Application of miR-141-5P in preparation of drugs for promoting proliferation of neural stem cells

Abstract

The invention discloses an application of miR-141-5P in preparation of a medicine for promoting proliferation of neural stem cells. The method comprises the following steps: firstly, carrying out in-vitro culture on neural stem cells of cerebral cortex of E14-day pregnant rats to discover that miR-141-5P shows a remarkable reduction trend in the mature process of the neural stem cells; and then miRNA mimics of the miR-141-5P is adopted to verify that the multiplication capacity of the neural stem cells can be obviously reduced by overexpressing the miR-141-5P in the neural stem cells, which indicates that the substance for inhibiting the expression of the miR-141-5P can promote the multiplication of the neural stem cells.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of miR-141-5P in the preparation of a drug for promoting the proliferation of neural stem cells. Background Art

[0002] Neural stem cells (NSCs) are a type of cells in the central nervous system that have the potential for self-renewal and multidirectional differentiation. They play a key role in neural development, injury repair, and regenerative medicine. Recent studies have revealed the important regulatory role of miRNA in the self-renewal, differentiation, proliferation, and apoptosis of neural stem cells.

[0003] miRNA is a type of non-coding small RNA that regulates the expression of target genes by binding to their mRNAs, thereby affecting cell function. In neural stem cells, the expression patterns of miRNAs vary at different developmental stages. These differential expression patterns determine the direction and phase of cell differentiation and are key regulatory factors for the "timing" and "directional" differentiation of cells. For example, miR-140-5p regulates the proliferation and differentiation of neural stem cells by targeting Prox1 and exerts its effects through the ERK / MAPK signaling pathway. After spinal cord injury, specific miRNA expression changes are closely related to biological processes such as neuroprotection, inflammatory response, cell apoptosis, and neural regeneration. For example, miR-29 nanoparticle carriers combined with self-assembling polypeptide nanoscaffolds were implanted into the spinal cord injury area of ​​rats to explore their role in regulating endogenous neural stem cells, providing new ideas and research foundations for the development and clinical transformation of self-assembling nanopeptide microRNA sustained-release systems. In neurodegenerative diseases, changes in miRNA expression are closely related to the occurrence and development of the disease and may serve as biomarkers of the disease. For example, miRNA-21 is upregulated after spinal cord injury, which can inhibit inflammatory response and cell apoptosis, thereby playing a neuroprotective role. The miRNA in stem cell exosomes can promote cell proliferation, inhibit cell apoptosis, promote angiogenesis, etc. The role of these exosome miRNAs in repairing tissue damage, preventing and treating related diseases is being continuously studied and explored. In general, miRNA has shown great potential in the study of neural stem cells, providing new perspectives and therapeutic strategies for neural development, injury repair and regenerative medicine.

[0004] Although miR-141-5p has been studied in depth in the field of tumors, for example, in gynecological malignancies, miR-141-5p and miR-141-3p are abnormally expressed in a variety of malignant tumors by regulating different signal transduction pathways, and are involved in the proliferation, differentiation, invasion and metastasis of malignant tumors. However, there have been no reports on the effects of miR-141-5p on neural stem cells. Summary of the invention

[0005] One of the purposes of the present invention is to provide the application of miR-141-5P in screening drugs that promote the proliferation of neural stem cells.

[0006] The second purpose of the present invention is to provide the use of a substance that inhibits the expression of miR-141-5P in the preparation of a drug for promoting the proliferation of neural stem cells.

[0007] The substance that inhibits the expression of miR-141-5P is selected from one or more of compounds, proteins, polypeptides, polysaccharides, glycoproteins, glycopeptides, and nucleic acids.

[0008] In the present invention, the nucleotide sequence information of miR-141-5P is as follows:

[0009] Accession MIMAT0017128

[0010] Description rno-miR-141-5p mature miRNA

[0011] Sequence:CCAUCUUCCAGUGCAGUGUUG.

[0012] The present invention firstly cultured neural stem cells of the cerebral cortex of E14 day pregnant mice in vitro and found that miR-141-5P showed a significant decreasing trend during the maturation of neural stem cells; then miR-141-5P mimics was used to verify that overexpression of miR-141-5P in neural stem cells would significantly reduce the proliferation ability of neural stem cells, which indicates that substances that inhibit the expression of miR-141-5P can promote the proliferation of neural stem cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The expression results of miR-141-5P in the maturation process of neural stem cells cultured in vitro. Among them, A is the bright field image of neural stem cells cultured in vitro for 1-4 days; B is the result of qRT-PCR detection of the expression changes of miR-141-5P in the maturation process of neural stem cells.

[0014] Figure 2 The results show the overexpression efficiency of miR-141-5P mimics in neural stem cells.

[0015] Figure 3The results show that overexpression of miR-141-5P significantly reduced the spheroidization and proliferation ability of stem cells. A is the result of the spheroidization ability test of neural stem cells after overexpression of miR-141-5P; B is the result of EdU after overexpression of miR-141-5P; C is the result of Ki-67 immunofluorescence chemistry experiment after overexpression of miR-141-5P. DETAILED DESCRIPTION

[0016] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0017] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0018] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0019] Example 1

[0020] 1. Expression of miR-141-5P during the maturation of neural stem cells cultured in vitro

[0021] The cerebral cortex of pregnant mice on day E14 was used to culture neural stem cells in vitro for 1-4 days, and then the expression of miR-141-5P was detected. Figure 1 As shown, miR-141-5P showed a significant downward trend during the maturation of neural stem cells.

[0022] 2. Functional verification of miR-141-5P

[0023] 1. Primary culture of neural stem cells from the cerebral cortex of pregnant SD mice on day E14

[0024] This embodiment uses a series of experimental steps to isolate and culture neural stem cells from pregnant mice on embryonic day 14 (E14d). First, the pregnant mice were anesthetized by ether and killed after cervical dislocation, followed by disinfection with 75% alcohol. Under sterile conditions, the fetuses were quickly transferred to the cell culture room, taken out and placed in a large dish on ice, the amniotic membrane was broken, the fetuses were taken out, and their brains were placed in Hanks dissection solution for cleaning. Under a stereomicroscope, the cerebral cortex was accurately located and separated, the membrane was gently peeled off and non-target tissues such as the hippocampus were removed. Subsequently, the separated cerebral cortex (from 5 fetal mice) was placed in a culture dish containing 3mL of complete medium for neural stem cells. Use a 1mL pipette to gently blow to ensure that the tissue is fully dispersed and filter through a 200-mesh sieve to remove any bulk tissue. The filtered suspension was transferred to a centrifuge tube and further blown to promote the dispersion of the cells.

[0025] For the P1 generation, the inventors observed that the cell clusters began to form within 24 hours and developed into regular round spherical structures (about 100-150 microns in diameter) within 2-3 days. The cell clusters were successfully dispersed into single cells by precipitation, centrifugation at 1000rpm for 3 minutes, removal of the supernatant, addition of digestion solution and digestion at 37°C for 7-8 minutes. Use a 1mL pipette to gently blow until the cell balls are completely dispersed. Subsequently, 4mL of complete medium was added to terminate the digestion, and the cells were collected by centrifugation at 1200rpm for 5 minutes. After discarding the supernatant, 2mL of complete medium was added to resuspend the cells and counted.

[0026] 6 × 10 were planted in each dish. 6 cells, and the total volume of the culture medium was 8 mL. During the culture process, the culture dish was shaken every morning and evening to prevent the cells from adhering to the wall and differentiating. For the P2-4 passages, a similar procedure was used, including removal of the supernatant, centrifugation, digestion, pipetting, and resuspension. 6×10 cells were planted in each culture dish. 6 cells in a total volume of 8 mL of culture medium.

[0027] 2. Electrotransfection of Ctrl / miR-141-5P mimics into P2 neural stem cells at E14

[0028] First, the neural stem cell spheres cultured to P2 were converted into single cell suspensions through a digestion process and the cells were counted. Then, an appropriate amount of cells were pipetted and mixed with miRNAmimics to ensure that the final concentration of the mixed solution reached 3.0×10 per 100 μL. 6 Specifically, the volume of cells was 90 μL, while the volume of miRNA mimics was 10 μL.

[0029] In the selection of miRNA mimics, mimics targeting miR-141-5P were used, and its sense strand sequence was UCCAUCUUCCAGUGCAGUGUUG, and its antisense strand sequence was ACACUGCACUGGAAGAUGGAUU. As a control, Ctrl mimics were used, and its sense strand sequence was UUCUCCGAACGUGUCACGUTT, and its antisense strand sequence was ACGUGACACGUUCGGAGAATT.

[0030] The mixed cells and miRNA mimics solution were thoroughly mixed to ensure uniform distribution between cells and mimics. Next, the neural stem cells were electroporated according to the operating instructions of the NEPA21 electroporation system. The specific operation steps included setting the electroporation parameters (150V, 5ms) to optimize the transfection efficiency and reduce cell damage.

[0031] 3. Extraction of RNA from Neural Stem Cells

[0032] After electroporation of miRNA mimics, the neural stem cells were further cultured for 48 hours to ensure that the miRNA mimics could be effectively absorbed by the cells and exert their effects. Subsequently, the RNA extraction process was carried out according to the instructions of the Micro-Tissue Cell RNA Extraction Kit (Single Column Method) (Cat. No.: R4012-02).

[0033] First, the number of cells was counted and RTL Lysis Buffer / β-ME was added to the cell sample to break up and lyse the cells. Next, an equal volume of RNA Binding Buffer was added to the homogenate or supernatant and pipetted 3 to 5 times or vortexed for 15 seconds to ensure that the cell lysate and RNA binding buffer were fully mixed.

[0034] Then, HiPure RNA Mini Column I was installed in a 2 mL collection tube, and the entire mixture (including the precipitate) was transferred to the column. We performed centrifugation at 8,000 × g for 30 seconds to collect the RNA on the column.

[0035] Next, the filtrate was discarded and the column was reinstalled in the collection tube. 500 μL of Buffer RW1 was added to the column and allowed to stand for 3 minutes to allow RNA to bind to the column. After that, centrifugation was performed again at 8,000 × g for 30 seconds.

[0036] To remove DNA and other impurities, the filtrate was discarded and the column was reinstalled in the collection tube. 500 μL of Buffer RW2 (diluted with ethanol) was added to the column and centrifuged at 8,000 × g for 30 seconds. This step was repeated twice to ensure thorough washing.

[0037] After the wash step was completed, the flow-through was discarded and the column was replaced in the collection tube. The column was dried by centrifugation at 10,000 × g for 3 minutes.

[0038] Finally, the column was transferred to a 1.5 mL centrifuge tube and 15 to 30 μL of RNase Free Water was added to the center of the column membrane. After standing for 1 minute, the column was centrifuged at 10,000 × g for 1 minute to elute the RNA. After this step, the RNA column was discarded, the OD value and concentration of the RNA were tested, and the extracted RNA was then stored at -80 ° C for subsequent experiments.

[0039] 4. Reverse transcription of miRNA

[0040] Using the miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) reverse transcription kit (Vazyme MR101-01), 500 ng of RNA was reverse transcribed into cDNA according to the miR-141-5P specific primer (sequence: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAACAC-3'), and the internal reference was U6. Operate on ice, each reaction system is 20 μL, as follows:

[0041] Reagents Usage 5×gDNA wiper Mix 2μL 10×RT Mix 2μL HiScript II Enzyme Mix 2μL miR-141-5P specific primers 1μL Total RNA 500ng <![CDATA[RNase-free H2O]]> up to 20μL

[0042] The reaction program was: 25°C for 5 min, 50°C for 15 min, 85°C for 5 sec, and 4°C for ∞.

[0043] 5. Real-time quantitative PCR (qRT-PCR)

[0044] The miR-141-5P qRT-PCR primer sequence was designed according to the primer design principles. The sequence is as follows:

[0045] miR-141-5P-F:5'-GCGTCCATCTTCCAGTGCA-3'

[0046] miR-141-5P-R:5'-AGTGCAGGGTCCGAGGTATT-3'.

[0047] The cDNA obtained by reverse transcription was subjected to the following qRT-PCR reaction, with U6 as the internal reference.

[0048] (1) Prepare qRT-PCR reaction solution according to the following components:

[0049] Reagents Usage 2×AceQ qPCR SYBR Green Master Mix(Without ROX) 5μL Primer F (10 μM) 0.5μL Primer R (10μM) 0.5μL cDNA 1μL <![CDATA[RNase-free H2O]]> 3μL Total 10μL

[0050] (2) The reaction solution was mixed and the reaction program of the real-time PCR instrument was as follows: pre-denaturation, 95°C for 30 seconds; denaturation, 95°C for 5 seconds, annealing and extension, 60°C for 30 seconds; 40 cycles; melting curve stage: 95°C for 15 seconds, 60°C for 60 seconds, and 95°C for 15 seconds.

[0051] The results are as follows Figure 2 As shown, miR-141-5P mimics treatment for 48 hours can significantly increase the expression of miR-141-5P in nerves.

[0052] 6. Detection of the self-renewal ability of neural stem cells

[0053] (1) EdU experiment

[0054] First, the 96-well plate was coated with 2×PLL solution at 4°C overnight, then washed three times with sterile ddH2O and sterilized under UV for 15-20 minutes to ensure the sterility of the experimental environment. Next, a 2× EdU working solution was prepared, and EdU (10mM) was diluted at a ratio of 1:500 in cell culture medium preheated to 37°C to obtain a 20μM 2×EdU working solution. Subsequently, this working solution was mixed with an equal volume of culture medium and added to a 96-well plate to a final concentration of EdU of 1×. 48 hours after mimics transfection, SD rat E14 cortical neural stem cells were digested into single cells and seeded in 24-well plates with 8×10 3cells. Then, add complete medium containing 1×EdU to the neural stem cells and continue to incubate the cells at 37°C and 5% CO2 for 6 hours. After EdU labeling, remove the culture medium and add 1ml of 4% PFA fixative to fix the cells at room temperature for 15 minutes. After fixation, wash the cells 3 times with 1ml of washing solution for 5 minutes each time to remove the fixative. Subsequently, remove the washing solution and add 1ml of PBS permeabilization solution containing 0.3% Triton X-100 to each well and incubate at room temperature for 15 minutes to enhance the permeability of the cell membrane. After permeabilization, wash the cells again with washing solution 1-2 times for 5 minutes each time. Next, prepare the Click Additive Solution according to the instructions of the kit and add 50μl of the reaction mixture to each well of the 96-well reaction system. Then, remove the washing solution, add 50μl of Click reaction solution to each well, and gently shake the culture plate to ensure that the reaction mixture evenly covers the sample. After that, incubate at room temperature in the dark for 30 minutes. After incubation, remove the Click reaction solution and wash 3 times with washing solution for 5 minutes each time. Next, the nuclei were stained by treating the cells with 1×Hoechst33342 solution (diluted with PBS at a ratio of 1:1000) and incubating at room temperature in the dark for 10 minutes. After staining, the cells were washed again with washing solution 3 times, 5 minutes each time. Finally, a Leica microscope was used for photography, and 42 images were taken for each group. After the experiment, the positive signals were analyzed using Image J software, and statistical analysis was performed using GraphPad software to evaluate the results of the EdU experiment.

[0055] (2) Immunofluorescence (IF)

[0056] The cultured cells were fixed with 4% PFA at 37°C for 20 min, washed 3 times with PBS, and blocked with 10% goat serum containing 10 mg / mL bovine serum albumin for 60 min. Then they were incubated with primary antibody anti-Ki67 (1:250, Abcam ab16667) at 4°C overnight. The next day, the cells were rewarmed for 10 min, the primary antibody was discarded, and the cells were washed 3 times with PBS. Then, the cells were incubated with the corresponding species-specific fluorescent conjugated secondary antibody Cy3-conjugated goat anti-rabbit IgG (HL) [1:400, Jackson ImmunoResarch Laboratories 111-165-003]) at room temperature in the dark for 2 h. The cells were stained with Hoechst 33342 (1:1000, Beyotime Biotechnology, Cat: C1022), incubated at room temperature in the dark for 15 min, and then washed with PBS. Fluorescence images were obtained using a fluorescence inverted microscope (Leica).

[0057] The results are as follows Figure 3As shown in Figure 2, overexpression of miR-141-5P in neural stem cells significantly reduced the sphere-forming ability of neural stem cells ( Figure 3 A). The results of EdU experiment and Ki-67 immunofluorescence chemistry experiment showed that overexpression of miR-141-5P significantly reduced the proliferation capacity of neural stem cells ( Figure 3 Chinese BC).

Claims

1. Application of miR-141-5P in screening drugs that promote the proliferation of neural stem cells.

2. Application of substances that inhibit the expression of miR-141-5P in the preparation of drugs for promoting the proliferation of neural stem cells.

3. The use according to claim 2, characterized in that: The substance that inhibits the expression of miR-141-5P is selected from one or more of compounds, proteins, polypeptides, polysaccharides, glycoproteins, glycopeptides, and nucleic acids.

Images