Method for establishing zebra fish model of neonatal congenital digestive tract obstruction

Abstract

Neonatal congenital digestive tract obstruction is digestive system structural deformity caused by various factors in the fetal development process, the invention provides a method for establishing a zebra fish model for neonatal congenital digestive tract obstruction, a gRNA target sequence is designed on an amino acid structural domain of a zebra fish ZIC3 gene, the specific sequence of sgRNA is GCGCCATAAGGTTCCGTACGAGG-3 or GCCCCGGACCATGGTGTGGGG, and a primer is synthesized; the ZIC3 mutation zebrafish juvenile fish grows to 6-7 days, and the zebrafish with the effective mutation type in embryo detection is obtained through multi-step detection.

Description

Technical Field

[0001] The invention relates to the technical field of methods for constructing model animal disease models, and in particular to a method for establishing a zebrafish model of neonatal congenital digestive tract obstruction. Background Art

[0002] Congenital gastrointestinal obstruction in newborns is a structural malformation of the digestive system caused by various factors during fetal development, with an incidence rate between 1 / 10,000 and 1 / 4,000. Depending on the location of the obstruction, it can be divided into several common types, such as esophageal atresia or stenosis, duodenal atresia or stenosis, jejunal or ileal atresia or stenosis, and anorectal malformation. The typical clinical feature of congenital gastrointestinal obstruction is gastrointestinal obstruction, manifested as vomiting, abdominal distension, dysphagia, and no normal meconium discharge. In addition to abnormalities in the anatomical structure of the digestive tract, such patients may also have gastrointestinal motility disorders. Although surgical treatment is currently the only recognized effective method, serious adverse reactions such as infection, adhesion, and anastomotic fistula may occur after surgery.

[0003] The etiology and pathogenesis of congenital gastrointestinal obstruction have not yet been fully elucidated. Genetic factors, environmental exposure, changes in hormone levels and other factors may be related to the occurrence of such diseases. Early studies proposed theories such as incomplete intestinal cavitation, late embryonic mesenteric blood supply disorders, and incomplete development of nerves and pacemaker cells in the intestinal wall, but none of them can fully explain the occurrence of the disease. With the in-depth research of disciplines such as embryology, immunology and genetics, more and more evidence shows that the formation of gastrointestinal malformations is inseparable from genetic factors, and multiple genes are involved in its occurrence and development.

[0004] The ZIC3 gene is located on human chromosome X and is responsible for encoding zinc finger protein 3 (Zincfingerprotein3), a member of the zinc finger protein family. Studies have shown that mutations or incomplete function of the ZIC3 gene are closely related to the disorder of the establishment of left-right symmetry of the body (such as abnormal position of the heart, intestines and other visceral organs), which is particularly prominent in heart development defects. In their 1997 study, Gebbia et al. first revealed the association between ZIC3 gene mutations and left-right axis developmental abnormalities. Interestingly, in addition to heart development defects and visceral heterotaxy, some individuals carrying ZIC3 gene mutations also exhibit digestive tract abnormalities such as anal malformations and duodenal atresia, suggesting that the ZIC3 gene may also play a key role in digestive tract development. In 2020, Bishop et al. discovered a ZIC3 gene variant in children with duodenal atresia, providing new evidence for the association of this gene with digestive tract malformations. ZIC3 may cause abnormal phenotypes of congenital digestive tract obstruction by affecting the differentiation of endoderm and mesoderm cells.

[0005] This study used the CRISPR / Cas9 system to construct ZIC3 Zebrafish line, describing the pathogenesis of mutant fish lineage by structural and pathological analysis of digestive tract malformations of mutants. Summary of the invention

[0006] The method for establishing a zebrafish model of neonatal congenital digestive tract obstruction is characterized by comprising the following steps: S1. Design gRNA target sequences in zebrafish ZIC3 On the amino acid domain of the gene, the specific sequence of sgRNA was GCGCCATAAGGTTCCGTACGAGG-3 or GCCCCGGACCATGGTGTGTGGG, and the primers were synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mixing the gRNA and Cas9 mRNA recovered in step S3 and microinjecting them into one-cell stage zebrafish embryos, with 180 to 220 microliters injected into each target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the injected batch embryos with double peaks in the sequencing results into the breeding system, and raise them until sexual maturity by screening the next generation of embryos to detect effective mutant types of zebrafish, thereby obtaining ZIC3 Mutant zebrafish.

[0007] S6, take step S5 ZIC3 Mutant zebrafish ZIC3 Expression level detection; S7, take step S5 ZIC3 Mutant zebrafish, embryonic day 6 ZIC3 Real-time in vivo fluorescence imaging of fish digestive tract motility in mutant zebrafish; S8, take step S5 ZIC3 Mutant zebrafish, embryos at 7 days old ZIC3 Pathological analysis of mutant zebrafish; S9, analyzing and describing the data obtained in step S6, step S7, and step S8 ZIC3 Pathogenesis of mutant zebrafish.

[0008] The steps of establishing the above model are further optimized as follows: In step S1, the sgRNA preferably uses the specific sequence GCGCCATAAGGTTCCGTACGAGG-3.

[0009] In step S1, the gRNA target sequence is designed in zebrafish ZIC3 Amino acid domains of genes.

[0010] The gRNA and Cas9 mRNA in the S4 were freshly mixed and microinjected into one-cell stage zebrafish embryos, with the gRNA at 320 ng / μL and the Cas9 mRNA at 800 ng / μL.

[0011] The injected batch embryos with bimodal sequencing results in step S5 are placed in a breeding system and raised until sexual maturity, and then the next generation of embryos are screened to detect effective mutant zebrafish.

[0012] The method for observing the situation under the fluorescence microscope in step S7 is as follows: ZIC3 Mutant zebrafish 6dpf zebrafish larvae were selected and placed in 6 plate wells for staining. 4mL of zebrafish culture water was added to each well, and then the dye was added to make the final concentration reach 1mg / L. After 24 hours of staining, the samples were washed 3 times with zebrafish culture water, and after washing, the samples were fixed with low melting point glue and finally photographed using a stereo microscope.

[0013] In step S7 ZIC3 Pathological analysis of mutant zebrafish larvae: ZIC3 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 hours, and then dehydrated, transparentized, wax-impregnated, and embedded. The slices were sliced ​​to a thickness of 4 μm, stained with HE, and the pathological conditions of the digestive tract were observed under a bright field microscope.

[0014] Said ZIC3 Mutant zebrafish larvae were 6-7 days old.

[0015] Beneficial effects of the present invention: The present invention designs targets based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score. The gRNA and Cas9 mRNA were freshly mixed and microinjected, and embryos were collected 72 hours after injection. The target fragments were amplified by PCR and sequenced. The results showed that the Crispant homozygous genotype zebrafish had double peaks, indicating that the CRISPR / Cas9 system designed this time worked. The present invention established ZIC3 After the mutant zebrafish line finally passes the detection and analysis of steps S6-S9, it can simulate the characteristics of congenital gastrointestinal obstruction disease in newborns. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a measurement diagram of the zic3 gene expression level in zebrafish.

[0017] Figure 2 For zebrafish control group and ZIC3 Real-time in vivo fluorescence imaging of digestive tract motility in mutant digestive tracts.

[0018] Figure 3 For zebrafish control group and ZIC3 Pathological changes in the digestive tract of mutants.

[0019] Figure 4 This is the verification map of the zebrafish ZIC3 genome sequence.

[0020] Figure 5 The sequencing results of mutant zebrafish with cleavage of the Target1 site.

[0021] Figure 6 This is the sequencing result of mutant zebrafish with cleavage of the Target2 site.

[0022] Figure 7 This is the sequencing result of the mutant zebrafish with the Target3 site cut.

[0023] Figure 8 This is the sequencing result of mutant zebrafish with cleavage of the Target4 site.

[0024] Fig. 9 This is a diagram of the cutting efficiency of mutant zebrafish that cut the Target1 site.

[0025] Fig.10 This is a diagram of the cutting efficiency of mutant zebrafish that cut the Target2 site.

[0026] Fig.11 This is a diagram of the cutting efficiency of mutant zebrafish that cut the Target3 site.

[0027] Fig.12 This is a diagram showing the cutting efficiency of mutant zebrafish that cut the Target4 site.

[0028] Fig.13 Map of gene knockdown target sequences constructed for zebrafish ZIC3 mutants. DETAILED DESCRIPTION

[0029] In order to make up for the above shortcomings, the present invention provides a method for establishing a zebrafish model of neonatal congenital digestive tract obstruction to solve the problems in the above background technology.

[0030] The method for establishing a zebrafish model of neonatal congenital digestive tract obstruction includes the following steps: S1. Design gRNA target sequences in zebrafish ZIC3 On the amino acid domain of the gene, the primers were synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mixing the gRNA and Cas9 mRNA recovered in step S3 and microinjecting them into one-cell stage zebrafish embryos, with 180 to 220 microliters injected into each target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the breeding system with a double peak in the injected batch embryos. The breeding system uses a zebrafish breeding system (ESEN-AW-DU5SS, Beijing Aisheng Company). When the zebrafish are sexually mature, the next generation of embryos are screened to detect effective mutation types, thereby obtaining ZIC3 mutant zebrafish; S6, take the ZIC3 mutant zebrafish from step S5 and perform ZIC3 Expression level detection; S7, take step S5 ZIC3 Mutant zebrafish, embryonic day 6 ZIC3 Real-time in vivo fluorescence imaging of fish digestive tract motility in mutant zebrafish; S8, take step S5 ZIC3 Mutant zebrafish, embryos at 7 days old ZIC3 Pathological analysis of mutant zebrafish; S9, analyzing and describing the data obtained in step S6, step S7, and step S8 ZIC3 Pathogenesis of mutant zebrafish.

[0031] In step S1, the gRNA target sequence is designed in zebrafish ZIC3 Amino acid domains of genes.

[0032] In step S4, the gRNA and Cas9 mRNA were freshly mixed and microinjected into the one-cell stage zebrafish embryos, with the gRNA concentration being 320 ng / μL and the Cas9 mRNA concentration being 800 ng / μL.

[0033] In the S4 step, 200 pellets were injected into each target point.

[0034] Method for observing the situation under fluorescence microscope in step S7: ZIC3Mutant zebrafish 6dpf zebrafish larvae were selected and placed in 6 plate wells for staining. 4mL of zebrafish culture water was added to each well, and then the dye was added to make the final concentration reach 1mg / L. After 24 hours of staining, the samples were washed 3 times with zebrafish culture water, and after washing, the samples were fixed with low melting point glue and finally photographed using a stereo microscope.

[0035] In step S7 ZIC3 Pathological analysis of mutant zebrafish larvae: ZIC3 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 hours, and then dehydrated, transparentized, wax-impregnated, and embedded. The slices were sliced ​​to a thickness of 4 μm, stained with HE, and the pathological conditions of the digestive tract were observed under a bright field microscope.

[0036] ZIC3 Mutant zebrafish larvae were 6-7 days old.

[0037] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further described below in conjunction with specific embodiments.

[0038] The specific target design of the present invention is as follows: (1) Target site selection: Select the target site as follows (Note: red fonts mark gene exon sequences; underlines mark sequence amplification primers; yellow background or wavy lines mark target sequences). Fig.13 shown.

[0039] (2) The designed target sequence is as follows: zic3-Target1 GCGCCATAAGGTTCCGTACG AGG Reverse zic3-Target2 GTTATAGTTATGCAGCGGAG CGG Reverse zic3-Target3 GCCCCCGGACCATGGTGTGT GGG Reverse zic3-Target4 GGGCCTTCTTCAGATACATG CGG Forward (3) The forward primers for target gRNA transcription template amplification are: zic3-T1F TTAATACGACTCACTATAGCGCCATAAGGTTCCGTACGGTTTTAGAGC TAGAAATAG zic3-T2F TTAATACGACTCACTATAGTTATAGTTATGCAGCGGAGGTTTTAGAGC TAGAAATAG zic3-T3F TTAATACGACTCACTATAGCCCCCGGACATGGTGTGTGTTTTAGAGC TAGAAATAG zic3-T4F TTAATACGACTCACTATAGGGCCTTCTTCAGATACATGGTTTTAGAGC TAGAAATAG (4) The reverse primer for target gRNA transcription template amplification is: T7gRNA-R AAAAAAAGCACCGACTCGGTGCCAC (5) Design and synthesize target detection primers: zic3-F1 AAATGCACCTGGGTTTACGC zic3-R1TGTACTCGGATGTGGTTCACG (6) Verification of zic3 genome sequence: Amplify the DNA sequence containing several targets and then sequence. Target 3 has a point mutation. When synthesizing the target forward primer, change it to the actual sequencing sequence, such as Figure 4 shown.

[0040] (7) ZIC3 target in vitro transcription concentration T1-gRNA: 5585ng / μL T2-gRNA: 1937ng / μL T3-gRNA: 2754ng / μL T4-gRNA: 5144ng / μL (8) ZIC3 target injection The target gRNA and Cas9 protein were mixed and injected into AB wild-type zebrafish embryos. The final concentration of Cas9 protein injection was 800ng / μL and the final concentration of gRNA was 320ng / μL. Microinjection was performed at the first embryonic stage of zebrafish, with 1nL injected into each embryo and about 100 embryos injected into each target site. After 3dpf, 20 juveniles were randomly selected from each group to extract the genome and perform PCR amplification, and then sent for sequencing. The sequencing results are shown in Figure 5 , Figure 6 , Figure 7 as well as Figure 8 As shown, specifically: A. Figure 5 It shows that Target1 GCGCCATAAGGTTCCGTACG AGG is cleaved; B. Figure 6 It shows that Target2 GTTATAGTTATGCAGCGGAG CGG undergoes cleavage; C. Figure 7 It showed that Target3 GCCCCCGGACCATGGTGTGT GGG was cleaved; D. Figure 8 It shows that Target4 GGGCCTTCTTCAGATACATG CGG is cleaved.

[0041] (9) Detection of zic3 target cleavage efficiency PCR products were cloned by TA, and 15 clones were selected for sequencing. The sequencing results without signal and non-single clone were removed, and the target cutting efficiency was calculated. For details, refer to Fig. 9 , Fig.10 , Fig.11 as well as Fig.12 , the conclusions are as follows: A. Fig. 9 As shown, the cutting efficiency of Target1 is 10 / 10; B. Fig.10 As shown, the cutting efficiency of Target2 is 5 / 9; C. Fig.11 As shown, the cutting efficiency of Target3 is 10 / 10; D. Fig.12 As shown, the cutting efficiency of Target4 is 10 / 11.

[0042] In summary, in fact, the specific sequence of the sgRNA of the present invention can be completely selected from Target1 or Target2 or Target3 or Target4, any of which undergoes cutting, but is selected based on the cutting efficiency, and specifically Target1 or Target3 is selected. Embodiment 1:

[0043] The present invention designs targets based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score. The gRNA and Cas9 mRNA were freshly mixed and microinjected, and embryos were collected 72 hours after injection. The target fragments were amplified by PCR and sequenced. The results showed that the Crispant homozygous genotype zebrafish had double peaks, indicating that the CRISPR / Cas9 system designed this time worked ( Figure 5-Figure 8). In the Crispant homozygous genotype zebrafish strain screened in Example 1, the QPCR results showed ZIC3 The expression level was significantly decreased ( Figure 1 ), specifically, refer to Figure 1 : After knocking down the zic3 gene in zebrafish, the expression level of the zic3 gene was measured, and it was found that the expression level of zic3 in the control group was about 40 times that of the internal reference, while the expression level of the zic3 knockdown group was about 30 times that of the internal reference. After statistical software analysis, the difference was significant (p<0.001, represented by three * in the figure), indicating that this experimental method can effectively knock down the expression of the target gene.

[0044] Fluorescent digestive tract examination of mutants: Real-time in vivo fluorescence imaging of digestive tract peristalsis in zebrafish mutants at 7 days of development showed obvious structural abnormalities in the digestive tract, including narrowing of the intestinal bulb, severe narrowing of the digestive tract cavity, obstructed contraction, and loss of peristalsis ( Figure 2 ).

[0045] Pathological analysis of mutants: Crispant homozygous zebrafish larvae grown to day 7 screened in Example 1 were taken. HE staining results showed that the zic3 gene knockdown zebrafish showed a trend of overall digestive tract narrowing, a significant reduction in intestinal folds, and the appearance of a large number of alveolar goblet cells ( Figure 3 ).

[0046] Comprehensive mutant fluorescent digestive tract examination and mutant pathological analysis, thus the invention establishes ZIC3 Mutant zebrafish lines can simulate the characteristics of congenital gastrointestinal obstructive diseases in newborns.

[0047] Experimental Example 1 Reagents: DEPC water (Solarbio), agar powder Agarose-Molecular Biology Grade (invitrogen), borosilicate glass capillaries (model 1B100F-4, World Precision Instruments, USA), HiScribe™ T7 (catalog number E2040S, New England Biolabs, USA); miRNA isolation kit (catalog number AM1561, Invitrogen, USA); NLS-Cas9 nuclease (model E365, China Jinan Protein Company).

[0048] Instruments: The feeding system used a zebrafish breeding system (ESEN-AW-DU5SS, Beijing Aisheng Company), a Hengsheng biochemical incubator (Shanghai Yuejin Medical Instrument Co., Ltd.), a stereomicroscope (P2-CTLA, Japan Nekon Company), a culture dish, a microinjection needle, a microinjection instrument (model PICOSPRITZER®Ⅲ, Parker, USA), and a real-time fluorescence quantitative PCR instrument (CFX96, Bio-Rad, USA).

[0049] The present invention designs targets based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score.

[0050] The method for establishing a zebrafish model of neonatal congenital digestive tract obstruction includes the following steps: S1. Design gRNA target sequences in zebrafish ZIC3 On the amino acid domain of the gene, the specific sequence of sgRNA was GCGCCATAAGGTTCCGTACGAGG-3, and the primers were synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mixing the gRNA and Cas9 mRNA recovered in step S3 and microinjecting them into one-cell stage zebrafish embryos, with 180 to 220 microliters injected into each target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the injected batch embryos with double peaks in the sequencing results into the breeding system, and raise them until sexual maturity by screening the next generation of embryos to detect effective mutant types of zebrafish, thereby obtaining ZIC3 mutant zebrafish; S6, take the ZIC3 mutant zebrafish from step S5 and perform ZIC3 Expression level detection, i.e. Figure 1 Middle: After knocking down the zic3 gene in zebrafish, the expression level of the zic3 gene was measured, and it was found that the expression level of zic3 in the control group was about 40 times that of the internal reference, while the expression level of the zic3 knockdown group was about 30 times that of the internal reference. After statistical software analysis, the difference was significant (p<0.001, represented by three * in the figure), indicating that this experimental method can effectively knock down the expression of the target gene.

[0051] S7, take step S5 ZIC3 Mutant zebrafish, embryonic day 6 ZIC3 Real-time in vivo fluorescence imaging of fish digestive tract motility in mutant zebrafish; S8, take step S5 ZIC3 Mutant zebrafish, embryos at 7 days old ZIC3 Pathological analysis of mutant zebrafish; S9, analyzing and describing the data obtained in step S6, step S7, and step S8 ZIC3 Pathogenesis of mutant zebrafish.

[0052] In step S1, the gRNA target sequence is designed in zebrafish ZIC3 Amino acid domains of genes.

[0053] In step S4, the gRNA and Cas9 mRNA were freshly mixed and microinjected into the one-cell stage zebrafish embryos, with the gRNA concentration being 320 ng / μL and the Cas9 mRNA concentration being 800 ng / μL.

[0054] In the S4 step, 200 pellets were injected into each target point.

[0055] Method for observing the situation under fluorescence microscope in step S7: ZIC3 Mutant zebrafish 6dpf zebrafish larvae were selected and placed in 6 plate wells for staining. 4mL of zebrafish culture water was added to each well, and then the dye was added to make the final concentration reach 1mg / L. After 24 hours of staining, the samples were washed 3 times with zebrafish culture water, and after washing, the samples were fixed with low melting point glue and finally photographed using a stereo microscope.

[0056] In step S7 ZIC3 Pathological analysis of mutant zebrafish larvae: ZIC3 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 hours, and then dehydrated, transparentized, wax-impregnated, and embedded. The slices were sliced ​​to a thickness of 4 μm, stained with HE, and the pathological conditions of the digestive tract were observed under a bright field microscope.

[0057] ZIC3 Mutant zebrafish larvae were 6-7 days old.

[0058] The specific sequence of sgRNA selected for this experimental example is GCGCCATAAGGTTCCGTACGAGG-3, and the target in vitro transcription concentration mainly affects the efficiency of transcription and the quality of the product. During in vitro transcription, the yield and quality of the target mRNA are affected by the transcription conditions provided, including the concentration of template DNA, the type and quantity of RNA polymerase, the concentration of NTPs, and the composition of the transcription buffer. Generally speaking, a higher target concentration helps to increase the yield of mRNA because it allows more RNA polymerase to be contacted within a certain period of time, thereby replicating more RNA molecules. In addition, the appropriate NTP concentration is also important because they are the raw materials for RNA synthesis. If the NTP concentration is inappropriate, it may cause incorrect promoter tailing, termination or mismatch, thereby affecting the quality and function of mRNA. In in vitro transcription, the use of RNase inhibitors should also be considered to prevent RNA from being degraded, and in the final RNA purification step, RNase needs to be completely removed and the integrity of RNA needs to be ensured, so as to obtain high-quality mRNA for experiments. In short, the target in vitro transcription concentration is a key factor that directly affects the yield and quality of mRNA, and thus affects the results of subsequent biological experiments. Therefore, proper selection of concentration is crucial when designing and performing in vitro transcription experiments.

[0059] Beneficial effects of the present invention: The present invention designs targets based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score. The gRNA and Cas9 mRNA were freshly mixed and microinjected, and embryos were collected 72 hours after injection. The target fragments were amplified by PCR and sequenced. The results showed that the Crispant homozygous genotype zebrafish had double peaks, indicating that the CRISPR / Cas9 system designed this time worked. The present invention established ZIC3 After the mutant zebrafish line finally passes the detection and analysis of steps S6-S9, it can simulate the characteristics of congenital gastrointestinal obstruction disease in newborns.

[0060] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A method for establishing a zebrafish model of neonatal congenital digestive tract obstruction, characterized in that: The following steps are involved: S1. Design the gRNA target sequence in zebrafish ZIC3 On the amino acid domain of the gene, the specific sequence of sgRNA was GCGCCATAAGGTTCCGTACGAGG-3 or GCCCCGGACCATGGTGTGTGGG, and the primers were synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mix the gRNA and Cas9 mRNA recovered in step S3 to make the final concentration of gRNA reach 320 ng / μL and Cas9 mRNA reach 800 ng / μL, then microinject into one-cell stage zebrafish embryos, injecting 180 to 220 pieces per target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the injection batch embryos with double peaks in the sequencing results into a breeding system (Beijing Aisheng Company). When they are sexually mature, the next generation of embryos is screened to detect effective mutant types of zebrafish, thereby obtaining ZIC3 Mutant zebrafish.

2. The method for establishing a zebrafish model of neonatal congenital digestive tract obstruction as claimed in claim 1, characterized in that: In step S1, the sgRNA uses a specific sequence of GCGCCATAAGGTTCCGTACGAGG-3.

3. The method for establishing a zebrafish model of neonatal congenital digestive tract obstruction as claimed in claim 2, characterized in that: The following steps are also included: S6, take step S5 ZIC3 Mutant zebrafish ZIC3 Expression level detection; S7, take step S5 ZIC3 Mutant zebrafish, embryonic day 6 ZIC3 Real-time in vivo fluorescence imaging of fish digestive tract motility in mutant zebrafish; S8, take step S5 ZIC3 Mutant zebrafish, embryos at 7 days old ZIC3 Pathological analysis of mutant zebrafish; S9, analyzing and describing the data obtained in step S6, step S7, and step S8 ZIC3 Pathogenesis of mutant zebrafish.

4. The method for establishing a zebrafish model of neonatal congenital digestive tract obstruction as claimed in claim 3, characterized in that: In step S1, the gRNA target sequence is designed in zebrafish ZIC3 Amino acid domains of genes.

5. The method for establishing a zebrafish model of neonatal congenital digestive tract obstruction as claimed in claim 3, characterized in that: The gRNA and Cas9 mRNA in the S4 were freshly mixed and microinjected into one-cell stage zebrafish embryos, with the gRNA at 320 ng / μL and the Cas9 mRNA at 800 ng / μL.

6. The method for establishing a zebrafish model of neonatal congenital digestive tract obstruction as claimed in claim 3, characterized in that: The injected batch embryos with bimodal sequencing results in step S5 are placed in a breeding system and raised until sexual maturity, and then the next generation of embryos are screened to detect effective mutant zebrafish.

7. The method for establishing a zebrafish model of neonatal congenital digestive tract obstruction according to any one of claims 3 to 6, characterized in that: The method for observing the situation under the fluorescence microscope in step S7 is as follows: ZIC3 Mutant zebrafish: 6 dpf zebrafish larvae were selected and placed in 6 plate wells for staining. 4 mL of zebrafish culture water was added to each well, and then the dye was added to make the final concentration reach 1 mg / L. After 24 hours of staining, the zebrafish culture water was used for 3 washes, and after washing, the samples were fixed with low melting point glue and finally photographed using a stereo microscope.

8. The method for establishing a zebrafish model of neonatal congenital digestive tract obstruction according to claim 7, characterized in that: In step S7 ZIC3 Pathological analysis of mutant zebrafish larvae: ZIC3 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 h, and then dehydrated, transparentized, wax-impregnated, and embedded. The slices were sliced ​​to a thickness of 4 μm and stained with HE. The pathological conditions of the digestive tract were observed under a bright-field microscope.

9. The method for establishing a zebrafish model of neonatal congenital digestive tract obstruction according to claim 8, characterized in that: Said ZIC3 Mutant zebrafish larvae were 6-7 days old.

Images