Preparation method and application of muscle cell exosome for microRNA loading

Abstract

The invention relates to a preparation method of a muscle cell exosome for microRNA loading. The preparation method specifically comprises the following steps: step 1, culturing C2C12 cells in a C2C12 cell culture medium prepared from fetal calf serum, DMEM (dulbecco's modified eagle medium), double antibodies, glutathione and arginine; step 2, carrying out exosome extraction on the C2C12 cells, carrying out multiple times of differential centrifugation, and sequentially carrying out exosome washing and exosome purification; and step 3, carrying out microRNA (Ribonucleic Acid) loading on the obtained C2C12 cell exosome in a sterile state. Meanwhile, the invention also provides application of the exosome prepared by the preparation method in promoting proliferation and activity of muscle cells. According to the method, the secretion capacity of the exosome is improved by adopting the improved culture medium, and the loading efficiency and the stability of the microRNA are remarkably improved by combining an exosome transfer technology.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological products, and specifically relates to a method for preparing muscle cell exosomes loaded with microRNA and an application thereof. Background Art

[0002] With the continuous development of molecular biology and gene therapy, microRNA (miRNA), as a small non-coding RNA, has attracted much attention due to its important role in gene expression regulation. MiRNA has a wide range of biological functions by binding to the mRNA of the target gene and regulating its expression, especially showing great application potential in disease treatment, immune response and development. Traditional miRNA delivery methods face problems such as low delivery efficiency, poor stability and poor specificity. Therefore, how to deliver miRNA efficiently, stably and with strong targeting has become a current research hotspot.

[0003] Exosomes, as a type of nano-scale membrane vesicles secreted by cells, have become ideal miRNA delivery carriers due to their natural biocompatibility, low immunogenicity and ability to cross cell membranes. Exosomes can carry a variety of molecules including proteins, lipids, RNA, etc., have a wide range of biological functions, and can be effectively delivered to target cells. Therefore, using exosomes as miRNA carriers for development and gene therapy research is an important direction at present. C2C12 cells are a cell line derived from mouse skeletal muscle and are widely used in muscle biology research and drug screening. This cell line can proliferate rapidly under standard culture conditions and is relatively easy to passage. Due to the high differentiation potential and good culture characteristics of C2C12 cells, it has also been widely used in the secretion and research of exosomes. By special culturing and exosome extraction of C2C12 cells, high-quality exosomes can be obtained, providing ideal conditions for miRNA carriers. In order to enhance the secretion efficiency of C2C12 cell exosomes and the loading capacity of miRNA, how to prepare exosomes with a high loading rate has become a key issue.

[0004] Although there have been some progress in the research of miRNA exosome delivery system, there are still problems such as how to load efficiently and improve loading efficiency. In particular, how to further improve the loading effect and biological activity of miRNA by optimizing the extraction and loading methods of exosomes is still the focus of technical research. Summary of the invention

[0005] In view of the above problems, the present invention provides a method for preparing muscle cell exosomes for microRNA loading and its application, which uses an improved culture medium to improve the extraction of exosomes from cells and combines exosome transport peptide technology to significantly improve the loading efficiency and stability of microRNA.

[0006] The technical solution adopted by the present invention to solve the above technical problems is: a method for preparing muscle cell exosomes for microRNA loading, which specifically comprises the following steps:

[0007] Step 1, culturing C2C12 cells in a C2C12 cell culture medium prepared with fetal bovine serum, DMEM, double antibody, glutathione, and arginine;

[0008] Step 2, extracting exosomes from C2C12 cells, performing multiple differential centrifugation, and sequentially washing and purifying the exosomes;

[0009] Step 3: The obtained C2C12 cell exosomes are loaded with microRNA under sterile conditions.

[0010] Preferably, the C2C12 cell culture medium contains 10% fetal bovine serum, 89% DMEM, 1% double antibody, 50-100 μM glutathione, and 0.5-1 mM arginine.

[0011] Preferably, the multiple differential centrifugations in step 2 include conventional centrifugation, medium-speed centrifugation and ultracentrifugation.

[0012] Preferably, the step 1 is to mix the C2C12 cell suspension with a culture medium containing fetal bovine serum, DMEM, double antibody, glutathione and arginine, and then aseptically place the mixture in an incubator at 37° C. and containing 5% CO 2 for static culture for 20 to 30 hours.

[0013] Preferably, the step 2 is specifically as follows:

[0014] Step 201, cell collection and conventional centrifugation

[0015] Under sterile conditions, collect the supernatant of the C2C12 cells cultured in step 1 into a sterile centrifuge tube, filter the harvested supernatant through a filter, and then use conventional centrifugation at 300-500×g for 10-15 minutes to remove cell residues and large particle impurities to obtain a clear supernatant;

[0016] Step 202, removing cell debris

[0017] The supernatant obtained in step 201 is centrifuged at 10,000-20,000×g for 30 minutes to remove cell debris and incompletely lysed cells, and the supernatant is collected again;

[0018] Step 203: ultracentrifugation to separate exosomes

[0019] The supernatant obtained in step S202 was transferred to a new sterile centrifuge tube and ultracentrifuged at 100,000×g for 120 min to separate the exosomes and obtain an exosome precipitate;

[0020] Step 204: Exosome washing

[0021] The exosome precipitate obtained in step 203 is resuspended in PBS buffer and ultracentrifuged again at 100,000×g for 120 min to obtain a crude exosome particle;

[0022] Step 205, exosome purification

[0023] The crude exosome particles obtained in step 204 are transferred to the upper chamber of the Exosome Purification Filter (EPF column), and centrifuged at 3000×g for 10 min at 4° C. After centrifugation, the liquid at the bottom of the EPF column tube is collected, and this liquid is the purified exosome particles.

[0024] Preferably, the step 3 is specifically as follows:

[0025] Step 301, microRNA synthesis

[0026] The ssc-miR-191 sequence was: CAACGGAATCCCAAAAGCAGCTG, which was modified using Cy3;

[0027] Step 302, microRNA loading

[0028] The separated C2C12 cell exosomes were mixed with the exosome transport peptide, microRNA, and reaction solution, and incubated in a 37°C incubator at 150 rpm with shaking in the dark for 2 h to form a mixed solution;

[0029] Step 303, removing free small nucleic acids

[0030] The mixed solution was centrifuged at 4000×g for 40-60 min in a 100KD ultrafiltration tube.

[0031] The present invention also provides the use of exosomes prepared according to the above preparation method in promoting muscle cell proliferation and activity.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] 1. The present invention uses an improved culture medium to improve the secretion capacity of exosomes, and combines exosome transport peptide technology to significantly improve the loading efficiency and stability of miRNA;

[0034] 2. Adding glutathione and arginine to the culture medium of the present invention can enable a large amount of exogenous microRNA to enter the exosomes, thereby increasing the microRNA loading capacity;

[0035] 3. The miRNA-loaded exosomes of the present invention can significantly increase cell proliferation activity and regulate the secretion of growth hormone;

[0036] 4. The application of the exosomes prepared by the preparation method of the present invention in promoting muscle cell proliferation and activity can effectively maintain muscle cell culture and stable cell growth, thereby effectively promoting muscle growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 is the loading efficiency of exosomes prepared from C2C12 cells cultured in different media;

[0038] Figure 2 is the effect of miRNA-loaded exosomes on the activity of C2C12 cells (* represents P < 0.05);

[0039] Figure 3 The effect of exosomes loaded with miRNA on hormone secretion in C2C12 cells (* represents P<0.05). DETAILED DESCRIPTION

[0040] The following will be combined Figure 1-3 The present invention is described in detail. The illustrative embodiments and descriptions of the present invention are used to explain the present invention, but are not intended to limit the present invention. Unless otherwise specified, all raw materials and reagents of the present invention are raw materials and reagents on the conventional market.

[0041] A method for preparing muscle cell exosomes loaded with microRNA, which specifically comprises the following steps:

[0042] Step 1, culturing C2C12 cells in a C2C12 cell culture medium prepared with fetal bovine serum, DMEM, double antibody, glutathione, and arginine, specifically, mixing the C2C12 cell suspension with a culture medium containing fetal bovine serum, DMEM, double antibody, glutathione, and arginine, and aseptically placing the mixture in an incubator at 37° C. and containing 5% CO2 for static culture for 20 to 30 hours, and the C2C12 cell culture medium contains 10% fetal bovine serum, 89% DMEM, 1% double antibody, 50 to 100 μM glutathione, and 0.5 to 1 mM arginine;

[0043] Step 2: Extract exosomes from C2C12 cells, perform multiple differential centrifugation, including conventional centrifugation, medium-speed centrifugation and ultracentrifugation, and sequentially wash and purify exosomes. The specific steps are as follows:

[0044] Step 201, cell collection and conventional centrifugation

[0045] Under sterile conditions, collect the supernatant of the C2C12 cells cultured in step 1 into a sterile centrifuge tube, filter the harvested supernatant through a filter, and then use conventional centrifugation at 300-500×g for 10-15 minutes to remove cell residues and large particle impurities to obtain a clear supernatant;

[0046] Step 202, removing cell debris

[0047] The supernatant obtained in step 201 is centrifuged at 10,000-20,000×g for 30 minutes to remove cell debris and incompletely lysed cells, and the supernatant is collected again;

[0048] Step 203: ultracentrifugation to separate exosomes

[0049] The supernatant obtained in step S202 was transferred to a new sterile centrifuge tube and ultracentrifuged at 100,000×g for 120 min to separate the exosomes and obtain an exosome precipitate;

[0050] Step 204: Exosome washing

[0051] The exosome precipitate obtained in step 203 is resuspended in PBS buffer and ultracentrifuged again at 100,000×g for 120 min to obtain a crude exosome particle;

[0052] Step 205, exosome purification

[0053] The crude exosome particles obtained in step 204 are transferred into the upper chamber of the Exosome Purification Filter (EPF column), and centrifuged at 3000×g for 10 min at 4° C. After centrifugation, the liquid at the bottom of the EPF column tube is collected, and this liquid is the purified exosome particles;

[0054] Step 3: Load the obtained C2C12 cell exosomes with microRNA under sterile conditions. The specific steps are as follows:

[0055] Step 301, microRNA synthesis

[0056] The ssc-miR-191 sequence was: CAACGGAATCCCAAAAGCAGCTG, which was modified using Cy3;

[0057] Step 302, microRNA loading

[0058] The separated C2C12 cell exosomes were mixed with the exosome transport peptide, microRNA, and reaction solution, and incubated in a 37°C incubator at 150 rpm with shaking in the dark for 2 h to form a mixed solution;

[0059] Step 303, removing free small nucleic acids

[0060] The mixed solution was centrifuged at 4000×g for 40-60 min in a 100KD ultrafiltration tube.

[0061] The present invention also provides the use of exosomes prepared by the above preparation method in promoting muscle cell proliferation and activity, which can effectively maintain muscle cell culture and stable cell growth, thereby effectively promoting muscle growth.

[0062] Example 1 A method for preparing a culture medium for preparing exosomes from C2C12 cells

[0063] (1) Configuration of C2C12 cell culture medium:

[0064] Culture medium 1: 10% fetal bovine serum, 89% DMEM, 1% double antibody, 50 μM glutathione, and 0.5 mM arginine.

[0065] Culture medium 2: 10% fetal bovine serum, 89% DMEM, 1% double antibody, 80 μM glutathione, and 0.5 mM arginine.

[0066] Culture medium 3: 10% fetal bovine serum, 89% DMEM, 1% double antibody, 100 μM glutathione, and 0.75 mM arginine.

[0067] Culture medium 4: 10% fetal bovine serum, 89% DMEM, 1% double antibody, 100 μM glutathione, and 1 mM arginine.

[0068] Culture medium 5: 10% fetal bovine serum, 89% DMEM, 1% double antibody.

[0069] (2) Cell culture: C2C12 cell culture medium was prepared using 5 different culture medium configuration requirements, including fetal bovine serum, DMEM, double antibody, glutathione, and arginine. After the C2C12 cell suspension was mixed with the culture medium, it was sterilely placed in an incubator at 37°C and 5% CO2 and cultured for 20 to 30 hours. The culture medium was replaced after 8 hours, and the culture was continued. The cell density was observed under a microscope. When the cell density reached 90%, subculture was started.

[0070] (3) Cell passaging: Remove cells from the incubator, remove the culture medium, wash the cells twice with 2 mL PBS, add 1 mL preheated trypsin, and gently shake the culture bottle to infiltrate all cells; digest in the incubator for 2 minutes, remove and observe under a microscope whether the cells have fallen off; remove and add 2 mL complete culture medium to terminate digestion. Transfer the suspension to a 15 mL centrifuge tube, centrifuge at 1200 r / min for 3 minutes, and discard the supernatant. Add culture medium to resuspend and blow the cells evenly, take 100 μL of cell suspension for cell counting and viability detection, and culture cells at a ratio of 1:3.

[0071] Example 2 A method for preparing C2C12 cell exosomes

[0072] (1) Cell collection and conventional centrifugation: Under sterile conditions, the C2C12 cells cultured in Example 1 were collected and placed into the supernatant, and the harvested supernatant was filtered through a 0.22 μm filter; then, the cell residues and large particle impurities were removed by centrifugation (conventional centrifugation) at 300 × g for 10 minutes to obtain a clear supernatant.

[0073] (2) Removal of cell debris:

[0074] The supernatant obtained in (1) was centrifuged at 10,000×g (medium speed centrifugation) for 30 min to remove cell debris and large cell debris and incompletely lysed cells. The supernatant was collected to avoid gravity sedimentation of cell debris before the next step.

[0075] (3) Ultracentrifugation to separate exosomes

[0076] The supernatant obtained in (2) was transferred to a new sterile centrifuge tube and subjected to ultracentrifugation at 100,000×g for 120 min to separate the exosomes and obtain an exosome precipitate.

[0077] (4) Exosome washing: To further remove residual proteins and small molecule impurities, the exosome precipitate was resuspended in PBS buffer and centrifuged again at 100,000 × g for 120 min to obtain the crude exosome particles.

[0078] (5) Exosome purification: The harvested crude exosome particles were transferred to the upper chamber of the Exosome Purification Filter (EPF column) and centrifuged at 3000 × g for 10 min at 4°C. After centrifugation, the liquid at the bottom of the EPF column was collected. This liquid was the purified exosome particles.

[0079] Example 3

[0080] The purpose of this example is to use the C2C12 cell exosomes separated and purified from Example 2 to load microRNA

[0081] (1) microRNA synthesis: The sequence of ssc-miR-191 is CAACGGAATCCCAAAAGCAGCTG, which was modified with Cy3.

[0082] (2) microRNA loading: The separated C2C12 cell exosomes were mixed with the exosome transport peptide, microRNA, and reaction solution, and incubated in a 37°C incubator at 150 rpm in the dark for 2 h to form a mixed solution;

[0083] (3) Removal of free small nucleic acids: Centrifuge the mixture in a 100KD ultrafiltration tube at 4000×g for 40-60 min.

[0084] (4) Identification of microRNA in exosomes: In order to identify whether exogenous microRNA has been introduced into exosomes and the efficiency of introduction, fluorescence quantification method was used to quantify the fluorescence intensity. Figure 1 We compared the introduction of the same ssc-miR-191 into exosomes prepared from different C2C12 cell culture media. We found that the C2C12 cell exosomes prepared from culture media 1, 2, 3, and 4 containing fetal bovine serum, DMEM, double antibodies, glutathione, and arginine, compared with the control culture media containing fetal bovine serum, DMEM, and double antibodies, the amount of ssc-miR-191 loaded in the C2C12 cell exosomes prepared from culture media 1, 2, 3, and 4 increased, indicating that the addition of glutathione and arginine in the culture media can allow a large amount of exogenous microRNA to enter the exosomes, increasing the amount of microRNA loaded.

[0085] Example 4

[0086] The purpose of this example is to use the C2C12 cell exosomes loaded with microRNA verified in Example 3 to culture C2C12 cells and verify its effect on cell activity and cytokines

[0087] (1) Experimental grouping: Exosomes loaded with miRNA were transfected into C2C12 cells, and different concentration groups (0, 50, 100 μg / mL exosomes) were set. The culture and passage methods were the same as in Example 1. The cells were incubated for 24 hours, and the cell supernatant and cells were collected for analysis.

[0088] (2) Cell activity detection: CCK-8 kit was used to detect cell activity. According to the kit instructions, the cell growth was measured for 24 hours, and the cell proliferation and activity were evaluated by measuring the absorbance (450 nm).

[0089] (3) Hormone level analysis: The growth hormone level in the cell culture supernatant was detected using an ELISA kit.

[0090] (4) Statistical analysis: SPSS was used for statistical analysis, and GraphPad Prism and other statistical software were used for data processing and statistical analysis. A P value < 0.05 indicated a significant difference.

[0091] (5) Results: Figure 2As shown in the figure, the cell activities between different groups were compared by CCK-8 test results. The results showed that 24 hours after treatment, the 100μg / mL miRNA-loaded exosome group showed higher cell proliferation activity than the blank control group (CCK-8 absorbance value increased significantly). In addition, in the growth hormone level test, the growth hormone concentration in the cell supernatant of the miRNA-loaded exosome group was significantly higher than that of the blank control group (such as Figure 3 ). In summary, exosomes loaded with miRNA can significantly enhance cell proliferation activity and regulate the secretion of growth hormone.

[0092] The technical solutions provided by the embodiments of the present invention are introduced in detail above. Specific examples are used herein to illustrate the principles and implementation methods of the embodiments of the present invention. The description of the above embodiments is only applicable to help understand the principles of the embodiments of the present invention. At the same time, for those skilled in the art, according to the embodiments of the present invention, there may be changes in the specific implementation methods and application scopes. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. A method for preparing muscle cell exosomes loaded with microRNA, characterized in that: The specific steps include: Step 1, culturing C2C12 cells in a C2C12 cell culture medium prepared with fetal bovine serum, DMEM, double antibody, glutathione, and arginine; Step 2, extracting exosomes from C2C12 cells, performing multiple differential centrifugation, and sequentially washing and purifying the exosomes; Step 3: The obtained C2C12 cell exosomes are loaded with microRNA under sterile conditions.

2. The method for preparing muscle cell exosomes for microRNA loading according to claim 1, characterized in that: The C2C12 cell culture medium contains 10% fetal bovine serum, 89% DMEM, 1% double antibody, 50-100 μM glutathione, and 0.5-1 mM arginine.

3. The method for preparing muscle cell exosomes for microRNA loading according to claim 1, characterized in that: The multiple differential centrifugations in step 2 include conventional centrifugation, medium-speed centrifugation and ultracentrifugation.

4. The method for preparing muscle cell exosomes for microRNA loading according to claim 1, characterized in that: Specifically, the step 1 is to mix the C2C12 cell suspension with a culture medium containing fetal bovine serum, DMEM, double antibody, glutathione, and arginine, and then aseptically place the mixture in an incubator at 37° C. and containing 5% CO 2 for static culture for 20 to 30 hours.

5. The method for preparing muscle cell exosomes for microRNA loading according to claim 1, characterized in that: The step 2 is specifically step 201, cell collection and conventional centrifugation Under sterile conditions, collect the supernatant of the C2C12 cells cultured in step 1 into a sterile centrifuge tube, filter the supernatant using a filter, and then use conventional centrifugation at 300-500×g for 10-15 minutes to remove cell residues and large particle impurities to obtain a clear supernatant; Step 202, removing cell debris The supernatant obtained in step 201 is centrifuged at 10,000-20,000×g for 30 minutes to remove cell debris and incompletely lysed cells, and the supernatant is collected again; Step 203: ultracentrifugation to separate exosomes The supernatant obtained in step S202 was transferred to a new sterile centrifuge tube and ultracentrifuged at 100,000×g for 120 min to separate the exosomes and obtain an exosome precipitate; Step 204: Exosome washing The exosome precipitate obtained in step 203 is resuspended in PBS buffer and ultracentrifuged again at 100,000×g for 120 min to obtain a crude exosome particle; Step 205, exosome purification The crude exosome particles obtained in step 204 are transferred to the upper chamber of the Exosome Purification Filter (EPF column), and centrifuged at 3000×g for 10 min at 4° C. After centrifugation, the liquid at the bottom of the EPF column tube is collected, and this liquid is the purified exosome particles.

6. The method for preparing muscle cell exosomes for microRNA loading according to claim 1, characterized in that: The step 3 is specifically step 301, microRNA synthesis The ssc-miR-191 sequence was: CAACGGAATCCCAAAAGCAGCTG, which was modified using Cy3; Step 302, microRNA loading The separated C2C12 cell exosomes were mixed with the exosome transport peptide, microRNA, and reaction solution, and incubated in a 37°C incubator at 150 rpm with shaking in the dark for 2 h to form a mixed solution; Step 303, removing free small nucleic acids The mixed solution was centrifuged at 4000×g for 40-60 min in a 100KD ultrafiltration tube.

7. Use of the exosomes prepared according to the method for preparing muscle cell exosomes for microRNA loading according to any one of claims 1 to 6 in promoting muscle cell proliferation and activity.

Images