PCV2 strain with high multiplication capacity as well as construction method and application of PCV2 strain

Abstract

The invention provides a high-multiplication-capacity PCV2 strain as well as a construction method and application thereof, and belongs to the technical field of vaccine strains. A at a 492bp site of a Cap segment of PCV2 is subjected to point mutation, so that the multiplication capacity of a virus strain can be remarkably enhanced after the point mutation. The invention also provides a primer pair for triggering the point mutation and a method for triggering the point mutation, and also provides application of the mutant strain in preparation of an anti-porcine circovirus vaccine. The embodiment of the invention proves that the multiplication capacity of the porcine circovirus can be obviously improved after the point mutation.

Description

Technical Field

[0001] The present invention belongs to the technical field of vaccine strains, and in particular relates to a PCV2 strain with high proliferation ability and a construction method and application thereof. Background Art

[0002] Porcine circovirus disease (PCVD) is an infectious disease caused by porcine circovirus type 2 (PCV2), which poses a huge threat to the global pig industry. The virus mainly attacks the immune system of pigs, causing immunosuppression, making pigs more susceptible to other pathogens and may show a variety of clinical symptoms, such as postweaning multisystemic wasting syndrome (PMWS), porcine dermatitis and nephritis syndrome (PDNS) and porcine respiratory disease complex (PRDC).

[0003] The immunity of PCV2 vaccine can provide good protection, and the effect is obvious and widely recognized, such as significantly reducing mortality, reducing mortality rate, improving production performance and reducing drug treatment costs. However, in the development of PCV2 vaccine, due to the extremely small genome of PCV2, its coding capacity is limited, resulting in poor in vitro proliferation ability, low virus content in culture, no pathological changes in virus-inoculated cells, difficult determination of virus content, different clinical reactions of virus-infected animals, and difficulty in evaluating immunity. Among them, increasing the antigen amount of the vaccine is the bottleneck of PCV2 vaccine production and application. Therefore, when producing PCV2 vaccine, high-reproduction capacity strains are often selected from clinically isolated strains, and then the vaccine strains are obtained by continuous subculture on the cell line. However, this method has a long research and development cycle and has the problem of limited improvement in reproduction capacity.

[0004] Porcine circovirus disease (PCVD) is an infectious disease caused by porcine circovirus type 2 (PCV2), which poses a huge threat to the global pig industry. The virus mainly attacks the immune system of pigs, causing immunosuppression, making pigs more susceptible to other pathogens and may show a variety of clinical symptoms, such as postweaning multisystemic wasting syndrome (PMWS), porcine dermatitis and nephritis syndrome (PDNS) and porcine respiratory disease complex (PRDC). Summary of the invention

[0005] The present invention provides a PCV2 strain with high proliferation ability, a construction method and an application thereof, and the PCV2 strain with high proliferation ability can be obtained without isolating the strain, and can be used as an antigen material for the production of PCV2 vaccine.

[0006] In a preferred embodiment of the present invention, the A point at the 492 bp of the Cap segment of porcine circovirus is mutated to G.

[0007] The present invention also provides a primer pair for inducing the A point mutation of the 492bp of the porcine circovirus Cap segment to G, comprising nucleotide sequences such as CapA492G-F shown in SEQ ID No.1 and CapA492G-R shown in SEQ ID No.2.

[0008] The present invention also provides a method for inducing the A point mutation of the 492bp of the porcine circovirus Cap segment to G, comprising the following steps: using the porcine circovirus genome as a template, amplifying using the above primer pair, transforming the amplified product into Escherichia coli based on the Dpn I enzyme, selecting a positive strain to extract a PCV2-capA492G plasmid;

[0009] After single restriction digestion of PCV2-capA492G plasmid, the linearized fragments were ligated to obtain circularized plasmid;

[0010] The circularized plasmid was used to transfect host cells to obtain a mutant strain in which the A point at the 492 bp of the Cap segment was mutated to G.

[0011] In a preferred embodiment of the present invention, the source of the porcine circovirus genome includes porcine circovirus type 2 strain.

[0012] In a preferred embodiment of the present invention, the amplification procedure includes: pre-denaturation at 98°C for 30s; denaturation at 98°C for 15s, annealing at 60°C for 5s, extension at 72°C for 10s, 30 cycles; and final extension at 72°C for 1min.

[0013] In a preferred embodiment of the present invention, the host cell comprises PK15 cell.

[0014] The present invention also provides a mutant strain constructed by the above method, in which the A point at the 492 bp of the Cap segment is mutated to G.

[0015] The present invention also provides the use of the mutant strain in preparing anti-porcine circovirus vaccine.

[0016] The present invention also provides an anti-porcine circovirus vaccine, the active ingredients of which include the inactivated strain of the mutant strain.

[0017] Beneficial effect: The present invention provides a method for improving the proliferation ability of porcine circovirus, by making a point mutation to the A at the 492bp site of the Cap segment of the porcine circovirus strain, and after the point mutation, the proliferation ability of the strain can be significantly enhanced. In the embodiment of the present invention, the 492bp site of the Cap segment of the porcine circovirus type 2 strain is mutated to obtain the PCV2-capA492G mutant strain, and the virus titer of the mutant strain is significantly increased compared with the PCV2 wild-type strain; and the Cap protein expression level is significantly improved compared with the PCV2 wild-type strain; using the SYBR Green method for absolute quantitative detection, it is found that the absolute quantitative analysis of the nucleic acid of the mutant strain is significantly improved, which confirms that after the A492G point mutation of the present invention, the proliferation ability of porcine circovirus can be significantly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the result of plasmid single enzyme digestion verification. pMD18-T-PCV2 means that the complete genome sequence of PCV2 strain is completely inserted into T vector. pMD18-T-PCV2-capA492G means that the mutant genome sequence of the 492bp site of the Cap segment of PCV2 strain is completely inserted into T vector.

[0019] Figure 2 is a map of the pMD18-T-PCV2 / PCV2-capA492G plasmid;

[0020] Figure 3 This is the IFA test result diagram;

[0021] Figure 4 This is a picture of the genome sequencing results;

[0022] Figure 5 It is a graph showing the results of virus titer determination of PCV2-capA492G mutant strain and PCV2 wild-type strain;

[0023] Figure 6 The graph is a test result of Cap protein expression level of PCV2-capA492G mutant strain and PCV2 wild-type strain;

[0024] Figure 7 is the absolute quantitative standard curve of PCV2;

[0025] Figure 8 The graph shows the copy number curve of PCV2 cap gene of wild strain and mutant strain detected by absolute quantitative method. DETAILED DESCRIPTION

[0026] The invention provides a method for improving the proliferation ability of porcine circovirus, comprising mutating the A point of the 492 bp of the Cap segment of porcine circovirus into other base types.

[0027] The porcine circovirus referred to in the present invention is PCV2. In one embodiment, the PCV2 strain is used as an example for description, and the Cap segment of the strain is subjected to a point mutation. The present invention performs a point mutation on the Cap segment of the PCV2 strain, and the point mutation is A492N, where N represents T, C or G. In one embodiment, A492G is used as an example for description.

[0028] The present invention also provides a primer pair for inducing the A point mutation of the 492bp of the porcine circovirus Cap segment to G, comprising nucleotide sequences such as CapA492G-F shown in SEQ ID No.1 and CapA492G-R shown in SEQ ID No.2.

[0029] In the embodiment of the present invention, the information of the primer pair may be as follows:

[0030] CapA492G-F (SEQ ID No. 1): ACTCCCGCTACTTTACCCCCAAGCCT;

[0031] CapA492G-R (SEQ ID No. 2): AATAGTGGAATCTAGGACAGGCTTG.

[0032] In the embodiment of the present invention, the primer pair is designed based on the genome of the PCV2 strain and commissioned to Zhejiang Shangya Biotechnology Co., Ltd. for synthesis.

[0033] The present invention also provides a method for inducing the A point mutation of the 492bp of the Cap segment of porcine circovirus to G, comprising the following steps: using the porcine circovirus genome as a template, amplifying using the above primer pair, transforming the amplified product into Escherichia coli based on the Dpn I enzyme, selecting positive strains and extracting to obtain the pMD18-T-PCV2-capA492G plasmid;

[0034] The pMD18-T-PCV2-capA492G plasmid and the T vector containing the porcine circovirus genome were digested with the same enzyme, and the linearized fragments were connected to obtain a circularized plasmid;

[0035] The circularized plasmid was used to transfect host cells to obtain a mutant strain in which the A point at the 492 bp of the Cap segment was mutated to G.

[0036] The present invention uses the primer pair shown in SEQ ID No.1 and SEQ ID No.2. In one embodiment, a plasmid containing a PCV2 genome is used as a template, such as a recombinant T vector (pMD18-T-PCV2 plasmid) containing the PCV2 genome, to amplify a gene fragment with a point mutation at the Cap492 site. The amplification system is calculated in 50 μL and includes: 2×phanta flashmastermix 25 μL, ddH2O 19 μL, primer F 2 μL, primer R 2 μL and template (pMD18-T-PCV2) 2 μL. The amplification program includes: pre-denaturation at 98°C for 30 seconds; denaturation at 98°C for 15 seconds, annealing at 60°C for 5 seconds, extension at 72°C for 10 seconds, 30 cycles; and final extension at 72°C for 1 minute.

[0037] The present invention recovers the PCR product obtained by amplification through gel and then digests it with Dpn I enzyme, then transforms the digested amplified fragment into Escherichia coli, evenly spreads the transformed bacterial solution on an ampicillin-resistant solid culture medium, cultures it overnight, selects a single colony for sequencing, and extracts the plasmid after the sequencing is correct, thereby obtaining the pMD18-T-PCV2-capA492G plasmid.

[0038] The present invention performs single enzyme digestion of the pMD18-T-PCV2-capA492G plasmid to obtain a linearized plasmid. In one embodiment, single enzyme digestion is performed by EcoR I fast digester, and the target fragment is recovered and then cyclized to obtain a circularized plasmid. Since the PCV2 genome is a single-stranded circular DNA, and the genome recovered after enzyme digestion is a linear DNA, the present invention needs to use T4 ligase for ligation to obtain a circularized plasmid.

[0039] The present invention utilizes the circularized plasmid to transfect host cells, such as PK15 cells. The present invention does not specifically limit the method for transfecting host cells, for example, in one embodiment, refer to the operating instructions of JetPRIME transfection reagent.

[0040] The present invention also provides a mutant strain constructed by the above method, in which the A point at the 492 bp of the Cap segment is mutated to G.

[0041] In one embodiment of the present invention, the 492bp site of the Cap segment of the porcine circovirus type 2 strain is mutated to obtain a PCV2-capA492G mutant strain. Compared with the PCV2 wild-type strain, the viral titer of the mutant strain is significantly increased; and compared with the PCV2 wild-type strain, the Cap protein expression level is significantly improved; using the SYBR Green method for absolute quantitative detection, it is found that the absolute quantitative analysis of the mutant strain nucleic acid is significantly improved. Based on this, the method of the present invention can be used to increase the yield of PCV2 under the same cost conditions to prepare a high-titer PCV2 vaccine.

[0042] The present invention also provides the use of the mutant strain in preparing anti-porcine circovirus vaccine.

[0043] The anti-porcine circovirus vaccine of the present invention may be an inactivated vaccine.

[0044] The present invention also provides an anti-porcine circovirus vaccine, the active ingredients of which include the inactivated strain of the mutant strain.

[0045] The present invention does not specifically limit the preparation method of the vaccine and the content of the inactivated strain therein, which can be determined using conventional means in the art.

[0046] In order to further illustrate the present invention, a high proliferation capacity PCV2 strain, construction method and application provided by the present invention are described in detail below in conjunction with examples, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1 Rescue of infectious clones with mutations in PCV2 cap 492

[0048] 1. Primer design and target fragment amplification

[0049] Two primers were designed according to the porcine circovirus type 2 strain. The primers were synthesized by Zhejiang Shangya Biotechnology Co., Ltd. The primer information is shown in SEQ ID No.1 and SEQ ID No.2.

[0050] by Figure 2 The pMD18-T-PCV2 (i.e., the complete genome sequence of PCV2 strain was inserted into the T vector) is shown in FIG. ) The plasmid was used as a template to PCR amplify the Cap 492 site mutation gene fragment. The reaction system was as follows:

[0051] 50μL system: 2× phanta flash master mix 25μL, upstream and downstream primers 2μL each, pMD18-T-PCV2 2μL and ddH2O 19μL.

[0052] Program: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 15 s, annealing at 60°C for 5 s, extension at 72°C for 10 s, 30 cycles; final extension at 72°C for 1 min.

[0053] The PCR products were identified by 1% agarose gel electrophoresis and then recovered.

[0054] 2. Dpn I enzyme digestion

[0055] Take 10 μL of PCR product, 5 μL of Dpn I enzyme and 2 μL of 10× enzyme buffer, and digest at 37°C for 30 min.

[0056] 3. Conversion

[0057] The competent E. coli cells were taken out from the -80°C refrigerator and thawed on ice. After thawing, the mixture digested with Dpn I was added to the sterile clean bench, mixed well, and placed on ice for 30 minutes. After the ice bath, the competent cells were placed in a 42°C water bath for 90 seconds, and then placed on ice for another 3 minutes. The bacterial solution was evenly spread on the ampicillin-resistant LB solid culture medium using a bacterial spreader stick and cultured in a 37°C incubator overnight.

[0058] 4. Spot picking and sequencing

[0059] The plaques grown on the overnight cultured ampicillin-resistant solid culture medium were picked up with a sterile pipette tip into 1 mL of ampicillin-resistant LB liquid culture medium, and cultured at 37°C in a shaking incubator for about 1 hour. Then, about 200 μL of the bacterial solution in the tube was aspirated and sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing. After the sequencing was correct, the plasmid was extracted.

[0060] 5. Plasmid single enzyme digestion

[0061] The constructed pMD18-T-PCV2-capA492G plasmid and pMD18-T-PCV2 full genome plasmid were digested with EcoR I enzyme, respectively, at 37°C for 30 min;

[0062] 20 μL system: EcoR I enzyme 1 μL, plasmid 1 μg, Buffer 2 μL and balance ddH2O.

[0063] 6. Rubber tapping and recovery of enzyme cleavage products

[0064] The digestion products were identified by 1% agarose gel electrophoresis. The larger band was the pMD18-T empty band, and the lower band was 1767 bp in size, i.e., the target band ( Figure 1 ), use a nucleic acid gel recovery kit to cut and recover the target band in the gel, and determine the concentration.

[0065] 7.T4 ligase ligation and circularization

[0066] Since the PCV2 genome is a single-stranded circular DNA, and the genome recovered after enzyme digestion is a linear DNA, it needs to be connected using T4 ligase. The system is 30μL of recovered product, 4μT4 ligase, and 4μT4 ligation buffer; the connection conditions are 16°C, 4h or overnight.

[0067] 8. Transfection

[0068] PK15 cells were plated in six-well plates or twelve-well plates (depending on the plasmid concentration), and the ligation products were transfected within 24 hours. For specific operations, refer to the instructions for the JetPRIME transfection reagent.

[0069] 9.IFA inspection

[0070] The transfected cells were subcultured for 5-6 generations, and then some cells were plated and tested by IFA. If an obvious Cap positive signal appeared, it indicated that the PCV2 cap 492 site (PCV2-capA492G) mutant strain was successfully rescued ( Figure 3 ).

[0071] 10. Genome Identification

[0072] The genomic DNA of PCV2 and its mutant infectious clone strains was extracted using a viral genome extraction kit, and the genome was compared. The sequencing results showed that the A at Cap 492 of the mutant infectious clone strain was successfully mutated to G ( Figure 4 ), named PCV2-CapA492G mutant strain.

[0073] Example 2 Improving the replication of PCV2 using the PCV2-CapA492G mutant strain constructed in Example 1

[0074] 1. PK15 cells were plated in 24-well cell culture plates. After 12 hours, PCV2-capA492G mutant strain and PCV2 wild-type strain were inoculated in 24-well plates at MOI=1. The medium was changed after two hours of inoculation. Samples were collected at hpi=12, 24, 36, 48, 60, and 72 for virus titer determination, SDS-WB and absolute quantitative analysis of viral nucleic acid.

[0075] 2. Virus titer determination: TCID of the virus solution was measured using a 96-well cell culture plate. 50Determination. The collected cell samples were frozen at -70°C and frozen and thawed three times, then centrifuged at 4°C 12,000rpm for 10 minutes to remove cell debris and collect the supernatant. The virus solution was diluted 10 times with DMEM medium and added to the newly plated PK-15 cell suspension. Six replicate wells were set for each dilution. After 72 hours of infection, the Cap-positive wells were counted by indirect immunofluorescence assay (IFA), and the cells were fixed for immunofluorescence staining. The cells were incubated at 36°C for 1h 30min with Cap5E11 mouse monoclonal antibody, incubated at 36°C for 45min with FITC-labeled goat anti-mouse secondary antibody, and DAPI was used to stain the nucleus for 10min. The Cap5E11 monoclonal antibody was prepared and preserved by the Key Laboratory of Animal Virology, Ministry of Agriculture and Rural Affairs; FITC-goat anti-mouse was purchased from KPL Company (5230-0427). The virus titer was calculated according to the Reed-Muench method, and the virus growth curve was finally drawn; the results showed that the virus titer of the PCV2-capA492G mutant strain was significantly increased compared with the PCV2 wild-type strain ( Figure 5 ), data see Table 1.

[0076] Table 1 Virus titer

[0077]

[0078] 3. SDS-WB experimental analysis; Use 10% SDS-PAGE gel, load the sample, 80V for 30min, and run at 120V to the appropriate position; Use nitrocellulose membrane (NC membrane) for transfer, and transfer at a constant flow for about 30min; Block with 5% skim milk prepared with 0.1% Tween-20 PBS at room temperature for 1h; Incubate Cap5E11, Rep2H10 and β-actin primary antibodies according to the band size, and incubate slowly at 4°C overnight. Rep2H10 monoclonal antibody was prepared and preserved by the Key Laboratory of Animal Virology, Ministry of Agriculture and Rural Affairs; β-actin mouse antibody (M1210-2) was purchased from Huaan Biotechnology Co., Ltd. (Hangzhou). After washing, add the corresponding HRP-labeled secondary antibody and incubate at room temperature for 1h; The results showed that the expression level of Cap protein in the PCV2-capA492G mutant strain was significantly increased compared with the PCV2 wild-type strain ( Figure 6 ).

[0079] 4. Absolute quantitative analysis of viral nucleic acid: After adding Trizol to the supernatant, mix it upside down, then add 200 μL of chloroform, and after vigorous shaking, let the mixture stand at room temperature for 10 minutes, then centrifuge at 12,000×g for 10 minutes at 4°C, take out the 1.5mL EP tube without RNase, carefully pipette the supernatant into it, add an equal volume of isopropanol to mix, let it stand for 20 minutes, centrifuge at 12,000×g for 10 minutes, discard the supernatant, add 75% ethanol (prepared with DEPC-Treated Water) to the white RNA precipitate, centrifuge at 12,000×g for 10 minutes at 4°C, discard the supernatant; dry at room temperature for 10 minutes, and finally add 10-20 μL DEPC H2O (DNase and RNase Free) to dissolve. Detect RNA concentration and reverse transcribe using the Novozyme reverse transcription kit. The SYBR Green method was used for absolute quantitative detection, and the PCV2 cap gene copy number was calculated using the formula Y = 46.01-4.3818X ( Figure 7 , Figure 8 ), data see Table 2.

[0080] Table 2 PCV2 cap gene copy number

[0081]

[0082] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for improving the proliferation ability of porcine circovirus, characterized in that: It includes mutating the A point of the 492bp of the Cap segment of porcine circovirus into other base types.

2. The method according to claim 1, characterized in that: It includes mutating the A point at the 492bp of the Cap segment of porcine circovirus to G.

3. A primer pair that induces a point mutation of A to G at 492 bp of the Cap segment of porcine circovirus, characterized in that: The nucleotide sequences include CapA492G-F shown in SEQ ID No.1 and CapA492G-R shown in SEQ ID No.

2.

4. A method for inducing a point mutation of A at 492 bp of the Cap segment of porcine circovirus to G, characterized in that: The following steps are involved: Using the porcine circovirus genome as a template, amplification is performed using the primer pair described in claim 3, the amplified product is transformed into Escherichia coli based on the Dpn I enzyme, and the positive strain is selected to extract the PCV2-capA492G plasmid; After single restriction digestion of PCV2-capA492G plasmid, the linearized fragments were ligated to obtain circularized plasmid; The circularized plasmid was used to transfect host cells to obtain a mutant strain in which the A point at the 492 bp of the Cap segment was mutated to G.

5. The method according to claim 4, characterized in that: The source of the porcine circovirus genome includes porcine circovirus type 2 strain.

6. The method according to claim 4, characterized in that: The amplification procedure includes: pre-denaturation at 98°C for 30s; denaturation at 98°C for 15s, annealing at 60°C for 5s, extension at 72°C for 10s, 30 cycles; and final extension at 72°C for 1min.

7. The method according to claim 4, characterized in that: The host cells include PK15 cells.

8. A mutant strain constructed by the method according to any one of claims 4 to 7 in which the A point at 492 bp of the Cap segment is mutated to G.

9. Use of the mutant strain according to claim 8 in the preparation of an anti-porcine circovirus vaccine.

10. An anti-porcine circovirus vaccine, characterized in that: The active ingredient comprises an inactivated strain of the mutant strain according to claim 8.

Images