUCUUAAGUUCAUCUGCACCACAGGUAAAUUGCCUGUACCUUGGCCUACACUCGUCACCACCCUCACCUACGGAGUUCAAUGCUUUUCCCGUUACCCAGAUCACAUGAAACAACAUGACUUUUUCAAGUCUGCAAUGCCAGAGGGAUAUGUCCAAGAGAGAACAAUCUUCUUUAAGGAUGACGGAAAUUAUAAGACUCGUGCCGAGGUUAAGUUCGAGGGUGAUACUCUCGUCAACCGUAUUGAGUUGAAGGGCAUCGAUUUCAAGGAAGACGGAAAUAUCCUCGGCCAUAAGCUUGAAUACAACUACAACAGUCACAACGUUUAUAUCAUGGCCGACAAGCAAAAAAAUGGAAUCAAGGUCAACUUCAAAAUCAGACACAACAUUGAGGAUGGCUCUGUUCAAUUGGCAGAUCACUACCAACAGAAUACUCUC

[0050] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. The application of BcMucin gene in regulating the pathogenicity of gray mold, characterized in that: The coding nucleotide sequence of the BcMucin gene is shown in SEQ ID No.

2.

2. The use according to claim 1, characterized in that Knocking out the BcMucin gene will result in slow hyphae growth of Botrytis cinerea and loss of pathogenicity of Botrytis cinerea.

3. A dsRNA targeting the BcMucin gene, characterized in that: The nucleotide sequence of the dsRNA synthetic template is shown in SEQ ID No. 4, and the sequence of the dsRNA is shown in SEQ ID No.

6.

4. Use of the dsRNA targeting the BcMucin gene according to claim 3 in preparing a preparation for preventing and treating gray mold.

5. The use according to claim 4, characterized in that The dsRNA is prepared to a concentration of 100 mg / L to 500 mg / L and sprayed on plant leaves.

Images