Fusarium sp. And application thereof in promoting blueberry growth

Abstract

The invention relates to the technical field of microorganisms, in particular to fusarium and application thereof in promoting blueberry growth. The fusarium is classified and named as Fusarium sp., the strain number of the fusarium is NX1, the fusarium is preserved in the China General Microbiological Culture Collection Center on June 26, 2024, and the preservation number of the fusarium is CGMCC No. 41384. The strain has the capability of obviously promoting the growth of blueberries, and can be cooperated with Alternaria alternata sp.CS9 to further promote the growth of blueberry seedlings, so that an ideal strain resource is provided for developing efficient biological fertilizers or microbial preparations.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a Fusarium strain and application thereof in promoting the growth of blueberries. Background Art

[0002] In recent years, a large amount of pesticides and fertilizers have been used in blueberry cultivation to increase fruit quality and yield, which will cause pollution to soil and water quality. Therefore, developing new technologies to apply to blueberry cultivation to replace or reduce the use of pesticides and fertilizers has become an important exploration for scientific researchers. As the main organ for plants to absorb nutrients and water, the root system plays a vital role in the growth and development of plants. Under natural conditions, the blueberry root system can coexist with mycorrhizal fungi to form a mycorrhizal structure, enhance its own stress resistance and promote plant growth.

[0003] Blueberry is a perennial shrub belonging to the genus Vaccinium Linn. of the family Ericaceae. Blueberry fruit is delicious and has a unique flavor. It is widely welcomed in the fruit market because it contains antioxidant substances such as anthocyanins and flavonoids, and has become one of the most popular fruits. Blueberry roots have no root hairs, and can coexist with mycorrhizal fungi in the natural environment, thereby replacing the role of root hairs. Therefore, the symbiosis of mycorrhizal fungi is particularly important for the growth of blueberries. At present, excellent growth-promoting fungi are still in short supply in the production of blueberries in my country. Screening of blueberry efficient growth-promoting fungi with application potential can provide a bacterial source for the development of efficient blueberry biological fertilizers or bacterial agents, promote efficient blueberry cultivation, thereby reducing the use of chemical fertilizers and pesticides in production and developing sustainable agriculture. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a strain of Fusarium spp. in view of the deficiencies of the prior art.

[0005] The technical problem that the present invention also aims to solve is to provide the application of the above-mentioned Fusarium in promoting the growth of blueberries.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0007] A strain of Fusarium, classified and named Fusarium sp., with strain number NX1, was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on June 26, 2024, with the deposit number CGMCC No.41384, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] Among them, by sequencing the ITS region of Fusarium, it was found that the nucleotide sequence of its ITS sequence is shown in SEQ ID No.1.

[0009] After the above-mentioned Fusarium was cultured on PDA medium at 28°C for 5 days, its morphology was observed, and it was found that the strain had a diameter of 30-33 mm and a normal growth rate; it was pure white; the hyphae were dense, radially spreading outward, and had a wooly texture; no exudate was produced, and no soluble pigment was produced.

[0010] The microscopic morphology of the Fusarium was observed under a microscope and it was found that the hyphae of Fusarium NX1 were colorless, relatively thick, 4 to 6 μm wide, and the conidia were sickle-shaped, growing in clusters at the top of branched hyphae, and were 8 to 11 μm long.

[0011] A microbial agent, which contains the above-mentioned Fusarium, or a product obtained by inoculating and fermenting the above-mentioned Fusarium.

[0012] The use of the above-mentioned Fusarium or the above-mentioned microbial agent in the preparation of a product promoting blueberry growth is also within the scope of protection of the present invention.

[0013] Specifically, the product includes fertilizers and / or growth regulators.

[0014] The use of the above-mentioned Fusarium or the above-mentioned microbial agent in promoting the growth of blueberries is also within the scope of protection of the present invention.

[0015] The promotion of blueberry growth is specifically manifested in the increase of any one or several of tree growth indexes, biomass indexes, and mycorrhizal indexes.

[0016] Specifically, the tree growth index includes any one or a combination of plant height, crown width, ground diameter, and number of basal branches.

[0017] Specifically, the biomass includes any one or a combination of above-ground fresh weight, underground fresh weight, above-ground dry weight, underground dry weight, whole plant fresh weight, and whole plant dry weight.

[0018] Specifically, the mycorrhizal index includes any one or a combination of several of the following: root length, root surface area, number of root tips, and number of root crossings.

[0019] In some embodiments of the present invention, the Fusarium can significantly increase the plant height, ground diameter, crown width, number of basal branches, biomass (above ground fresh weight, below ground fresh weight, above ground dry weight, below ground dry weight, whole plant dry weight, whole plant dry weight), root length, root surface area, number of root tips, and number of root crossings of blueberry seedlings.

[0020] The application of Fusarium and Alternaria in synergistically promoting the growth of blueberries is also within the scope of protection of the present invention.

[0021] Among them, the alternaria sp. is classified and named Alternaria sp., with the strain number CS9. The strain was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on June 26, 2024, with the deposit number CGMCC No. 41385, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0022] A method for promoting the growth of blueberries, comprising applying a mycelium block containing the Fusarium according to claim 1 to the rhizosphere of blueberries, thereby promoting the growth of blueberries.

[0023] Among them, the blueberry, including but not limited to the matrix-cultivated blueberry seedlings described in the embodiment of the present invention, the blueberry that meets the symbiosis with Fusarium NX1 in the prior art, or the blueberry that is symbiotic with Fusarium NX1 and Alternaria CS9 are all suitable for the present invention.

[0024] Wherein, the application amount is 2 to 4 mycelium blocks per plant.

[0025] Specifically, the mycelium block has a diameter of 4 to 6 mm.

[0026] Beneficial effects:

[0027] The present invention isolates a blueberry growth-promoting Fusarium sp. NX1 from the blueberry root system. The Fusarium sp. NX1 has the ability to significantly promote the growth of blueberry seedlings, and can significantly increase the plant height, ground diameter, crown width, number of basal branches, biomass of underground and aboveground parts, and root length of blueberry plants. At the same time, it can work together with another Alternaria sp. CS9 isolated from the blueberry root system to efficiently promote the growth of blueberry seedlings, providing a bacterial source for the development of efficient biological bacterial fertilizers or bacterial agents for blueberries. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The present invention will be further described in detail below with reference to the accompanying drawings, and the above and / or other advantages of the present invention will become more clear.

[0029] Figure 1 This is the colony morphology of the NX1 strain after being cultured on PDA medium at 28°C for 5 days.

[0030] Figure 2 This is the microstructural morphology of the NX1 strain.

[0031] Figure 3 This is the colony morphology of the CS9 strain after growing on PDA medium for 5 days.

[0032] Figure 4 This is the microstructural morphology of the CS9 strain.

[0033] Figure 5 This is the overall appearance of the blueberry tissue culture seedlings after inoculation with NX1. In the figure: a1, a2, a3, a4, a5, a6, a7, a8 represent blueberry tissue culture seedlings inoculated with NX1; b1, b2, b3, b4, b5, b6, b7, b8 represent blueberry tissue culture seedlings not inoculated with NX1, and c1, c2, c3, c4, c5, c6, c7, c8 represent blueberry tissue culture seedlings inoculated with NX1 and CS9.

[0034] Figure 6 This is a scanning analysis of the root system of blueberry tissue culture seedlings after inoculation with NX1. In the figure, a1, a2, a3, a4 represent blueberry tissue culture seedlings inoculated with NX1, b1, b2, b3, b4 represent blueberry tissue culture seedlings not inoculated with NX1, and c1, c2, c3, c4 represent blueberry tissue culture seedlings inoculated with NX1 and CS9. DETAILED DESCRIPTION

[0035] The present invention will be further described in detail below in conjunction with specific implementations, and the above and / or other advantages of the present invention will become more clear.

[0036] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0037] Collection information:

[0038] (1) A strain of Fusarium sp., classified and named as Fusarium sp., with strain number NX1, was deposited in the General Microbiological Center of China Microorganism Culture Collection on June 26, 2024, with the deposit number CGMCC No.41384, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0039] (2) A strain of Alternaria sp., classified and named as Alternaria sp., with strain number CS9, was deposited in the General Microbiological Center of China Microorganism Culture Collection on June 26, 2024, with the deposit number CGMCC No.41385, and the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0040] Example 1: Isolation and identification of blueberry mycorrhizal fungus NX1

[0041] 1. Isolation and purification of blueberry growth-promoting mycorrhizal fungus NX1

[0042] The blueberry plant "Brilliant" was obtained from Nanxiang Berry Garden in Lishui District, Nanjing City, Jiangsu Province. Under a sterile environment, the blueberry roots washed with clean water were disinfected with 75% ethanol for 2 minutes, rinsed with sterile water 5 times, disinfected with 1% sodium hypochlorite solution for 10 minutes, rinsed with sterile water 5 times, and then the surface moisture of the roots was sucked dry to obtain the disinfected young blueberry roots.

[0043] The sterilized young blueberry roots were cut into root segments of about 1.5 cm in length, inoculated onto PDA flat culture medium, and placed in a constant temperature incubator at 28°C in the dark. When hyphae grew out on the cross section of the root segment, the tip of the fungal hyphae was picked up with a sterile inoculation needle and transferred to a new PDA flat culture medium. After multiple purification and culture, a single strain was obtained on May 27, 2022. Finally, the purified strain was inoculated onto the PDA slant culture medium and stored at 4°C.

[0044] Among them, the PDA culture medium, its 1LPDA preparation process is as follows: peel 200g of potatoes and cut them into small pieces with a side length of 2cm, add 1000mL of distilled water, heat and boil on an induction cooker and keep it for 20min, filter with four layers of gauze to obtain the filtrate, add 20g of agar, pH natural; sterilize at 121℃ for 20min, and set aside.

[0045] 2. Morphological observation of mycorrhizal fungi

[0046] (1) Apparent morphology: Take a 5 mm long isolated and purified fungus NX1 block, invert it on a PDA culture medium plate, culture it at 28°C for 5 days, and take pictures to record the apparent morphology of the fungus. Figure 1 As shown, the strain has a diameter of 30 to 33 mm and a normal growth rate; it is pure white; the hyphae are dense, spreading radially outward, and have a wooly texture; no exudate is produced and no soluble pigment is produced.

[0047] (2) Microscopic morphology: The fungus NX1 cultured in a 28°C constant temperature incubator for 3 to 5 days was observed under a microscope, and the microscopic characteristics of the fungus NX1, such as hyphae, spore size, and spore morphology, were recorded. Figure 2 As shown, the hyphae of fungus NX1 are colorless, thick, 4 to 6 μm wide, and its conidia are sickle-shaped, large in size, growing in clusters at the top of branched hyphae, and 8 to 11 μm long.

[0048] 3. Molecular Biology Identification

[0049] According to the instructions of the fungal DNA extraction kit of Yisheng Biological Company, the DNA of fungus NX1 was extracted, and the DNA concentration was detected by Nanodrop micro-nucleic acid analyzer. The total DNA of the strain that met the concentration requirements was used as a template to amplify the ITS sequence. The universal fungal primers ITS1 and ITS4 were used for PCR amplification.

[0050] Among them, primer ITS1: 5′-TCCGTAGGTGAACCTGCGG-3′;

[0051] Primer ITS4: 5′-TCCTCCGCTTATTGATATGC-3′.

[0052] The PCR reaction system was as follows: template DNA 2 μL, primer ITS1 (10 μM) 2 μL, primer ITS4 (10 μM) 2 μL, 2× PCR Master Mix 25μL, ddH2O to make up to 50μL.

[0053] The PCR reaction conditions were: 94°C for 5 min; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 10 min.

[0054] The quality of the target product obtained by PCR amplification was detected by 1.0% agarose gel electrophoresis, and the target product was sequenced. The synthesis of ITS primers and the sequencing of PCR products were completed by Nanjing Qingke Biological Co., Ltd. The sequence results obtained by sequencing were compared using the BLAST tool of NCBI. The results showed that the strain NX1 had the highest similarity with Fusarium sp. (OP727399.1), which was 99.42%. The specific nucleotide sequence of the ITS sequence (5'-3') measured by the strain NX1 is shown in SEQ ID NO.1.

[0055] SEQ ID NO.1:

[0056] ACACGAGCTACACTCCCACCCCTGTGACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAAC CATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC GCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGGCGTTCCTCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGT AAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCTAAAAGGGGGAAGAAACCAACAAAAAAAA

[0057] In summary, through morphological and ITS sequence comparison comprehensive identification, it was found that the present invention isolated a Fusarium sp. strain from the blueberry root system and named it NX1. The identified fungus was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on June 26, 2024, and was classified and named Fusarium sp., with a strain number of NX1 and a deposit number of CGMCC No.41384. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0058] Example 2: Blueberry growth promotion test

[0059] 1. Preparation of experimental materials: The plant material is the blueberry tissue culture seedling "Emerald". The blueberry tissue culture seedling "Emerald" was planted in a sterilized cultivation medium and used for strain inoculation after 10 days of acclimatization.

[0060] The cultivation medium was purchased from Jiangsu Xingnong Matrix Technology Co., Ltd. The medium is mainly made of imported peat, with a small amount of coconut bran and perlite added. The basic physical and chemical properties are: pH 4.5-5.5, EC value <0.1mS / cm, total pore density 75%, air-water ratio 1:2-3, and dry bulk density 0.2g / cm.

[0061] 2. Fungus inoculation into blueberry tissue culture seedlings: In the nutrient pot planted with blueberry tissue culture seedlings, dig three holes in three directions near the root with the root as the center, inject 5 mL of unsolidified PDA culture medium into each hole, use a hole puncher to take 5 mm diameter mycelium blocks on the plates of fungus NX1 and fungus CS9, and inoculate fungus NX1, fungus CS9, fungus NX1 and fungus CS9 (when fungus NX1 and fungus CS9 are inoculated together, half a fungal mycelium block is inoculated in each hole to ensure that the number of inoculated mycelium blocks is consistent) into the holes. The control group was only injected with PDA culture medium in the hole without inoculation of mycelium blocks.

[0062] Among them, the fungus CS9 was isolated from the root system of the blueberry plant "Lexie" obtained from Changsha City, Hunan Province. Its morphological results are as follows Figure 3 As shown, the strain has a diameter of 60-65 mm, grows fast, is pure white, has a tapered texture, and has obvious wrinkles on the surface; the hyphae are short and dense; there is no exudate and no soluble pigment secretion. Figure 4 As shown, under the microscope, the hyphae of the fungus CS9 are dark and without septa, relatively thick, 2 to 4 μm wide, and the conidia are round and grow in strings at the top of the branched hyphae, with a diameter of 2.8 to 3.2 μm.

[0063] Further molecular biological identification showed that strain CS9 had the highest similarity with Alternaria sp. (MW 008908.1), which was 99.44%. The specific nucleotide sequence of the ITS sequence (5'-3') measured for strain CS9 is shown in SEQ ID NO.2.

[0064] SEQ ID NO.2:

[0065] ACAAAGATGAGGCGGGCTGGACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGCACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAA TCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGAAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGC ACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGAAATTGGCAGCCGGCCTACTGG TTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAAGCCGGAAGGAAGGAAC

[0066] In summary, the fungus CS9 is a strain of Alternaria sp., classified and named Alternaria sp., with the strain number CS9. The strain was deposited in the General Microbiology Center of China Microorganism Culture Collection on June 26, 2024, with the deposit number CGMCC No.41385, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0067] 3. Determination of growth indexes of blueberry seedlings

[0068] After the plants were grown in natural environment conditions for 3 months, the tree growth indicators (plant height, crown width, ground diameter, number of basal branches), biomass (aboveground fresh weight, underground fresh weight, aboveground dry weight, underground dry weight, whole plant dry weight, whole plant dry weight) and mycorrhizal indicators (root length, root surface area, number of root tips, number of root intersections) of the blueberry seedlings were measured.

[0069] The determination methods of each indicator are as follows:

[0070] Plant height: Use a tape measure to measure the distance from the base of the blueberry plant to the top;

[0071] Crown width: Use a tape measure to measure the east-west and north-south crown width of the blueberry plant, and finally take the average value as the crown width;

[0072] Ground diameter: Use a vernier caliper to measure the diameter of the root neck of the blueberry plant;

[0073] Number of basal branches: the number of branches growing from the ground of a blueberry plant;

[0074] Fresh weight above ground: Take a blueberry plant, cut off the root of the plant, cut off the above-ground part of the plant, and weigh it with an electronic balance;

[0075] Above-ground dry weight: Put the above-ground part of the blueberry plant into a kraft paper envelope, seal it, first sterilize it at 105℃ for 40min, then put it in an oven at 80℃ to dry to constant weight, take it out and weigh it with an electronic balance;

[0076] Underground fresh weight (root fresh weight): Weigh the roots of the cut blueberry plants using an electronic balance;

[0077] Underground dry weight (root dry weight): Put the roots of blueberry plants into a kraft paper envelope, seal it, first sterilize it at 105℃ for 40min, then put it in an oven at 80℃ to dry to constant weight, take it out and weigh it with an electronic balance;

[0078] Whole plant fresh weight: The total of above-ground fresh weight and root fresh weight is the whole plant fresh weight;

[0079] Whole plant dry weight: The total of above-ground dry weight and root dry weight is the whole plant dry weight;

[0080] Underground indicators: Before measuring the dry weight of the roots, the roots were washed and air-dried naturally, and the blueberry roots were scanned and analyzed using the root analysis software of the EPSONExpression 12000XL plant image analysis system.

[0081] The overall appearance of blueberry plants inoculated with NX1 alone and mixed with NX1 and CS9 is shown in Figure 2. Figure 5 , root scan results are shown in Figure 6 The specific measurement results of the above indicators are shown in Tables 1 to 3.

[0082] Table 1 Effects of fungi on the growth of blueberry seedlings

[0083] deal with Plant height / cm Ground diameter / mm Crown width / cm Number of basal branches Control group 30.80±4.55 2.06±0.26 18.08±5.24 3.13±0.64 NX1 Group 34.71±3.85 2.41±0.28 20.47±5.27 4.50±0.53 CS9 Group 32.56±3.57 2.18±0.40 19.45±6.52 3.25±0.46 NX1+CS9 group 27.83±3.79 2.60±0.46 27.66±4.16 3.63±0.74

[0084] The results in Table 1 show that after inoculation with a single fungus, the plant height, ground diameter, crown width, and number of basal branches of blueberry seedlings were significantly improved, among which the NX1 group was more significantly improved than the CS9 group. Compared with the control group, the plant height, ground diameter, crown width, and number of basal branches of the NX1 group were 12.69%, 16.99%, 13.22%, and 43.77% higher than those of the control group, respectively. After synergistic treatment with fungi NX1 and fungi CS9, in addition to plant height, the NX1+CS9 group further improved the growth of ground diameter, crown width, and number of basal branches of blueberry seedlings cultivated in the matrix, compared with the control group, with an increase of 21%, 25.99%, 15.9

[0085] 7%, but the growth of basal branches in NX1+CS9 group was lower than that in NX1 group. Based on the above results, it was found that NX1 group and NX1+CS9 group had more significant effects on the growth of blueberry seedlings cultivated in matrix.

[0086] Table 2 Effects of fungi on fresh weight and dry weight of blueberry seedlings

[0087]

[0088] As shown in Table 2, whether inoculated with a single fungus or mixed fungi, the fresh weight and dry weight of blueberry seedlings were significantly increased. Compared with the control group, the fresh weight of the underground, aboveground and whole plant in the NX1 group increased by 59.70%, 53.31% and 55.03%, respectively, and the dry weight of the underground, aboveground and whole plant increased by 62.96%, 33.02% and 39.40%, respectively; the fresh weight of the underground, aboveground and whole plant in the CS9 group increased by 86.57%, 5.15% and 21.60%, respectively, and the dry weight of the underground, aboveground and whole plant increased by 140.74%, 50.94% and 70.45%, respectively; the fresh weight of the underground, aboveground and whole plant in the NX1+CS9 group increased by 140.30%, 114.71% and 120.41%, respectively, and the dry weight of the underground, aboveground and whole plant increased by 100%, 71.70% and 79.55%, respectively. Based on the above results, it was found that the synergistic effect of fungus NX1 and fungus CS9 had a more significant effect on the biomass of blueberry seedlings cultivated in substrate.

[0089] Table 3 Effects of fungi on root parameters of blueberry seedlings

[0090] deal with Root length / mm <![CDATA[Root surface area / cm 2 > Number of root tips Root crossing number Control group 333.39±78.54 49.45±17.11 2282.25±410.54 442.63±159.64 NX1 Group 530.87±170.31 73.58±29.70 3236.13±1098.42 931.25±393.13 CS9 Group 325.19±80.48 53.86±13.22 1414.75±425.11 512.00±190.98 NX1+CS9 group 472.76±179.30 79.45±29.93 2710.38±1143.49 716.13±372.06

[0091] As shown in Table 3, compared with the control group, the root length, root surface area, root tip number, and root crossing number of blueberry seedlings inoculated with a single NX1 fungus increased by 59.23%, 48.80%, 41.80%, and 110.28%, respectively. Although the root length, root surface area, root tip number, and root crossing number of the mixed fungus-inoculated NX1+CS9 group increased by 41.80%, 60.67%, 18.76%, and 61.79%, respectively, compared with the control group, they were generally inferior to the NX1 group, indicating that the inoculation of a single NX1 fungus had the greatest impact on the root system of blueberry seedlings and was most effective in promoting the root development and growth of blueberry seedlings cultivated in substrates.

[0092] The present invention provides a strain of Fusarium and its idea and method of using in promoting the growth of blueberries. There are many methods and ways to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. A strain of Fusarium, classified and named Fusarium sp., with strain number NX1, was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on June 26, 2024, with the deposit number CGMCC No.41384.

2. A microbial agent, characterized in that: The microbial agent contains the Fusarium according to claim 1, or contains the product obtained by inoculation and fermentation of the Fusarium according to claim 1.

3. Use of the Fusarium according to claim 1 or the microbial agent according to claim 2 in the preparation of a product that promotes blueberry growth.

4. Use of the Fusarium according to claim 1 or the microbial agent according to claim 2 in promoting the growth of blueberries.

5. The use according to claim 4, characterized in that: The promotion of blueberry growth is manifested in the increase of any one or more of tree growth indicators, biomass indicators, and mycorrhizal indicators.

6. The use according to claim 5, characterized in that: The tree growth index includes any one or a combination of plant height, crown width, ground diameter, and number of basal branches; the biomass includes any one or a combination of above-ground fresh weight, underground fresh weight, above-ground dry weight, underground dry weight, whole plant fresh weight, and whole plant dry weight; the mycorrhizal index includes any one or a combination of root length, root surface area, number of root tips, and number of root crossings.

7. Use of the Fusarium and Alternaria alternata as claimed in claim 1 in synergistically promoting the growth of blueberries.

8. The use according to claim 7, characterized in that: The alternaria sp. is classified and named Alternaria sp., with the strain number CS9. The strain was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on June 26, 2024, with the deposit number CGMCC No.41385, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

9. A method for promoting blueberry growth, characterized in that: The mycelium block containing the Fusarium according to claim 1 is applied to the rhizosphere of blueberries to promote the growth of blueberries.

10. The method according to claim 9, characterized in that The application amount is 2 to 4 mycelium blocks per plant.

Images