SgRNA aiming at LPA gene, recombinant expression vector and method

Abstract

The invention provides sgRNA for an LPA gene, a recombinant expression vector and a method, and belongs to the technical field of gene engineering. According to the sgRNA for targeted editing of the LPA gene provided by the invention, the nucleotide sequence of the sgRNA is selected from any one of the sequences as shown in SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.9. According to the PAM region structural domain of the ABE editor principle, the sgRNA is designed for the full length of the LPA gene, namely all introns and exons, the sgRNA with the highest editing efficiency is screened, and a new target is provided for screening of new drugs clinically in the future.

Description

Technical Field

[0001] The present application relates to the field of genetic engineering technology, and specifically to sgRNA, recombinant expression vectors and methods targeting the LPA gene. Background Art

[0002] Cardiovascular disease is one of the most important health challenges in the world today. It not only affects people's quality of life, but is also the main cause of death for many people. According to statistics from the World Health Organization (WHO), millions of people die each year from cardiovascular diseases, including heart disease, stroke and other related diseases. Among all cardiovascular diseases, atherosclerotic cardiovascular disease (ASCVD) is one of the most common types.

[0003] ASCVD is a chronic disease caused by lipid deposition in the arteries, which usually manifests as vascular narrowing and blockage, eventually leading to heart attack, stroke or other cardiovascular events. Although the pathogenesis of ASCVD is complex, in most cases it is closely related to a series of risk factors, including high blood pressure, high cholesterol, smoking, lack of exercise, unhealthy eating habits, obesity and diabetes. Among them, low-density lipoprotein cholesterol (LDL-c) is considered to be one of the main pathogenic factors of ASCVD.

[0004] For a long time, researchers and doctors have regarded the reduction of LDL-c levels as one of the main strategies for the prevention and treatment of ASCVD. Many clinical trials and epidemiological studies have shown that the use of lipid-lowering drugs such as statins can significantly reduce LDL-c levels and reduce the incidence of cardiovascular events. However, despite the excellent performance of these drugs in controlling LDL-c, they are ineffective in reducing Lp(a) levels. Lp(a) is a complex lipoprotein particle composed of two proteins, apo(a) and apoB-100. Apo(a) is mainly encoded by the LPA gene, and the structure of the LPA gene determines the size of the apo(a) protein and the plasma Lp(a) level. The LPA gene encodes two kringle domains (KIV and KV), of which KIV is further expanded into multiple subtypes, among which the gene copy number variation of KIV2 exists in different populations, resulting in genetic polymorphism of Lp(a) levels. Plasma Lp(a) levels show obvious differences in the population, and this difference exists not only between different races, but also has a wide range of variation even within the same race. Studies have shown that high plasma Lp(a) levels are significantly associated with the risk of ASCVD. Even when LDL-c levels are low, high Lp(a) levels increase the risk of ASCVD.

[0005] Currently, although a variety of drugs have been developed to lower LDL-c levels, the choice of drugs for lowering Lp(a) levels is relatively limited. For example, traditional statins not only fail to effectively lower Lp(a) levels, but may cause them to increase. While new drugs developed in recent years, such as PCSK9 inhibitors, have a certain effect on Lp(a) levels, the effect is still unsatisfactory. Therefore, there is an urgent need to develop a new treatment method that can lower Lp(a) levels in a long-term and continuous manner, thereby reducing the incidence of ASCVD and related cardiovascular events.

[0006] As research on Lp(a) continues to deepen, scientists have gradually realized its importance in the pathogenesis of ASCVD and have begun to explore new treatment strategies. For example, some monoclonal antibody drugs targeting Lp(a) have shown certain efficacy in clinical trials, providing new hope for reducing Lp(a) levels. In addition, advances in gene editing technology have also provided new ways to regulate the LPA gene, which is expected to bring new breakthroughs in the treatment of ASCVD in the future. Summary of the invention

[0007] The present application provides sgRNA, recombinant expression vectors and methods for the LPA gene. Using an adenine base editor (ABE), all targets that can be edited with single bases are designed for all exons and introns of the LPA gene, and their editing efficiency is evaluated.

[0008] In order to achieve the above-mentioned invention object, this application provides the following technical solutions:

[0009] On the one hand, the present application provides an sgRNA for targeted editing of the LPA gene, wherein the nucleotide sequence of the sgRNA comprises any one of the sequences selected from SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, and SEQ ID No. 9.

[0010] Optionally, the nucleotide sequence of the sgRNA comprises a sequence as shown in SEQ ID No.5, SEQ ID No.7 or SEQ ID No.9.

[0011] Optionally, the targeting site of the sequence shown in SEQ ID No. 5 is within the range of -8 bp to 12 bp of Exon9.

[0012] Optionally, the targeting site of the sequence shown in SEQ ID No. 7 is within the range of -4 bp to 16 bp of Exon1.

[0013] Optionally, the targeting site of the sequence shown in SEQ ID No. 9 is within the range of 101 bp to 120 bp of Exon2.

[0014] In the present application, the selection of sgRNA has an important influence on the editing effect of the adenine single-base editor. After a large number of experimental verifications, only the four sgRNAs screened in this application can achieve a relatively ideal editing effect.

[0015] In a second aspect, the present application provides a recombinant expression vector for targeted editing of the LPA gene, wherein the recombinant expression vector comprises the above-mentioned sgRNA.

[0016] In a third aspect, the present application provides a method for constructing the above-mentioned recombinant expression vector for targeted editing of the LPA gene, comprising the following steps:

[0017] The sgRNA is cloned into a plasmid vector to obtain a recombinant expression vector for the targeted editing of the LPA gene.

[0018] Optionally, the following steps are included:

[0019] (1) designing and synthesizing the sgRNA;

[0020] (2) adding the BbsI restriction site caccg to the 5' end of the sgRNA sequence to obtain the sequence 5'-caccg-sgRNA-3', and synthesizing its complementary sequence 5'-aaac-sgRNA-c-3';

[0021] (3) annealing the sequences 5'-caccg-sgRNA-3' and 5'-aaac-sgRNA-c-3' to obtain a double-stranded DNA molecule;

[0022] (4) Connecting the double-stranded DNA molecule to a plasmid vector to obtain a recombinant expression vector for the targeted editing of the LPA gene.

[0023] Optionally, in step (3), the annealing temperature is 94-96° C.;

[0024] The annealing time is 4 to 6 minutes.

[0025] Optionally, in step (3), the annealing temperature is independently selected from any value among 94° C., 95° C., 96° C., or any range between the two.

[0026] Optionally, in step (3), the annealing time is independently selected from any value among 4 min, 5 min, 6 min, or any range between the two.

[0027] Optionally, in step (4), the plasmid vector includes a PUC57 vector cut with BbsI.

[0028] Optionally, the PUC57 vector contains a U6 promoter.

[0029] In a fourth aspect, the present application provides a method for targeted editing of the LPA gene, comprising the following steps:

[0030] The adenine single-base editor and the above-mentioned recombinant expression vector are introduced into cells to perform gene editing on LPA to reduce the LPA gene level.

[0031] Optionally, the adenine single-base editor is an ABE 8e editor.

[0032] Optionally, the ABE 8e editor comprises nCas9 and adenine deaminase.

[0033] In the present application, the adenine single-base editor (i.e., ABE editor) is developed by fusing nCas9 with wild-type or evolved TadA (eTadA) (originally a transfer RNA (tRNA) adenine deaminase in Escherichia coli), in order to effectively produce the transition from A·T to G·C without breaking the DNA. In order to improve the editing efficiency and targeting range, an ABE variant, i.e., ABE 8e, was developed through molecular evolution of the eTadA monomer. Its activity is 3 to 11 times higher than that of the first-generation ABE editor. At the same time, it also expands the editing window and is the most efficient and compatible ABE variant.

[0034] Optionally, the introduction method includes liposome transfection.

[0035] Optionally, the total transfection amount of the liposome transfection method is 2-4 μg.

[0036] Preferably, the total amount of transfection by the liposome transfection method is 3 μg.

[0037] Optionally, the transfection ratio of the adenine single-base editor and the recombinant expression vector is 1:1 to 3.

[0038] Optionally, the transfection ratio of the adenine single-base editor and the recombinant expression vector is independently selected from any value of 1:1, 1:2, 1:3, or any range value therebetween.

[0039] Optionally, the cells comprise HEK293T cells.

[0040] In the present application, the HEK293T cells are human-derived tool cells, whose genetic material is consistent with or similar to that of humans and are easy to transfect.

[0041] Optionally, the transfected cells are cultured for 48 hours, the genomic DNA of the cells obtained in the above step is extracted, and gene sequencing is performed after PCR to observe the gene editing efficiency.

[0042] The present application also provides a cell, which contains the sgRNA or the expression vector.

[0043] The present application also provides a pharmaceutical composition, which comprises:

[0044] A delivery vector and the sgRNA or the expression vector.

[0045] The delivery vehicle is selected from one or more of polymer liposomes, nanoparticles, viral vectors or extracellular vesicles.

[0046] The present application also provides the use of the sgRNA, the expression vector or the pharmaceutical composition in preparing one of the following products:

[0047] 1) Products of LPA gene editing in vitro;

[0048] 2) products that reduce apolipoprotein(a) and lipoprotein(a);

[0049] 3) Drugs for the treatment of cardiovascular diseases.

[0050] Exemplarily, the cardiovascular disease is selected from one or more of hypercholesterolemia, coronary heart disease, hypertension, myocardial infarction, stroke, peripheral vascular disease or aortic atherosclerosis.

[0051] The present application also provides a method for editing the LPA gene in vitro, characterized in that it comprises the following steps:

[0052] The sgRNA and the recombinant expression vector are introduced into cells to perform gene editing on LPA to reduce the expression level of the LPA gene.

[0053] In the present application, the introduction method includes one or more of liposome transfection, viral transduction, electroporation, microinjection, particle bombardment or gene gun transformation.

[0054] The cells described herein may be human cells or related cell lines, such as HEK293T cells or HepG2 cells.

[0055] Compared with the prior art, the beneficial effects of this application include:

[0056] 1. According to the PAM region domain of the ABE editor principle, this application designs sgRNA for the full length of the LPA gene, i.e., all introns and exons, and screens the sgRNA with the highest editing efficiency. The gene editing efficiency of this application can be as high as 50%, and the bases at the corresponding position of the LPA gene will produce a transition from A·T to G·C, which is significantly higher than the mutation rate that can be achieved using ZFN, TALEN or Cas12a / Cpf1RNP.

[0057] 2. Due to the characteristics of the LPA gene having different KIV2 copy numbers, the DNA editing efficiency involved in this application is the average efficiency. Therefore, it is speculated that for people with low KIV2 copy numbers, the gene editing efficiency is higher and the lipid-lowering effect is also greater; the high gene editing efficiency achieved by this application is of great significance in saving experimental time and investment in manpower and material resources; the sgRNA of this application can achieve efficient gene editing efficiency and effective lipid-lowering effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0059] Figure 1 Schematic diagram of the working principle of the ABE base editor in this application;

[0060] Figure 2 This is the plasmid sequencing diagram of the PUC57 vector of this application connected with different sgRNAs;

[0061] Figure 3 This is the sequencing peak diagram after PCR amplification of HEK293T cell genomic DNA in this application;

[0062] Figure 4 Schematic diagram of real-time PCR amplification of LPA mRNA levels in HEK293T cells in this application (Note: ns indicates no difference; * indicates P < 0.05; ** indicates P < 0.01). DETAILED DESCRIPTION

[0063] The present application is further described below in conjunction with specific embodiments. The following are only a few embodiments of the present application, and are not intended to limit the present application in any form. Although the present application discloses the following preferred embodiments, they are not intended to limit the present application. Any technician familiar with the profession, without departing from the scope of the technical solution of the present application, using the above disclosed technical content to make some changes or modifications are equivalent to equivalent implementation cases and are within the scope of the technical solution.

[0064] Unless otherwise specified, the raw materials in the examples of the present application were purchased from commercial sources and used directly without any special treatment.

[0065] Unless otherwise specified, the analysis methods in the examples all adopt conventional settings and conventional analysis methods of instruments or equipment.

[0066] Example 1

[0067] Construction and testing of the PUC57 vector targeting the LPA gene:

[0068] 1. Within the full length of the LPA gene (132.794 kb) (LPA gene ID: 4018 (https: / / www.ncbi.nlm.nih.gov / gene / 4018); the NCBI accession number of the full-length sequence is NC_000006; the ENSEMBL accession number of the CDS sequence of the LPA gene (all exons) is ENST00000316300), all sgRNAs shown in Table 1 were designed based on the PAM region (NGG) domain of the working principle of the ABE editor. A mutation from A·T to G·C was generated within the active window of the LPA gene target sequence shown in Table 1, and the resulting mutant protein will not retain most of the functional domains, so LPA loses the function of binding to APOB100, thereby reducing the level of LP(a). Restriction sites were designed at both ends of the BbsI restriction endonuclease (NEB, Ipswich, MA, USA), and the caccg engineering oligo was added to the 5' end of the sgRNA. The sequence was caccg-sgRNA; the reverse complementary sequence was aaac-sgRNA-c, and both sequences were synthesized.

[0069] Table 1 sgRNA sequences of LPA gene

[0070]

[0071]

[0072] 2. The PUC57 vector backbone was configured with the restriction enzyme digestion system according to the instructions of the BbsI restriction enzyme and digested. After digestion, 1% agarose gel electrophoresis was performed and the digestion product was recovered according to the Vazyme gel recovery kit. Annealing and ligation were performed according to the instructions of T4 DNA Ligase (Thermo Scientific, Waltham, MA, USA). The ligation product was transformed into DH5α Escherichia coli competent cells (Invitrogen, Waltham, MA, USA), plated and cultured overnight on ampicillin-resistant solid LB medium, and single colonies were sequenced. Sequencing was performed using the M13 Rev promoter forward primer to verify whether it was successfully constructed. The results are as follows: Figure 2 The correct colony was expanded and the plasmid was extracted.

[0073] Example 2

[0074] Screening of LPA gene sgRNA:

[0075] 1. According to Example 1, the LPA gene sequence designed based on the ABE editor PAM region. After obtaining the PUC57-LPA plasmid, the ratio of its transfection into HEK293T cells needs to be optimized. The ABE:PUC57-LPA plasmid was used at a ratio of 1:1, 1:2, and 1:3 to transfect 1×10 5 HEK293T cells. Secondly, the total amount of HEK293T cells transfected was optimized to 2μg, 3μg, and 4μg, respectively. The culture conditions of HEK293T cells were 37°C, 5% CO2, and the culture medium was 90% DMEM ( Life Technologies, Eggstein, Germany) plus 10% fetal bovine serum ( The culture medium was 90% DMEM (Gibco) plus 10% fetal bovine serum (Gibco), and the medium was changed 24 hours before transfection to keep the cells in an exponential growth state.

[0076] 2. In this application, when the total amount of transfection is greater than 4 μg, a large number of HEK293T cells die; when less than 2 μg is used, the efficiency of gene editing in cells is less than 5%; when the total amount of transfection is 3 μg, HEK293T cells are in good condition and the gene editing efficiency is 30%, so the total amount is set to 3 μg in subsequent operations. In this application, the ratio of transfected ABE and PUC57-LPA plasmids is 1:1.

[0077] 3. Different PCR primers were designed according to different sgRNA sites, as shown in Table 2. After transfection of HEK293T cells for 48 hours, the cell genome was collected and PCR amplification was performed (95°C for 3 min, [95°C for 15 s, 62°C for 15 s, 72°C for 40 s] for 35 cycles, 72°C for 5 min). The amplified products were sequenced and the proportion of gene-edited DNA was calculated. The editing efficiency of all sgRNAs is shown in Table 3.

[0078] Table 2 PCR primer sequences corresponding to LPA gene sgRNA

[0079]

[0080]

[0081] Table 3 LPA gene sgRNA editing efficiency in HEK293T cells

[0082]

[0083] 4. As shown in Table 3, compared with the comparative example sequences, the editing efficiency of the sgRNA in the experimental example of the present application is higher, especially sgRNA5, 7 and 9; preferably, sgRNA7 or 9; more preferably, sgRNA9, such as Figure 3 shown.

[0084] Example 3

[0085] In vitro cell verification of sgRNA editing effect:

[0086] 1. According to the sequence shown in SEQ ID NO. 5, 7 or 9 selected in Example 2, HEK293T cells were transfected according to the above method.

[0087] 2. Cell RNA was collected 48 hours after transfection. The mRNA was reverse transcribed into cDNA using a reverse transcription kit (Thermo Scientific, Waltham, MA, USA). The level of LPA mRNA was detected by real-time PCR (95°C 30s, [95°C 10s, 60°C 30s] 40 cycles) under the action of SYBR green luciferase (Vazyme). The effect of SEQ ID NO.5 or 9 was significantly better than SEQ ID NO.7. The results are shown in Figure 4 shown.

[0088] The qPCR primer sequences used are as follows:

[0089] qPCR-F: CTGCCGTCATCACTGACAAAGTAA (as shown in SEQ ID No. 25);

[0090] qPCR-R: GTAACATTCAGTCCTGGCGGTG (as shown in SEQ ID No. 26).

[0091] Example 4

[0092] Application of LPA gene sgRNA:

[0093] Screening of new drugs and establishment of treatment methods: Establish a humanized LPA mouse model, use this model to verify the in vivo editing efficiency of sgRNA, extract RNA and protein from mouse liver, evaluate the lipid-lowering effect and duration after LPA gene editing in vivo; evaluate the improvement of atherosclerosis phenotype after gene editing; further screen the sgRNA with the highest efficiency and the most obvious lipid-lowering effect in vivo to provide targets for the screening of new drugs and further establish good treatment methods for lowering plasma LP(a).

[0094] The above description is only an embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions, improvements, etc. made within the principles of the present application shall be included in the protection scope of the present application.

Claims

1. sgRNA targeting and editing the LPA gene, characterized in that: The nucleotide sequence of the sgRNA comprises any one selected from the sequences shown in SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, and SEQ ID No.

9.

2. The sgRNA for targeted editing of LPA gene according to claim 1, characterized in that The nucleotide sequence of the sgRNA comprises the sequences shown in SEQ ID No.5, SEQ ID No.7, and SEQ ID No.

9.

3. A recombinant expression vector for targeted editing of LPA gene, characterized in that: The recombinant expression vector contains the sgRNA according to claim 1 or 2.

4. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises: A delivery vector and the sgRNA according to any one of claims 1-2 or the expression vector according to claim 3.

5. The pharmaceutical composition according to claim 4, characterized in that The delivery vehicle is selected from one or more of polymer liposomes, nanoparticles, viral vectors or extracellular vesicles.

6. Use of the sgRNA according to any one of claims 1-2, the expression vector according to claim 3, or the pharmaceutical composition according to any one of claims 4-5 in the preparation of one of the following products: 1) Products of LPA gene editing in vitro; 2) products that reduce apolipoprotein(a) and lipoprotein(a); 3) Drugs for the treatment of cardiovascular diseases.

7. The use according to claim 6, characterized in that The cardiovascular disease is selected from one or more of hypercholesterolemia, coronary heart disease, hypertension, myocardial infarction, stroke, peripheral vascular disease or aortic atherosclerosis.

8. A method for editing LPA gene in vitro, characterized in that: The steps include: The sgRNA according to claim 1 or 2 and the recombinant expression vector according to claim 3 are introduced into cells to perform gene editing on LPA to reduce the expression level of the LPA gene.

9. The method for editing LPA gene in vitro according to claim 8, characterized in that: The introduction method includes one or more of liposome transfection, virus transduction, electroporation, microinjection, particle bombardment or gene gun transformation.

10. The method for editing LPA gene in vitro according to claim 8, characterized in that: The cells include HEK293T cells or HepG2 cells.

Images