Kit for pretreatment of 5hmC-DNA, pretreatment method, photoelectrochemical sensor for detecting 5hmC-DNA, and detection method of 5hmC-DNA

Abstract

The invention relates to the technical field of biosensing, in particular to a kit for pretreatment of 5hmC-DNA, a pretreatment method, a photoelectrochemical sensor for detecting the 5hmC-DNA and a detection method of the 5hmC-DNA. According to the invention, a Y-shaped stent structure is formed by specific reaction of an azidation reaction on a 5hmC target, and signal conversion output of the Y-shaped stent is realized by combining an isothermal amplification technology; on the basis, a photoelectrochemical analysis strategy of the ternary heterojunction photocatalyst Cu2O and CuO and Ag is constructed, and double amplification of photoelectrochemical response signals is realized by utilizing a signal conversion output structure and a catalytic medium amplification principle, so that the detection sensitivity is improved. According to the dose-effect relationship between photoelectrochemical signal response and a target sequence, a mathematical model of hydroxymethylation and electrochemical response signals of DNA with different abundance is established, and the purpose of quantitative analysis of hydroxymethylation of 5hmC-DNA is achieved.

Description

Technical Field

[0001] The present invention relates to the field of biosensor technology, and in particular to a kit and a pretreatment method for 5hmC-DNA pretreatment, a photoelectrochemical sensor for detecting 5hmC-DNA, and a 5hmC-DNA detection method. Background Art

[0002] 5-Hydroxymethylcytosine (5hmC) is a mode of epigenetic modification, mainly produced by 5-methylcytosine (5mC) catalyzed by TET (ten-eleven translocation, TET) protease, and is the "sixth base" discovered after 5mC. So far, a large number of studies at home and abroad have shown that the overall content of 5hmC in various cancer genes such as breast cancer HOXA, LZTS1, TNFA genes, colon cancer CA2, FMN2, PDCD4, PKIB genes, lung cancer SOD3 genes, etc. has been significantly reduced; while in benign uterine leiomyoma, acute myeloid leukemia and glioblastoma, the overall level of 5hmC has shown an increasing trend; in addition, abnormal 5hmC distribution has also been found in myelodysplastic syndrome, Huntington's disease and Alzheimer's disease. Therefore, 5hmC is not only a key intermediate in the demethylation process, but also acts as an independent epigenetic marker, and is an important biomarker for disease diagnosis and prognosis. Since epigenetic modification regulates gene expression in the early stages of tumor development, and positive imaging results of tumors are often found in the middle and late stages of tumors, and the detection of protein tumor markers is also a biochemical test after tumor formation, the detection of 5hmC modification levels belongs to an earlier test. At the same time, the detection of characteristic target genes of tumors has better methodological specificity compared with the detection of protein tumor markers carried out in current laboratories. Therefore, epigenetic DNA hydroxymethylation levels have become a new target for early specific diagnosis of tumors, and quantitative analysis of specific sequence DNA hydroxymethylation can provide strong support for understanding the epigenetic laws of disease development and early specific diagnosis of tumors.

[0003] The main methods for DNA hydroxymethylation analysis reported so far are as follows: ① Liquid chromatography mass spectrometry (LC-MS) analysis technology. LC-MS analysis mainly combines the separation ability of chromatography with the qualitative detection of mass spectrometry. After the DNA sample is enzymatically hydrolyzed into single nucleotides, it is injected into the chromatographic column, and the mass spectrum is drawn after each peak is measured. Although this technology has high specificity and can provide the proportion of each component, it cannot achieve single-base resolution, and the amount of sample for a single detection is small. ② Analytical technology based on the principle of glycosylation labeling mainly refers to the use of radioactive labeled glucose through enzymatic reaction to specifically label the radioactive substance to the 5hmC base of the target gene, and then enrich and purify the target gene. Although this method has high sensitivity, low cost and easy operation, it has problems of radioactive contamination and incomplete enzymatic reaction. ③ Based on single-molecule sequencing technology, single-molecule DNA sequencing distinguishes different bases by means of optical signals, electrical signals, etc. The base recognition error rate of this technology is as high as 18-20%, and its accuracy is poor. In addition, the huge amount of data processing after the test and the special requirements for the testing equipment make it difficult to promote in clinical laboratories.

[0004] In summary, how to obtain accurate and specific 5hmC at a single-base resolution from a large number of C (cytosine, C) and 5mC sites still faces major challenges. Summary of the invention

[0005] The purpose of the present invention is to provide a kit and a pretreatment method for 5hmC-DNA pretreatment, a photoelectrochemical sensor for detecting 5hmC-DNA, and a method for detecting 5hmC-DNA. The pretreatment method of the present invention is used to treat 5hmC-DNA before detection, and 5hmC can be specifically detected at a single-base resolution level, with high detection sensitivity, simple operation, low cost, and no radioactive pollution.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a kit for 5hmC-DNA pretreatment, comprising NE buffer, uridine diphosphate-6-azide-glucose solution, T4 bacteriophage β-glucose transferase, DBCO-modified primer Yc, DNA chain Ya, DNA chain Yb, DNA chain H1, DNA chain H2, DNA chain S1, deoxynucleotide triphosphate solution, DNA polymerase and nicking endonuclease;

[0008] The nucleotide sequence of the primer Yc is shown in SEQ ID NO.1;

[0009] The nucleotide sequence of the DNA chain Ya is shown in SEQ ID NO.2;

[0010] The nucleotide sequence of the DNA chain Yb is shown in SEQ ID NO.3;

[0011] The nucleotide sequence of the DNA chain H1 is shown in SEQ ID NO.4;

[0012] The nucleotide sequence of the DNA chain H2 is shown in SEQ ID NO.5;

[0013] The nucleotide sequence of the DNA chain S1 is shown in SEQ ID NO.6.

[0014] The present invention provides a 5hmC-DNA pretreatment method, which uses the kit described in the above scheme to treat 5hmC-DNA, comprising the following steps:

[0015] NE buffer, uridine diphosphate-6-azido-glucose solution, T4 bacteriophage β-glucose transferase and the 5hmC-DNA sample to be treated are mixed, and the resulting mixture is subjected to an azidation reaction at 37°C to obtain an azidation-labeled 5hmC solution;

[0016] The azide-labeled 5hmC solution was mixed with the DBCO-modified primer Yc, and a click chemistry reaction was performed at 37° C. to obtain 5hmC-Yc;

[0017] The 5hmC-Yc, DNA chain Ya and DNA chain Yb are mixed and hybridized at 37° C. to obtain a Y-shaped scaffold;

[0018] The Y-shaped scaffold is mixed with DNA strand H1 and DNA strand H2, and assembled at 37° C. to form a hairpin-containing Y-shaped scaffold;

[0019] The hairpin-containing Y-shaped scaffold was mixed with DNA chain S1, and a chain displacement reaction was performed at 37°C. The obtained reaction solution was mixed with deoxynucleotide triphosphate, DNA polymerase and nicking endonuclease, and a first incubation was performed at 37°C.

[0020] Preferably, the molar ratio of 5hmC-Yc, DNA chain Ya and DNA chain Yb is 1:1:1;

[0021] The molar ratio of the Y-shaped support to the DNA chain H1 and the DNA chain H2 is 1:1:1.

[0022] The present invention provides a photoelectrochemical sensor for detecting 5hmC-DNA, comprising a substrate electrode loaded with a Cu2O@CuO@Ag layer, a DNA chain H3 modified with NH3, ethanethiol, and the kit ALP-H4 solution described in the above scheme;

[0023] The nucleotide sequence of the DNA chain H3 is shown in SEQ ID NO.7;

[0024] The ALP-H4 in the ALP-H4 solution is Biotin-H4-Biotin, wherein the nucleotide sequence of H4 is shown in SEQ ID NO.8.

[0025] Preferably, the preparation method of the substrate electrode loaded with the Cu2O@CuO@Ag layer comprises: dispersing Cu2O@CuO@Ag in water to obtain a Cu2O@CuO@Ag suspension; dropping the Cu2O@CuO@Ag suspension onto the surface of a conductive substrate, followed by drying and calcining to obtain a substrate electrode loaded with the Cu2O@CuO@Ag layer.

[0026] Preferably, it also includes MES buffer and Tris buffer;

[0027] The MES buffer contains 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide;

[0028] The Tris buffer contains trisodium L-ascorbic acid-2-phosphate.

[0029] A method for detecting 5hmC-DNA for non-disease diagnosis purposes using the photoelectrochemical sensor described in the above scheme comprises the following steps:

[0030] The NH3-modified DNA chain H3 is heated and then cooled to form a hairpin structure H3;

[0031] Add H3 with a hairpin structure to the surface of the substrate electrode loaded with the Cu2O@CuO@Ag layer to combine and form H3 / Cu2O@CuO@Ag / conductive substrate;

[0032] Ethyl mercaptan is added to the surface of the H3 / Cu2O@CuO@Ag / conductive substrate for a second incubation to form a HT layer, thereby obtaining HT / H3 / Cu2O@CuO@Ag / conductive substrate; the HT is ethyl mercaptan;

[0033] Using the kit to pre-treat the sample according to the pre-treatment method described in the above scheme to obtain a sequence P solution;

[0034] Adding the sequence P solution to the surface of HT / H3 / Cu2O@CuO@Ag / conductive substrate, performing a third incubation to form P / HT / H3 / Cu2O@CuO@Ag / conductive substrate;

[0035] ALP-H4 solution was added to the surface of P / HT / H3 / Cu2O@CuO@Ag / conductive substrate for the fourth incubation to form a photoelectrochemical sensor;

[0036] The photoelectrochemical sensor is placed in a Tris-HCl buffer containing L-ascorbic acid 2-phosphate trisodium salt for photocurrent testing, and the photocurrent intensity is measured. The content of 5hmC-DNA in the sample to be tested is calculated based on the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration.

[0037] Preferably, before adding the hairpin structured H3 to the surface of the substrate electrode loaded with the Cu2O@CuO@Ag layer, the method further comprises activating the substrate electrode loaded with the Cu2O@CuO@Ag layer using MES buffer.

[0038] Preferably, after completing the fourth incubation, the method further includes adding Tris buffer to the surface of the formed ALP-H4 / P / HT / H3 / Cu2O@CuO@Ag / conductive substrate.

[0039] Preferably, the temperature of the combination is 37° C. and the time is 1.5 h.

[0040] The detection principle of the present invention is as follows: the Cu2O@CuO@Ag ternary composite material is used as the basic photocurrent of PEC (photoelectrochemical sensor), and the azidation reaction is used to specifically react to the 5hmC target to form a Y-shaped bracket structure, and the self-triggered isothermal amplification technology is combined to realize the signal amplification strategy of the Y-shaped bracket, thereby converting the 5hmC site into a large number of sequences P (specifically, S1 starts the self-triggered isothermal amplification technology, S1 binds to the hairpin H1 to open, the self-priming domain in the stem segment of H1 is exposed and rearranged, and the extension of H1 continuously repeats the extension and enzyme cleavage reaction, thereby converting the 5hmC site into a large number of sequences P). Sequence P is introduced on the electrode to bind to H3, and after the hairpin H3 is opened, it is subsequently recognized by the H4 probe with ALP (i.e., ALP-H4), and ALP catalyzes AAP in Tris-HCl buffer. ( L-Ascorbic acid 2-phosphate trisodium salt ) Hydrolysis produces more AA (ascorbic acid) electron donors for PEC detection.

[0041] The present invention uses an azidation reaction to specifically react to the 5hmC target to form a Y-shaped bracket structure, and combines the self-triggered isothermal amplification technology to realize signal conversion output of the Y-shaped bracket; on this basis, a photoelectrochemical analysis strategy of the ternary heterojunction photocatalyst Cu2O@CuO@Ag is constructed, and the signal conversion output structure and the catalytic medium amplification principle are used to realize the double amplification of the photoelectrochemical response signal, thereby realizing the specific detection of 5hmC and improving the sensitivity of the detection. Through the quantitative relationship between the photoelectrochemical signal response and the target sequence, a mathematical model of DNA hydroxymethylation with different abundances and the electrochemical response signal is established to achieve the purpose of quantitative analysis of 5hmC-DNA hydroxymethylation.

[0042] The results of the examples show that the detection limit of the present invention for 5hmC is 0.42fM (signal-to-noise ratio S / N=3). BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is a schematic diagram of the process of 5hmC-DNA pre-treatment of the present invention;

[0044] Figure 2 Schematic diagram of the method flow for detecting 5hmC-DNA;

[0045] Figure 3 This is the SEM image of Cu2O@CuO@Ag;

[0046] Figure 4 The photocurrent intensity curves of 5hmC-DNA with different known concentrations;

[0047] Figure 5 is the standard curve between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration;

[0048] Figure 6 Electrochemical impedance spectra of different photochemical sensors;

[0049] Figure 7 The results of the specific detection experiment. DETAILED DESCRIPTION

[0050] The invention provides a kit for 5hmC-DNA pretreatment, comprising NE buffer, uridine diphosphate-6-azide-glucose solution, T4 bacteriophage beta-glucose transferase, DBCO-modified primer Yc, DNA chain Ya, DNA chain Yb, DNA chain H1, DNA chain H2, DNA chain S1, deoxynucleotide triphosphate solution, DNA polymerase and nicking endonuclease.

[0051] In the present invention, unless otherwise specified, the raw materials used are commercially available products well known in the art.

[0052] In the present invention, the NE buffer is preferably composed of Tris-HCl, MgCl2 and dithiothreitol (DTT), and the pH value of the NE buffer is preferably 6.0.

[0053] The present invention has no special requirements on the concentration of the UDP-6-N3-Glu solution. In the embodiment of the present invention, it is specifically 200 nM.

[0054] The present invention has no special requirements on the activity of the T4 bacteriophage β-glucose transferase (T4-β-GT). In an embodiment of the present invention, the unit activity of the T4 bacteriophage β-glucose transferase is preferably 20 U / mL.

[0055] In the present invention, the nucleotide sequence of the primer Yc is shown in SEQ ID NO.1, specifically G GACAGACGGATTTCCTCTAGTACTCCTGTGTGACTCCA, and the DBCO-modified primer Yc is specifically: GGACAGACGGATTTCCTCTAGTACTCCTGTGTGACTCCA-DBCO, wherein DBCO is dibenzocyclooctene. In the present invention, the DBCO-modified primer Yc is synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0056] In the present invention, the nucleotide sequence of the DNA chain Ya is as shown in SEQ ID NO.2; specifically, GAATGCTGCGTGTAATCCGTCTGTCCACTGGCTACTGTC.

[0057] In the present invention, the nucleotide sequence of the DNA chain Yb is as shown in SEQ ID NO.3; specifically, GAGTACTAGAGGAACACGCAGCATTCACCTGTCTGTCGT.

[0058] In the present invention, the nucleotide sequence of the DNA chain H1 is shown in SEQ ID NO.4; specifically, TGGAAAATCTCTAGCAGTACGTACACTGCTAGAGGCCGTGTAGGATCCG AATTTTTTTTGACAGTAGCCAGT.

[0059] In the present invention, the nucleotide sequence of the DNA chain H2 is shown in SEQ ID NO.5; specifically, ACTGCTAGAGATTTTCCACGGCCTCTAGCAGTGTACGTTTTTTTTTTTAC GACAGACAGGT.

[0060] In the present invention, the nucleotide sequence of the DNA chain S1 is shown in SEQ ID NO.6; specifically, GAGATTTTCCA.

[0061] In the present invention, the above-mentioned DNA chains are synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0062] In the present invention, the concentration of the deoxynucleotide triphosphate (dNTP) solution is preferably 500 μM.

[0063] In the present invention, the DNA polymerase is preferably KF DNA polymerase; the activity of the DNA polymerase is preferably 100 U / mL.

[0064] In the present invention, the activity of the nicking endonuclease (Nt.BbvCI) is preferably 500 U / mL.

[0065] The present invention provides a 5hmC-DNA pretreatment method, which uses the kit described in the above scheme to treat 5hmC-DNA, comprising the following steps:

[0066] NE buffer, uridine diphosphate-6-azido-glucose solution, T4 bacteriophage β-glucose transferase and the 5hmC-DNA sample to be treated are mixed, and the resulting mixture is subjected to an azidation reaction at 37°C to obtain an azidation-labeled 5hmC solution;

[0067] The azide-labeled 5hmC solution was mixed with the DBCO-modified primer Yc, and a click chemistry reaction was performed at 37° C. to obtain 5hmC-Yc;

[0068] The 5hmC-Yc, DNA chain Ya and DNA chain Yb are mixed and hybridized at 37° C. to obtain a Y-shaped scaffold;

[0069] The Y-shaped scaffold is mixed with DNA strand H1 and DNA strand H2, and assembled at 37° C. to form a hairpin-containing Y-shaped scaffold;

[0070] The hairpin-containing Y-shaped scaffold was mixed with DNA chain S1, and a chain displacement reaction was performed at 37°C. The obtained reaction solution was mixed with deoxynucleotide triphosphate, DNA polymerase and nicking endonuclease, and a first incubation was performed at 37°C.

[0071] The present invention mixes NE buffer, uridine diphosphate-6-azide-glucose solution, T4 bacteriophage β-glucose transferase and a 5hmC-DNA sample to be processed, and performs an azidation reaction on the obtained mixed solution at 37° C. to obtain an azide-labeled 5hmC solution.

[0072] In the present invention, the dosage of the UDP-6-azido-glucose solution is preferably such that the concentration of UDP-6-N3-Glu in the mixed solution is 6 to 7 nM; the dosage of T4 bacteriophage β-glucose transferase (T4-β-GT) is preferably such that the concentration of T4-β-GT in the mixed solution is 0.06 to 0.07 U / mL.

[0073] The present invention has no special requirements for the 5hmC-DNA sample to be processed. In the embodiment of the present invention, the 5hmC-DNA synthesized by Sangon Biotech (Shanghai) Co., Ltd. is specifically used. In the present invention, the nucleotide sequence of 5hmC is that the 18th C of the sequence shown in SEQ ID NO.9 is replaced by 5hm C. In the present invention, the volume ratio of the NE buffer to the 5hmC-DNA sample to be processed is preferably 9:20.

[0074] In the present invention, the time of the azidation reaction is preferably 2 hours. In the azidation reaction process of the present invention, T4-β-GT glycosylates 5-hydroxymethylcytosine to generate β-glucosyl-5-hydroxymethylcytosine (β-glucosyl-5-hydroxymethylcytosine, 5-ghmC) in the presence of glucose donor UDP-6-N3-Glu, thereby achieving azidation labeling.

[0075] After the azidation reaction is completed, the present invention preferably purifies the reaction system using a DNA purification kit to remove UDP-6-N3-Glu and T4 bacteriophage β-glucose transferase to obtain an azidation-labeled 5h mC solution.

[0076] After obtaining the azide-labeled 5hmC solution, the present invention mixes the azide-labeled 5hmC solution with the DBCO-modified primer Yc, and performs a click chemistry reaction at 37° C. to obtain 5hmC-Yc.

[0077] In the present invention, the molar ratio of the azide-labeled 5hmC to the DBC O-modified primer Yc in the azide-labeled 5hmC solution is preferably 1:1.

[0078] In the present invention, the click chemistry reaction time is preferably 24 hours.

[0079] After obtaining 5hmC-Yc, the present invention mixes the 5hmC-Yc, DNA chain Ya and DNA chain Yb, and performs hybridization reaction at 37° C. to obtain a Y-shaped scaffold.

[0080] In the present invention, the molar ratio of 5hmC-Yc, DNA chain Ya and DNA chain Yb is preferably 1:1:1. In the present invention, the time of the hybridization reaction is preferably 2h. In the present invention, during the hybridization reaction, Ya, Yb and Yc hybridize with each other in pairs.

[0081] After obtaining the Y-shaped scaffold, the present invention mixes the Y-shaped scaffold with DNA chain H1 and DNA chain H2, and assembles them at 37° C. to form a hairpin-containing Y-shaped scaffold.

[0082] In the present invention, the molar ratio of the Y-shaped scaffold to the DNA strand H1 and the DNA strand H2 is preferably 1:1:1. In the present invention, the assembly time is preferably 2 hours.

[0083] After forming the hairpin-containing Y-shaped scaffold, the present invention mixes the hairpin-containing Y-shaped scaffold with the DNA chain S1, and performs a chain displacement reaction at 37° C. to obtain a reaction solution.

[0084] In the present invention, the molar ratio of the hairpin-containing Y-shaped scaffold to the DNA chain S1 is preferably 1:1.

[0085] In the present invention, the strand displacement reaction time is preferably 2 hours. In the present invention, DNA strand S1 is used to open the hairpin H1, and then H1 and H2 undergo hybridization reaction.

[0086] After obtaining the reaction solution, the reaction solution is mixed with deoxynucleotide triphosphate, DNA polymerase and nicking endonuclease, and first incubated at 37°C.

[0087] In the present invention, the volume ratio of the reaction solution to deoxynucleotide triphosphate, DNA polymerase and nicking endonuclease is preferably 2000:50:4:25.

[0088] In the present invention, the first incubation time is preferably 2 hours. The present invention generates a large number of signal recognition-conversion element P sequences through the first incubation.

[0089] After the first incubation is completed, the present invention preferably further comprises inactivating the obtained solution, and the solution obtained after inactivation is recorded as solution P. The present invention has no special requirements for the inactivation conditions, as long as the inactivation effect can be achieved. In the embodiment of the present invention, the inactivation is specifically carried out at 80°C for 20 minutes.

[0090] Figure 1 Schematic diagram of the process of 5hmC-DNA pre-treatment of the present invention.

[0091] The present invention utilizes an azidation reaction to specifically react with the 5hmC target to form a Y-shaped bracket structure, and combines the self-triggered isothermal amplification technology to realize signal conversion output of the Y-shaped bracket, thereby realizing the amplification of the photoelectrochemical signal.

[0092] The present invention provides a photoelectrochemical sensor for detecting 5hmC-DNA, comprising a substrate electrode loaded with a Cu2O@CuO@Ag layer, an NH3-modified DNA chain H3, ethanethiol, the kit described in the above scheme, and an ALP-H4 solution.

[0093] In the present invention, the preparation method of the substrate electrode loaded with the Cu2O@CuO@Ag layer preferably comprises: dispersing Cu2O@CuO@Ag in water to obtain a Cu2O@CuO@Ag suspension; dropping the Cu2O@CuO@Ag suspension onto the surface of a conductive substrate, drying and calcining the suspension to obtain a substrate electrode loaded with the Cu2O@CuO@Ag layer.

[0094] The following is an explanation of Cu2O@CuO@Ag.

[0095] In the present invention, the Cu2O@CuO@Ag preferably comprises Cu2O@CuO and Ag particles supported on the surface of the Cu2O@CuO. The mass of the Ag particles is preferably 9-10% of the mass of the Cu2O@CuO.

[0096] In the present invention, the Cu2O@CuO@Ag is prepared by a method well known in the art; the preparation method of the Cu2O@CuO@Ag preferably comprises the following steps:

[0097] Dispersing Cu2O in water, adding nitrate to the obtained dispersion, and performing solid-liquid separation to obtain Cu2O@CuO;

[0098] The Cu2O@CuO is dispersed in a water-ethanol mixed solution, the obtained dispersion is mixed with a silver nitrate solution, and light irradiation reaction is performed, and solid-liquid separation is performed to obtain Cu2O@CuO@Ag.

[0099] The present invention disperses Cu2O in water, adds nitrate to the obtained dispersion to carry out oxidation reaction, separates the solid and the liquid, and obtains Cu2O@CuO.

[0100] In the present invention, the Cu2O can be prepared using commercially available products or methods well known in the art. In an embodiment of the present invention, the Cu2O is self-made. Specifically, 0.375g CuSO4·5H2O is added to 80mL of anhydrous sodium citrate with a concentration of 0.5mM to form a light blue solution under vigorous stirring; then, 20mL NaOH with a concentration of 1.25M is added to the above solution to obtain a dark blue suspension; then, 50mL of 0.03M ascorbic acid solution is added dropwise to the suspension, and stirred at a constant speed for 30min, and centrifuged after standing for 1h to obtain brick red particles, which are washed three times with deionized water and anhydrous ethanol respectively; finally, the particles are dried overnight in a vacuum oven at 60°C to obtain Cu2O.

[0101] In the present invention, the water is preferably deionized water; the present invention has no special requirements for the amount of water used, as long as it can disperse the Cu2O evenly. In the present invention, the nitrate is preferably potassium nitrate; the mass ratio of Cu2O to nitrate is preferably 2:1. In the present invention, the nitrate is preferably added to the dispersion under stirring conditions. In the present invention, the time of the oxidation reaction is preferably 1 hour; the oxidation reaction is preferably carried out under stirring conditions. The equation of the oxidation reaction is 3Cu2O+2NO3 - →6CuO+2NO↑+O 2- .

[0102] In the present invention, the solid-liquid separation is preferably centrifugation. After the solid-liquid separation is completed, the present invention preferably washes the obtained precipitate with deionized water and anhydrous ethanol three times, and then vacuum-dries it at 60° C. overnight to obtain Cu2O@CuO.

[0103] After obtaining Cu2O@CuO, the present invention disperses the Cu2O@CuO in a water-ethanol mixed solution, mixes the obtained dispersion with a silver nitrate solution, performs light irradiation reaction, and performs solid-liquid separation to obtain Cu2O@CuO@Ag.

[0104] In the present invention, the volume ratio of water to ethanol in the water-ethanol mixed solution is preferably 1:1; the present invention has no special requirements for the amount of the water-ethanol mixed solution, as long as the Cu2O@CuO can be dispersed evenly. In the present invention, the dispersion is preferably carried out under ultrasonic conditions. The present invention has no special requirements for the concentration of the silver nitrate solution, preferably satisfying that the mass of Ag in the silver nitrate solution is 9-10% of the mass of Cu2O@CuO, more preferably 10%.

[0105] In the present invention, the light irradiation reaction is preferably carried out in a photoreactor; the light irradiation reaction is preferably provided by a 300WXe lamp, and the light irradiation reaction is preferably irradiated for 1 hour under stirring conditions. The present invention preferably keeps the reaction temperature at 10 to 20°C by circulating water during the entire light irradiation process. The present invention attaches silver particles to Cu2O@CuO by photodeposition.

[0106] In the present invention, the solid-liquid separation is preferably centrifugal. After the solid-liquid separation is completed, the present invention preferably washes the obtained precipitate, then vacuum-dries it at 60°C overnight, and grinds it to obtain Cu2O@CuO@Ag powder.

[0107] The following is a description of the preparation method of the base electrode loaded with the Cu2O@CuO@Ag layer.

[0108] The present invention disperses Cu2O@CuO@Ag in water to obtain a Cu2O@CuO@Ag suspension; the Cu2O@CuO@Ag suspension is dripped onto the surface of a conductive substrate, and then dried and calcined to obtain a substrate electrode loaded with a Cu2O@CuO@Ag layer.

[0109] In the present invention, the concentration of the Cu2O@CuO@Ag suspension is preferably 2 mg / mL.

[0110] In the present invention, the conductive substrate is preferably ITO conductive glass. Before the Cu2O@CuO@Ag suspension is added dropwise to the surface of the conductive substrate, the conductive substrate is preferably first ultrasonically cleaned with acetone, ethanol and deionized water in sequence for 10 minutes and then dried in nitrogen.

[0111] In the present invention, the amount of the Cu2O@CuO@Ag suspension is preferably such that the loading amount of Cu2O@CuO@Ag is 0.05-0.1 mg / cm 2 Preferably, 0.08 mg / cm 2 .

[0112] In the present invention, the drying is preferably carried out at room temperature; the calcination temperature is preferably 180° C.; and the calcination time is preferably 40 minutes. In the present invention, Cu2O@CuO@Ag is loaded onto the surface of a conductive substrate by calcination.

[0113] The photoelectrochemical sensor for detecting 5hmC-DNA provided by the present invention is described below.

[0114] In the present invention, the photoelectrochemical sensor for detecting 5hmC-DNA comprises a substrate electrode loaded with a Cu2O@CuO@Ag layer, an NH3-modified DNA chain H3, ethanethiol, the kit described in the above scheme, and an ALP-H4 solution.

[0115] The substrate electrode supporting the Cu2O@CuO@Ag layer has been discussed above.

[0116] In the present invention, the nucleotide sequence of the DNA chain H3 is shown in SEQ ID NO.7; the NH3-modified DNA chain H3 is specifically CCTACCGGGAAGTCGCGTGTGTAGGATCCGAA TGCCTTT-NH3. In the present invention, the NH3-modified DNA chain H3 is synthesized by Sangon Biotech (Shanghai) Co., Ltd. In the present invention, the concentration of the NH3-modified DNA chain H3 is preferably 1 μM.

[0117] In the present invention, the ALP-H4 in the ALP-H4 solution is Biotin-H4-Biotin, wherein the nucleotide sequence of the H4 is as shown in SEQ ID NO.8, specifically ACACGCGACTTCCCG, and ALP-H4 represents Biotin-ACACGCGACTTCCCG-Biotin.

[0118] In the present invention, the ALP-H4 solution is preferably composed of alkaline phosphatase-labeled streptavidin (1 mg mL -1 ) was added to H4 (1 μM) buffer and incubated at room temperature for 90 min to form.

[0119] In the present invention, the concentration of the ALP-H4 solution is preferably 1 μM.

[0120] In the present invention, the photoelectrochemical sensor preferably also includes MES buffer and Tris buffer; the MES buffer preferably contains 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS); the concentration of 1-ethyl-(3-dimethylaminopropyl)carbodiimide in the MES buffer is preferably 2 mg / mL, and the concentration of N-hydroxysuccinimide is preferably 50 mM; the pH value of the MES buffer is preferably 5-6, more preferably 5.5.

[0121] In the present invention, the Tris buffer preferably contains L-ascorbic acid-2-trisodium phosphate, and the concentration of L-ascorbic acid-2-trisodium phosphate in the Tris buffer is preferably 100 mM; the pH value of the Tris buffer is preferably 7-8, more preferably 7.3.

[0122] The present invention provides a method for detecting 5hmC-DNA for non-disease diagnosis purposes using the photoelectrochemical sensor described in the above scheme, comprising the following steps:

[0123] The NH3-modified DNA chain H3 is heated to form a hairpin structure H3;

[0124] Add H3 with a hairpin structure to the surface of the substrate electrode loaded with the Cu2O@CuO@Ag layer to combine and form H3 / Cu2O@CuO@Ag / conductive substrate;

[0125] Ethyl mercaptan is added to the surface of the H3 / Cu2O@CuO@Ag / conductive substrate for a second incubation to form a HT layer, thereby obtaining HT / H3 / Cu2O@CuO@Ag / conductive substrate; the HT is ethyl mercaptan;

[0126] Using the kit to pre-treat the sample according to the above-mentioned pre-treatment method to obtain a sequence P solution;

[0127] Adding the sequence P solution to the surface of HT / H3 / Cu2O@CuO@Ag / conductive substrate, performing a third incubation to form P / HT / H3 / Cu2O@CuO@Ag / conductive substrate;

[0128] ALP-H4 solution was added to the surface of P / HT / H3 / Cu2O@CuO@Ag / conductive substrate for the fourth incubation to form a photoelectrochemical sensor;

[0129] The photoelectrochemical sensor is placed in a Tris-HCl buffer containing L-ascorbic acid 2-phosphate trisodium salt for photocurrent testing, and the photocurrent intensity is measured. The content of 5hmC-DNA in the sample to be tested is calculated based on the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration.

[0130] The present invention heats the NH3-modified DNA chain H3 and then cools it to form H3 with a hairpin structure.

[0131] In the present invention, the heating temperature is preferably 95°C, the heating time is preferably 10 min. In the present invention, the cooling rate is preferably 0.1°C·s -1 The present invention preferably cools to 37° C. The present invention forms a hairpin structure by heating.

[0132] After forming the hairpin structure H3, the present invention adds the hairpin structure H3 to the surface of the substrate electrode loaded with the Cu2O@CuO@Ag layer, and combines them to form H3 / Cu2O@CuO@Ag / conductive substrate.

[0133] Before adding the hairpin structure H3, the present invention preferably uses MES buffer to activate the substrate electrode loaded with the Cu2O@CuO@Ag layer; the activation time is preferably 2 hours. The present invention has no special requirements for the specific operation of the activation, and the MES buffer is directly added dropwise to the surface of the substrate electrode loaded with the Cu2O@CuO@Ag layer, and then rinsed with PBS buffer after 2 hours.

[0134] In the present invention, the volume ratio of the hairpin structure H3 to the sequence P solution is preferably 1:1; the concentration of the hairpin structure H3 is preferably 1 μM.

[0135] In the present invention, the binding temperature is preferably 37° C., and the binding time is preferably 1.5 h. In the present invention, the H3 chain is modified with -NH3, which can bind to the Ag particles on the Cu2O@CuO@Ag through coordination bonds.

[0136] After the combination is completed, the present invention preferably rinses with PBS buffer to form H3 / Cu2O@CuO@Ag / conductive substrate.

[0137] After forming the H3 / Cu2O@CuO@Ag / conductive substrate, the present invention adds ethyl mercaptan to the surface of the H3 / Cu2O@CuO@Ag / conductive substrate for a second incubation to form a HT layer to obtain a HT / H3 / Cu2O@CuO@Ag / conductive substrate; the HT is ethyl mercaptan.

[0138] In the present invention, the temperature of the second incubation is preferably 37° C., and the time is preferably 40 min. The present invention has no special requirements on the amount of ethanethiol added, as long as it can achieve the purpose of blocking nonspecific adsorption.

[0139] The present invention performs pretreatment on the sample to be tested to obtain a sequence P solution; the pretreatment method has been discussed above and will not be repeated here.

[0140] The present invention adds the sequence P solution to the surface of HT / H3 / Cu2O@CuO@Ag / conductive substrate, performs a third incubation, and forms P / HT / H3 / Cu2O@CuO@Ag / conductive substrate.

[0141] In the present invention, the dosage of the P solution is preferably 35 to 45 μL / cm 2 , more preferably 40 μL / cm 2 In the present invention, the temperature of the third incubation is preferably 37° C., and the time is preferably 1.5 h. In the third incubation of the present invention, the P sequence opens the card H3 sequence and hybridizes with the H3 chain to complement each other.

[0142] After the third incubation is completed, the present invention preferably uses PBS buffer to rinse to wash away unreacted substances to obtain P / HT / H3 / Cu2O@CuO@Ag / conductive substrate.

[0143] After obtaining the P / HT / H3 / Cu2O@CuO@Ag / conductive substrate, the present invention adds the ALP-H4 solution to the surface of the P / HT / H3 / Cu2O@CuO@Ag / conductive substrate for a fourth incubation.

[0144] In the present invention, the dosage of the ALP-H4 solution is preferably 35 to 45 μL / cm 2 , more preferably 40 μL / cm 2 In the present invention, the temperature of the fourth incubation is preferably 37° C., and the time is preferably 1.5 h. In the fourth incubation of the present invention, the H4 chain and the H3 chain are hybridized and complementary paired.

[0145] After completing the fourth incubation, the present invention preferably further comprises adding Tris buffer to the surface of the formed ALP-H4 / P / HT / H3 / Cu2O@CuO@Ag / conductive substrate to improve the buffer resistance of the photoelectrochemical sensor.

[0146] In the present invention, the amount of Tris buffer is preferably 35 to 45 μL / cm 2 , more preferably 40 μL / cm 2 .

[0147] After the photoelectrochemical sensor is formed, the present invention places the photoelectrochemical sensor in a Tris-HCl buffer containing L-ascorbic acid 2-phosphate trisodium salt to perform a photocurrent test, measures the photocurrent intensity, and calculates the content of 5hmC-DNA in the sample to be tested based on the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration.

[0148] In the present invention, the concentration of L-ascorbic acid 2-phosphate trisodium salt (AALP) in the Tris-HCl buffer is preferably 100 mM, the concentration of tris in the Tris-HCl buffer is preferably 0.1 M; the pH value of the Tris-HCl buffer is preferably 7 to 7.5, more preferably 7.3.

[0149] In the present invention, the test conditions of the photocurrent intensity preferably include: a bias voltage of 0V and a switching light interval of 10s.

[0150] In the present invention, the method for obtaining the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration is the same as the method for detecting 5hmC-DNA, the only difference being that the sample to be tested is replaced by a standard sample with a known 5hmC-DNA concentration.

[0151] In the present invention, the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration is preferably represented by the logarithm of the 5hmC concentration (Log C) as the abscissa and the photocurrent intensity as the ordinate.

[0152] In the present invention, the method for detecting 5hmC-DNA for non-disease diagnosis purposes using the photoelectrochemical sensor described in the above scheme is shown in the flowchart as follows: Figure 2 As shown (the conductive substrate takes ITO conductive glass as an example).

[0153] The present invention constructs a photoelectrochemical analysis strategy of the ternary heterojunction photocatalyst Cu2O@CuO@Ag, utilizes the signal conversion output structure (P sequence) and the catalytic medium amplification principle, realizes the double amplification of the photoelectrochemical response signal, and thus improves the detection sensitivity.

[0154] Example 1

[0155] Step 1: Construction of signal transduction elements based on azidated 5hmC-DNA targets

[0156] 1) 5hmC-DNA target azide-glucose transfer treatment: 5hmC labeling reaction was carried out in a 30μL solution consisting of 9μL 1×NE buffer, 1μL 200nMUDP-6-N3-Glu, 20μL 2μM 5hmC-DNA and 0.1μL 20U / mL T4-β-GT, and reacted at 37°C for 2h. Subsequently, a DNA purification kit was used to remove UDP-6-N3-Glu and enzyme. 20μL DBCO-modified primer (Yc) was added to the azide-labeled 5hmC solution, and a click chemistry reaction was performed, which was incubated at 37°C for 24h to form 5hmC-Yc.

[0157] 2) Preparation of Y-shaped scaffold: Mix Ya, Yb and 5hmC-Yc at equal concentrations (all 5 μM before mixing), take 35 μL of each, and perform hybridization reaction at 37°C for 2 h to prepare a Y-shaped scaffold. Subsequently, add 100 μL H1 (5 μM) and 100 μL H2 (5 μM), react at 37°C for 2 h, and assemble to form a hairpin-containing Y-shaped scaffold.

[0158] Output of signal conversion element: 100 μL of 5 μM S1 was added to 100 μL of hairpin-containing Y-shaped scaffold, and the strand displacement reaction was carried out at 37°C for 2 h. Subsequently, a mixture containing 0.4 μL KF DNA polymerase (100 U / mL), 5 μL 500 μM deoxynucleotide triphosphate (dNTP) and 2.5 μL Nt.BbvCI (500 U / mL) was incubated at 37°C for 2 h to produce a large amount of signal recognition-conversion element P sequence, and then inactivated at 80°C for 20 min to obtain the resulting P solution for the next step.

[0159] Step 2: Design of photoelectrochemical sensor based on Cu2O@CuO@Ag composite

[0160] 1) Preparation of Cu2O: First, 0.375g CuSO4·5H2O was added to 80mL of 0.5mM anhydrous sodium citrate to form a light blue solution under vigorous stirring. Then, 20mL of 1.25M NaOH was added to the above solution to obtain a dark blue suspension. Subsequently, 50mL of 0.03M ascorbic acid solution was added dropwise to the suspension and stirred at a constant speed for 30min. After standing for 1h, the suspension was centrifuged to obtain brick-red particles, which were washed three times with deionized water and anhydrous ethanol respectively. Finally, the particles were dried in a vacuum oven at 60°C overnight.

[0161] 2) Preparation of Cu2O@CuO: 100 mg of freshly prepared Cu2O was dispersed in 50 mL of deionized water, and then 50 mg of potassium nitrate was dissolved in the above suspension under vigorous stirring for 1 h. The precipitate was collected by centrifugation and washed three times with deionized water and anhydrous ethanol. Subsequently, it was vacuum dried at 60 °C overnight to obtain a dark red powder.

[0162] 3) Preparation of Cu2O@CuO@Ag: 100 mg of Cu2O@CuO was dispersed in 100 mL of a mixture solution of deionized water and anhydrous ethanol in a volume ratio of 1:1 under ultrasound. Then, 157.4 μL AgNO3 solution (0.1 g / mL) was added to the above suspension, and the added Ag and Cu2O@CuO were about 10%. The mixed solution was transferred to a photoreactor, and a 300 W Xe lamp was used as the light source. The reaction temperature was kept at about 15 °C by circulating water during the whole process, and the irradiation reaction was started under stirring for 1 hour. Finally, the precipitate was collected by centrifugation, washed and dried in a vacuum oven at 60 °C overnight. Finally, the Cu2O@CuO@Ag brown powder was obtained after grinding (SEM picture as shown in Figure 3 As shown, it can be seen that Ag is located on the surface of Cu2O@CuO).

[0163] Step 3: Assembly of photoelectrochemical sensor based on ternary heterojunction photocatalyst Cu2O@CuO@Ag composite

[0164] 1) Ultrasonic clean the ITO conductive glass with acetone, ethanol and deionized water for 10 min in sequence, dry in nitrogen, and fix the electrode with insulating tape to a conductive area of ​​5 mm×5 mm. Weigh 2 mg of Cu2O@CuO@Ag powder and ultrasonically disperse it in 1 mL of ultrapure water to obtain a 2 mg / mL Cu2O@CuO@Ag suspension. Take 10 μL of the Cu2O@CuO@Ag suspension and drop it onto the surface of the ITO electrode. After drying at room temperature, place the electrode in a muffle furnace and calcine at 180 °C for 40 min to obtain an ITO electrode covered with a Cu2O@CuO@Ag film. Apply 6 μL of MES buffer (containing 2 mg / mL EDC and 50 mM NHS, pH 5.5) to the electrode surface for activation for 2 h.

[0165] 2) Use 10 μL 0.1 mM ethanethiol (HT) for 40 min to block nonspecific adsorption. Heat H3 (1 μM) at 95°C for 10 min and incubate at 0.1°C·s -1 The electrode was cooled to 37°C at a rate of 1 μM to form a hairpin structure. Subsequently, 10 μL H3 (1 μM) was added to the electrode (Cu2O@CuO@Ag / ITO) and hybridized at 37°C for 1.5 h to form H3 / Cu2O@CuO@Ag / ITO. Subsequently, 10 μL P solution was added and incubated at 37°C for 1.5 h to form P / H3 / Cu2O@CuO@Ag / ITO. 10 μL 1 μM ALP-H4 solution was added to P / H3 / Cu2O@CuO@Ag / ITO and incubated at 37°C for 1.5 h, followed by the addition of 10 μL Tris buffer (pH 7.4) containing 100 mM L-ascorbic acid-2-trisodium phosphate (ALP) to prepare the photoelectrochemical sensor (PEC) used in the experiment.

[0166] The electrochemical impedance was measured using a CHI660E electrochemical workstation, using a three-electrode system, with an ITO electrode as the working electrode (different substances were fixed on the ITO surface to form a working electrode), a platinum wire electrode as the counter electrode, and Ag / AgCl as the reference electrode. The electrochemical impedance was measured in a 5 mM K3Fe(CN)6 / K4Fe(CN)6 solution containing 0.1 M KCl, with a frequency range of 5×10 -2 Up to 1×10 6 Hz, the open circuit voltage amplitude is 10mV. Figure 6 shown. Figure 6 In the figure, a is ITO; b is Cu2O@CuO@Ag / ITO; c is H3 / Cu2O@CuO@Ag / ITO; d is HT / H3 / Cu2O@CuO@Ag / ITO; e is P / HT / H3 / Cu2O@CuO@Ag / ITO; and f is H4 / P / HT / H3 / Cu2O@CuO@Ag / ITO. Figure 6 It can be seen that the resistance (Ret) of the blank ITO electrode (curve a) is relatively small. When Cu2O@CuO@Ag is fixed on the electrode surface (curve b), Ret increases significantly. Subsequently, H3, HT, P, and H4 are added in sequence, and Ret gradually increases (curve cf), indicating that the sensor is successfully prepared.

[0167] PEC was measured in 15 mL of 0.1 M Tris-HCl buffer (containing 100 mM L-ascorbic acid 2-phosphate trisodium salt (AAP)) with a bias voltage of 0 V and an on-off light interval of 10 s.

[0168] The photocurrent intensity of 5hmC-DNA with different known concentrations was tested according to the above test method. The results are shown in Figure 4 , the standard curve is shown in Figure 5 . Figure 4 In the figure, the 5hmC concentrations of curves a to j are 1 μM, 100 nM, 10 nM, 1 nM, 100 pM, 10 pM, 1 pM, 100 fM, 10 fM and 1 fM, respectively. Figure 4 It can be seen that as the 5hmC concentration decreases from 1μM to 1fM, the ECL intensity gradually decreases (curve a to curve g); the standard curve shows that there is a linear relationship between the ECL intensity (I) and the logarithm of the 5hmC concentration (Log C), and the linear regression equation is expressed as I=0.12LogC+2.24, and the detection limit is 0.42fM (S / N=3).

[0169] Specificity experiments:

[0170] The target 5hmC-DNA in the above experiment was replaced with 5mC-DNA and C-DNA, wherein the nucleotide sequence of CDNA is as shown in SEQ ID NO.9, specifically: CGGATGTTGTGGGTCAGC GCATCATACTCTA, the nucleotide sequence of 5hmC-DNA is to replace the bold C at position 18 with 5hmC; the nucleotide sequence of 5mC-DNA is to replace the bold C at position 18 with 5mC; the rest of the detection steps remain unchanged. The experimental results are shown in Figure 7 As shown. Figure 7 It can be seen that in the azide DNA process, 100nM 5hmC-DNA was replaced by different DNAs (5mC-DNA, C-DNA) of the same concentration. The electrode preparation and detection steps were kept consistent to ensure comparable experimental conditions. By comparing the photocurrent values ​​of different DNAs on the electrode, the selectivity of the detection method for different DNA molecules can be evaluated. Figure 7As shown, the photocurrents of 5hmC-DNA and mixed substances (containing 100nM 5hmC-DNA, 100nM5mC-DNA and 100nM DNA at the same time) were significantly higher than those of other DNAs, indicating that this method has good detection selectivity for 5hmC-DNA (Note: no substance was added to the blank group).

[0171] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A kit for 5hmC-DNA pretreatment, characterized in that: The invention comprises NE buffer, uridine diphosphate-6-azido-glucose solution, T4 bacteriophage β-glucose transferase, DBCO-modified primer Yc, DNA chain Ya, DNA chain Yb, DNA chain H1, DNA chain H2, DNA chain S1, deoxynucleotide triphosphate solution, DNA polymerase and nicking endonuclease; The nucleotide sequence of the primer Yc is shown in SEQ ID NO.1; The nucleotide sequence of the DNA chain Ya is shown in SEQ ID NO.2; The nucleotide sequence of the DNA chain Yb is shown in SEQ ID NO.3; The nucleotide sequence of the DNA chain H1 is shown in SEQ ID NO.4; The nucleotide sequence of the DNA chain H2 is shown in SEQ ID NO.5; The nucleotide sequence of the DNA chain S1 is shown in SEQ ID NO.

6.

2. A 5hmC-DNA pretreatment method, characterized in that: Using the kit according to claim 1 to treat 5hmC-DNA comprises the following steps: NE buffer, uridine diphosphate-6-azido-glucose solution, T4 bacteriophage β-glucose transferase and the 5hmC-DNA sample to be treated are mixed, and the resulting mixture is subjected to an azidation reaction at 37°C to obtain an azidation-labeled 5hmC solution; The azide-labeled 5hmC solution was mixed with the DBCO-modified primer Yc, and a click chemistry reaction was performed at 37° C. to obtain 5hmC-Yc; The 5hmC-Yc, DNA chain Ya and DNA chain Yb are mixed and hybridized at 37° C. to obtain a Y-shaped scaffold; The Y-shaped scaffold is mixed with DNA strand H1 and DNA strand H2, and assembled at 37° C. to form a hairpin-containing Y-shaped scaffold; The hairpin-containing Y-shaped scaffold was mixed with DNA chain S1, and a chain displacement reaction was performed at 37°C. The obtained reaction solution was mixed with deoxynucleotide triphosphate, DNA polymerase and nicking endonuclease, and a first incubation was performed at 37°C.

3. The pre-treatment method according to claim 2, characterized in that: The molar ratio of 5hmC-Yc, DNA chain Ya and DNA chain Yb is 1:1:1; The molar ratio of the Y-shaped support to the DNA chain H1 and the DNA chain H2 is 1:1:

1.

4. A photoelectrochemical sensor for detecting 5hmC-DNA, characterized in that: It includes a base electrode loaded with a Cu2O@CuO@Ag layer, a DNA chain H3 modified with NH3, ethanethiol, and the ALP-H4 solution of the kit according to claim 1; The nucleotide sequence of the DNA chain H3 is shown in SEQ ID NO.7; The ALP-H4 in the ALP-H4 solution is Biotin-H4-Biotin, wherein the nucleotide sequence of H4 is shown as SEQ ID NO.

8.

5. The photoelectrochemical sensor according to claim 4, characterized in that The preparation method of the substrate electrode loaded with the Cu2O@CuO@Ag layer comprises: dispersing Cu2O@CuO@Ag in water to obtain a Cu2O@CuO@Ag suspension; dropping the Cu2O@CuO@Ag suspension onto the surface of a conductive substrate, drying and calcining the suspension to obtain a substrate electrode loaded with the Cu2O@CuO@Ag layer.

6. The photoelectrochemical sensor according to claim 4, characterized in that Also included are MES buffer and Tris buffer; The MES buffer contains 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide; The Tris buffer contains trisodium L-ascorbic acid-2-phosphate.

7. A method for detecting 5hmC-DNA for non-disease diagnosis purposes using the photoelectrochemical sensor according to any one of claims 4 to 6, characterized in that: The following steps are involved: The NH3-modified DNA chain H3 is heated and then cooled to form a hairpin structure H3; Add H3 with a hairpin structure to the surface of the substrate electrode loaded with the Cu2O@CuO@Ag layer to combine and form H3 / Cu2O@CuO@Ag / conductive substrate; Ethyl mercaptan is added to the surface of the H3 / Cu2O@CuO@Ag / conductive substrate for a second incubation to form a HT layer, thereby obtaining HT / H3 / Cu2O@CuO@Ag / conductive substrate; the HT is ethyl mercaptan; Using the kit to pre-treat the sample according to the pre-treatment method of claim 2 or 3 to obtain a sequence P solution; Adding the sequence P solution to the surface of HT / H3 / Cu2O@CuO@Ag / conductive substrate, performing a third incubation to form P / HT / H3 / Cu2O@CuO@Ag / conductive substrate; ALP-H4 solution was added to the surface of P / HT / H3 / Cu2O@CuO@Ag / conductive substrate for the fourth incubation to form a photoelectrochemical sensor; The photoelectrochemical sensor is placed in a Tris-HCl buffer containing L-ascorbic acid 2-phosphate trisodium salt for photocurrent testing, and the photocurrent intensity is measured. The content of 5hmC-DNA in the sample to be tested is calculated based on the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration.

8. The method according to claim 7, characterized in that Before adding the hairpin structured H3 on the surface of the base electrode loaded with the Cu2O@CuO@Ag layer, the base electrode loaded with the Cu2O@CuO@Ag layer is activated by using MES buffer.

9. The method according to claim 7, characterized in that: After completing the fourth incubation, the method further includes adding Tris buffer to the surface of the formed ALP-H4 / P / HT / H3 / Cu2O@CuO@Ag / conductive substrate.

10. The method according to claim 7, characterized in that The temperature of the binding was 37°C and the time was 1.5 h.

Images