Nano preparation for accurate diagnosis and treatment of early pulmonary fibrosis and preparation method thereof

Abstract

The invention discloses a nano preparation for accurate diagnosis and treatment of early pulmonary fibrosis and a preparation method, the nano preparation is loaded with a diagnostic gene and an anti-pulmonary fibrosis drug at the same time, and can express fluorescent protein 1-Linker1-DEVD-Linker2-fluorescent protein 2, after being specifically recognized and cut off by apoptosis-associated protein (Caspase-3) in AECs II, the fluorescent resonance energy transfer phenomenon is triggered to generate fluorescence change, so that accurate diagnosis of early pulmonary fibrosis is realized; the consumption of the expressed protein on Caspase-3 further inhibits the excessive activation of an AECs II pro-inflammatory pathway, and the expressed protein and an anti-pulmonary fibrosis drug synergistically regulate the AECs II homeostatic equilibrium, thereby achieving the purpose of reversing pulmonary fibrosis. The preparation method of the nano preparation is simple, the required raw materials are cheap and easy to obtain, the biological safety is high, and the nano preparation has certain clinical transformation potential.

Description

Technical Field

[0001] The present invention generally relates to the field of molecular technology drugs, and more specifically, to a method for preparing a nanoformulation for accurate diagnosis and treatment of early pulmonary fibrosis, as well as a nanoformulation and a pharmaceutical use of the nanoformulation. Background Art

[0002] Pulmonary fibrosis is an interstitial lung disease with a very high mortality rate and unknown etiology, and its clinical manifestations are progressive dyspnea and asphyxia. At present, the clinical treatment of pulmonary fibrosis is mainly based on pirfenidone and nintedanib, but they can only relieve the patient's respiratory depression symptoms and cannot achieve the reversal of pulmonary fibrosis. This is closely related to the lack of efficient and accurate diagnostic methods for pulmonary fibrosis. At present, the clinical diagnosis of pulmonary fibrosis is mainly based on high-resolution computed tomography (HRCT), which has a relatively accurate diagnostic effect on late-stage pulmonary fibrosis where the lung structure has been destroyed and there is no possibility of reversal, but its clinical significance is relatively small; because the pathological characteristics of early pulmonary fibrosis are extremely similar to pneumonia, it is easy to be misdiagnosed by HRCT, and the treatment window period is missed, resulting in treatment delays. Therefore, nanoformulations that can achieve complete reversal of pulmonary fibrosis through precise diagnosis and coordinated drug treatment are urgently needed in clinical practice.

[0003] In the initial stage of pulmonary fibrosis, continuous damage and apoptosis of type II alveolar epithelial cells (AECs II) are the key causes of the occurrence and development of the disease. The imbalance of mitochondrial oxidative stress in damaged AECs II induces the activation of quiescent cysteine-aspartate proteinase-2 (caspase-3), which further leads to the activation of pro-inflammatory pathways in AECs II and abnormal expression of related cytokines, thereby causing excessive proliferation of myofibroblasts and accelerating the formation and development of early pulmonary fibrosis.

[0004] Diagnostic genes can identify abnormally expressed biomolecules at the molecular level and present visible fluorescence. However, during treatment, the base fragments of diagnostic genes are recognized or degraded by enzymes and phagocytes in the circulation system, resulting in a short circulation time in the body and low efficiency in reaching the target site. Therefore, the development of nanoformulations that simultaneously deliver diagnostic genes and anti-pulmonary fibrosis drugs has certain difficulties and positive effects in achieving the reversal of pulmonary fibrosis. Summary of the invention

[0005] According to an embodiment of the present invention, a preparation method of a nanoparticle preparation with a diagnostic gene is provided, and the specific steps of the preparation method include:

[0006] a. Constructing a recombinant plasmid expressing fluorescent protein 1-Linker1-DEVD-Linker2-fluorescent protein 2 to obtain the diagnostic gene Ft;

[0007] b. Take cationic lipid CL, amphiphilic lecithin, liposomal phospholipids, cholesterol and hydrophilic / hydrophobic anti-pulmonary fibrosis drugs fully dissolved in a water-immiscible organic solvent, the organic solvent was rotary evaporated under water bath conditions to form a thin film, ultrapure water was added for water bath ultrasonic oscillation, and then ultrasonic crusher fully homogenized into a suspension;

[0008] c. Dissolve the diagnostic gene Ft in enzyme-free ultrapure water, add it to the suspension and mix thoroughly, then let it stand at room temperature to obtain a nanoparticle preparation with a diagnostic gene.

[0009] The organic solvent is dichloromethane or chloroform.

[0010] Furthermore, the base sequence of the DEVD is shown in SEQ ID No.4.

[0011] Furthermore, the fluorescent protein is selected from EYFP, ECFP, EBFP or EGFP, and the fluorescent protein 1 and the fluorescent protein 2 are different from each other.

[0012] Further, the linker is selected from glycine-serine polymers: GGSG, SGGG, (GGGGS)n, (GGGS)n, (GGS)n, (GS)n or (G)n, wherein n is selected from 1, 2, 3, 4, 5 or 6; alanine-serine polymers and α-helical linkers: (EAAAK)n, wherein n is selected from 1, 2, 3, 4, 5 or 6.

[0013] Furthermore, the base sequence of Linker1-DEVD-Linker2 is as follows: gctgccgccgccgtccacctca tctccgccgccaga .

[0014] The base sequence of fluorescent protein 1 is as follows:

[0015] cttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggtctttgctcagggcggactggtagctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatgggggtgttctgctggtagtggtcggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttcaccttgatgccgttcttctgcttgtcggccatgatatagacgttgtggctgttgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgcggttcaccagggtgtcgccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcggacttgaagaagtcgtgctgcttcatgtggtcggggtagcgggcgaagcactgcaggccgtagccgaaggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtcagcttgccgtaggtggcatcgccctcgccctcgccggacacgctgaacttgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccccggtgaacagctcctcgcccttgctcaccat

[0016] The base sequence of Fluorescent Protein 2 is shown as follows:

[0017] ttacttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggtc tttgctcagggcggactgggtgctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatgggggtgttctgctggtagtggtc ggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttggccttgatgccgttcttctgcttgtcggcggtgatatagac gttgtggctgatgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgcggttcac cagggtgtcgccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcggacttgaagaagtcgtgctgcttcatgtggtcggggtagcggctgaagcactgcacgccccaggtcagggtggtcacgag ggtgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtcagcttgccgtaggtggcatcgccctcgccctcgccggacacgctgaacttgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccacccggtgaacagctcctcgcccttgctcaccat

[0018] Furthermore, by mass ratio, the cationic lipid CL: amphiphilic phosphatidylcholine P: DSPE-xPEGy: cholesterol: hydrophilic / hydrophobic anti-pulmonary fibrosis drug is 14:4:1:2:0.8.

[0019] Furthermore, the cationic lipid CL is selected from at least one of DOTAP, DOTMA, DODMA, DC-cholesterol, and Dlin-MC3-DMA.

[0020] Furthermore, the amphiphilic lecithin is selected from at least one of soybean lecithin, egg yolk lecithin, hydrogenated lecithin, deoxy lecithin and isolecithin.

[0021] Furthermore, the liposome phospholipid is DSPE-xPEGy, wherein x is selected from at least one of -CH3, -NH2, -COOH, -MAL, and -OCH3; and the molecular weight of y is selected from at least one of 1000, 2000, and 5000.

[0022] Furthermore, the hydrophobic anti-fibrotic drug is selected from nintedanib, imatinib, gefitinib, dasatinib, sorafenib, ibrutinib, sildenafil, minoxidil, treprostinil, atorvastatin, azithromycin, rapamycin, vildagliptin, olopatadine, and idebenone; or the hydrophilic anti-fibrotic drug is selected from at least one of pirfenidone, metformin, N-acetylcysteine, ambroxol, minocycline, linopril, losartan, cangrelor, doxycycline, and minocycline.

[0023] In a second aspect of the present invention, a nanoformulation is provided that simultaneously carries a diagnostic gene and an anti-pulmonary fibrosis drug.

[0024] In a third aspect of the present invention, a method for preparing an anti-pulmonary fibrosis drug is provided.

[0025] Compared with the prior art, the beneficial effect of the present invention is to provide a precise diagnostic and therapeutic nano-preparation loaded with diagnostic genes and anti-fibrosis drugs and having efficient gene transfection ability. The nano-preparation has a uniform structure and is positively charged. The diagnostic genes are efficiently loaded on positively charged nanoparticles to reduce the risk of degradation and phagocytosis, and are taken up by damaged AECs II in early pulmonary fibrosis through the combination of positive and negative charges, and the loaded diagnostic genes and anti-fibrosis drugs are released after escaping through lysosomes. It has high-efficiency transfection ability, and its transfection efficiency is better than that of the commercially available transfection reagent lipofectamine 3000; it can highly express proteins with EYFP-SGGGDEVDGGGS-ECFP fragments that are specifically recognized by Caspase-3. After overexpressed caspase-3 in cells in early pulmonary fibrosis recognizes and cuts the protein, it triggers the fluorescence energy resonance transfer phenomenon to cause fluorescence changes, and the fluorescence of CFP and YFP is detected at the same time, thereby achieving the purpose of accurate diagnosis of pulmonary fibrosis. At the same time, the consumption of Caspase-3 further inhibits the activation of AECs II pro-inflammatory response and the expression and secretion of pro-inflammatory cytokines, and further cooperates with anti-pulmonary fibrosis drugs to block the activation and excessive proliferation of myofibroblasts, thereby achieving the purpose of reversing pulmonary fibrosis and realizing accurate diagnosis and treatment of early pulmonary fibrosis.

[0026] The present invention achieves the technical effect of accurate diagnosis and reversal treatment of early fibrosis at the molecular level. Rational design of diagnostic genes to achieve synergistic effects of diagnosis and treatment is an important strategy for reversing early pulmonary fibrosis. The nanoparticles prepared by the present invention have the advantages of good biocompatibility and degradability, and have great potential for clinical application.

[0027] It should be understood that the contents described in the summary of the invention are not intended to limit the key or important features of the embodiments of the present invention, nor are they intended to limit the scope of the present invention. Other features of the present invention will become easily understood through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The above and other features, advantages and aspects of the embodiments of the present invention will become more apparent with reference to the following detailed description in conjunction with the accompanying drawings. In the accompanying drawings, the same or similar reference numerals represent the same or similar elements, wherein:

[0029] Figure 1 is a sequence map of the diagnostic gene Ft according to an embodiment of the present invention;

[0030] Figure 2 is a flow chart of the preparation of the precise diagnosis and treatment nanoformulation GMT-GN according to an embodiment of the present invention;

[0031] Figure 3 It is a characteristic image of particle size, potential and morphology of the precise diagnosis and treatment nano-preparation GMT-GN according to an embodiment of the present invention;

[0032] Figure 4 is the loading efficiency of the precise diagnosis and treatment nanoparticle preparation GMT-G for diagnostic genes according to the embodiment of the present invention;

[0033] Figure 5 It is the loading condition of the anti-pulmonary fibrosis drug by the precise diagnosis and treatment nanoformulation GMT-GN according to the embodiment of the present invention;

[0034] Figure 6 It is the delivery efficiency (cellular uptake, lysosomal escape) of the precise diagnosis and treatment nanoformulation GMT-GN for diagnostic genes and anti-pulmonary fibrosis drugs according to the embodiments of the present invention;

[0035] Figure 7 is the transfection efficiency of the diagnostic gene by the precise diagnosis and treatment nanoparticle preparation GMT-G according to the embodiment of the present invention;

[0036] Figure 8 It is an accurate diagnostic evaluation of damaged AECs II at the in vitro level by the accurate diagnosis and treatment nanoparticle preparation GMT-G according to the embodiment of the present invention;

[0037] Fig. 9 It is the efficacy evaluation of the precise diagnosis and treatment nanoformulations GMT-GN and GMT-G in repairing the damaged AECs II mitochondrial membrane potential in vitro according to the embodiments of the present invention;

[0038] Fig.10The anti-pulmonary fibrosis effects of the precision diagnosis and treatment nanoformulations GMT-G and GMT-GN on pulmonary fibrosis mice according to the embodiments of the present invention were evaluated by H&E staining and Masson. DETAILED DESCRIPTION

[0039] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0040] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0041] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0042] In addition, the term "and / or" in this article is only a description of the association relationship between the associated objects, indicating that there can be three relationships. For example, A and / or B can represent: A exists alone, A and B exist at the same time, and B exists alone. In addition, the character " / " in this article generally indicates that the associated objects before and after are in an "or" relationship.

[0043] Example 1

[0044] The specific preparation steps of EYFP-Linker-DEVD-Linker-ECFP are as follows:

[0045] (1)① Primers were designed for the Linker1-DEVD-Linker2 (hereinafter referred to as pLinker) cDNA shown in SEQ ID No.3, the forward primer sequence: 5'-gcatggacgagctgtacaagtctggcggcggagatgaggtggacggcggcggcagc-3', SEQ ID No.6; the reverse primer sequence: 5'-gcccttgctcaccatgctgccgccgccgtccacctcatctccgccgccaga-3', SEQ ID No.7.

[0046] ②Use the even-numbered long primers obtained in step ① to perform PCR amplification by alternating overlapping extension to obtain a PCR product, i.e., a small fragment pLinker cDNA with a length of about 36 bp, with an annealing temperature of 60°C.

[0047] PCR system:

[0048] pLinker cDNA: 1 μl

[0049] 0.2μM forward primer: 1μl

[0050] 0.2μM reverse primer: 1μl

[0051] 2×NovoStart SYBR qPCR SuperMix Plus*: 10μl

[0052] Make up to 20 μl with RNase Free Water.

[0053] The PCR amplification program was 95°C, 1 min; single cycle 95°C, 20 s, 60°C, 1 min; repeated 40 cycles.

[0054] ③ The PCR product in step ② was digested with BamHI enzyme to generate sticky ends. Meanwhile, pEYFP cDNA (purchased from Clontech, USA) was digested with BamHI enzyme to generate sticky ends. pEYFP cDNA and pLinker cDNA were recombined by ligation reaction. The ligation reaction system (20 μl) was:

[0055] pLinker cDNA fragment (with sticky ends): 0.25 μl (1.2 pmol)

[0056] pEYFP cDNA vector (with sticky ends): 1.23 μl (0.4 pmol)

[0057] Enzyme-free sterile water: 18.52 μl

[0058] Mix the three liquids, place in a 45°C water bath for 5 minutes to melt the reannealed sticky ends, and quickly place in ice after 5 minutes, keep for 2 minutes, and add

[0059] 10×Taq DNA Ligase Reaction Buffer (containing NAD+): 2μl

[0060] Taq DNA polymerase: 1 μl

[0061] After the reaction system is completely mixed, the centrifuge tube containing the reaction system is centrifuged to allow the reagents in the reaction system to fully contact. The centrifuge tube is placed in a constant temperature incubator at 4°C for overnight connection reaction (12-16h). After the enzyme digestion reaction is completed, the centrifuge tube is taken out and placed on ice to terminate the reaction. The fragments after enzyme digestion are purified; 1.2% agarose gel electrophoresis is performed for identification, and the pEYFP-Linker cDNA vector is recovered by agarose gel. The pEYFP-Linker cDNA is recovered using a column DNA gel recovery kit (purchased from Bio-Tech Biotech Co., Ltd.).

[0062] (2) Using pEYFP-Linker cDNA as a template, PCR amplification was performed to obtain a PCR amplified fragment, which was then digested with NheI and BamHI, wherein the digestion reaction system was:

[0063] Purified DNA fragment: 1 μg

[0064] Nhe I enzyme: 0.25 μl

[0065] BamHI enzyme: 0.25 μl

[0066] 1×CutOneTM Buffer:1.5μl

[0067] Sterile water: 12 μl

[0068] After the reaction system is completely mixed, the centrifuge tube containing the reaction system is centrifuged to allow the reagents in the reaction system to fully contact. The centrifuge tube is placed in a constant temperature incubator with a preset temperature of 37°C for enzyme digestion reaction for 4 hours. After the enzyme digestion reaction is completed, the centrifuge tube is taken out and placed on ice to terminate the reaction. The fragments after enzyme digestion are purified; 1.2% agarose gel electrophoresis is performed for identification, and the pEYFP-Linker fragment is recovered by agarose gel recovery column DNA gel recovery kit (purchased from Bio-Tech Biotech Co., Ltd.).

[0069] (3) pECFP-N1 (purchased from Clontech, USA) was purified by digestion with NheI and BamHI, wherein the digestion reaction system was:

[0070] Purified DNA fragment: 1 μg

[0071] Nhe I enzyme: 0.25 μl

[0072] BamHI enzyme: 0.25 μl

[0073] 1×CutOneTM Buffer:1.5μl

[0074] Sterile water: 12 μl

[0075] After the reaction system is completely mixed, the centrifuge tube containing the reaction system is centrifuged to allow the reagents in the reaction system to fully contact. The centrifuge tube is placed in a constant temperature incubator with a preset temperature of 37°C for enzyme digestion reaction for 4 hours. After the enzyme digestion reaction is completed, the centrifuge tube is taken out and placed on ice to terminate the reaction. The fragments after enzyme digestion are purified; 1.2% agarose gel electrophoresis is performed for identification, and the pECFP-N1 vector is recovered by agarose gel recovery column DNA gel recovery kit for pECFP-N1 recovery (purchased from Bio-Tech Bio Co., Ltd.).

[0076] (4) pEYFP-Linker was connected to pECFP-N1, wherein the connection reaction system (20 μl) was:

[0077] pEYFP-Linker fragment (containing sticky ends): 0.39 μl (0.12 pmol)

[0078] pECFP-N1 vector (containing sticky ends): 1.12 μl (0.04 pmol)

[0079] Enzyme-free sterile water: 18.49 μl

[0080] Mix the three liquids, place in a 45°C water bath for 5 minutes to melt the reannealed sticky ends, and quickly place in ice after 5 minutes, keep for 2 minutes, keep in an ice bath, and add:

[0081] 10×Taq DNA Ligase Reaction Buffer (contains NAD + ): 2μl

[0082] Taq DNA polymerase: 1 μl

[0083] After the reaction system is completely mixed, the centrifuge tube containing the reaction system is centrifuged to allow the reagents in the reaction system to fully contact each other. The centrifuge tube is placed in a constant temperature incubator at 4°C for overnight (12-16 hours) connection reaction.

[0084] (5) Take 20 μl of E. coli DH5 competent cell suspension from the -70℃ refrigerator, thaw it at room temperature, and immediately place it on ice. Add 10 μl of the ligation product solution and shake gently. Place it on ice for 30 minutes, then place it in a 37℃ water bath for 5 minutes. After the heat shock, quickly place it on ice to cool for 3-5 minutes.

[0085] (6) Add 1 ml of LB liquid culture medium (without kanamycin antibiotics) to tube (5), mix well and culture at 37°C with shaking for 1 hour to allow the bacteria to resume normal growth and express the plasmid-encoded kanamycin antibiotic resistance gene (KanR / NeoR).

[0086] (7) After shaking the above bacterial solution, take 100 μl and spread it on a screening plate containing kanamycin antibiotics. Place it face up for half an hour. After the bacterial solution is completely absorbed by the culture medium, invert the culture dish and culture it at 37°C for 16-24 hours.

[0087] (8) Use a sterile toothpick to pick a single white colony and inoculate it into 5 ml LB liquid medium containing kanamycin antibiotics, and shake and culture it at 37°C for 12 hours. Use the Omega Rapid Plasmid Extraction Kit to isolate plasmid DNA, and digest the isolated plasmid DNA with NheI and BamHI. The digestion steps are the same as step (2). The digested fragments and the pEYFP-Linker fragment are subjected to 1.2% agarose gel electrophoresis. It can be found that the sizes of the two fragments are consistent, proving that the pEYFP-Linker fragment has been successfully recombined on the pECFP-N1 vector to form EYFP-Linker-DEVD-Linker-ECFP.

[0088] (9) Collect and freeze the competent E. coli DH5 that successfully expresses EYFP-Linker-DEVD-Linker-ECFP.

[0089] EYFP-Linker-DEVD-Linker base sequence 5'-3' SEQ ID No.1:

[0090] cttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggtctttgctcagggcggactggtagctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatgggggtgttctgctggtagtggtcggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttcaccttgatgccgttcttctgcttgtcggccatgatatagacgttgtggctgttgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgcggttcaccagggtgtcgccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcggacttgaagaagtcgtgctgcttcatgtggtcggggtagcgggcgaagcactgcaggccgtagccgaaggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtcagcttgccgtaggtggcatcgccctcgccctcgccggacacgctgaacttgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccccggtgaacagctcctcgcccttgctcaccat gctgccgccgccgtccacctcatctccgccgccaga

[0091] Note: The underlined part is the base sequence of Linker1-DEVD-Linker2.

[0092] ECFP base sequence 5'-3' SEQ ID No.2:

[0093] ttacttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggtctttgctcagggcggactgggtgctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatgggggtgttctgctggtagtggtcggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttggccttgatgccgttcttctgcttgtcggcggtgatatagacgttgtggctgatgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgcggttcaccagggtgtcgccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcggacttgaagaagtcgtgctgcttcatgtggtcggggtagcggctgaagcactgcacgccccaggtcagggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtcagcttgccgtaggtggcatcgccctcgccctcgccggacacgctgaacttgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccccggtgaacagctcctcgcccttgctcaccat

[0094] Linker1-DEVD-Linker2 base sequence 5'-3' SEQ ID No.3:

[0095] gctgccgccgccgtccacctcatctccgccgccaga

[0096] DEVD base sequence SEQ ID No.4: gtccacctcatc

[0097] Linker1-DEVD-Linker2 protein sequence SEQ ID No.5:

[0098] SGGGDEVDGGGS

[0099] In some embodiments, blue fluorescent protein (EBFP) or green fluorescent protein (EGFP) may be used instead of EYFP or ECFP, and the fluorescent proteins at both ends of the Linker protein sequence are different.

[0100] In some embodiments, other fusion protein linkers can also be used at both ends of the sensitive peptide sequence -DEVD-, such as glycine-serine polymers: GGSG, SGGG, (GGGGS)n, (GGGS)n, (GGS)n, (GS)n or (G)n, wherein n is selected from 1, 2, 3, 4, 5 or 6); alanine-serine polymers and α-helical linkers ((EAAAK)n, wherein n is selected from 1, 2, 3, 4, 5 or 6). Those skilled in the art can also design peptides conjugated to any desired element that may include all or part of a flexible linker, so that the linker may include a flexible linker. The hinge domain sequence may contain glycine, alanine and / or serine residues.

[0101] In this embodiment, after the diagnosis-promoting gene Ft in GMT-GN and GMT-G is expressed, the sensitive peptide sequence -DEVD- in the protein EYFP-SGGGDEVDGGGS-ECFP can be specifically recognized and cut off by the over-expressed caspase-3 in the damaged AECs II cells. The cut protein can detect the fluorescence of CFP and YFP at the same time. Normal cells have only a very small amount of caspase-3, which cannot cut off the protein EYFP-SGGGDEVDGGGS-ECFP. The fluorescent protein CFP transfers energy to YFP, and only the fluorescence of YFP can be detected, thereby achieving accurate diagnosis of early pulmonary fibrosis.

[0102] Example 2

[0103] Preparation process of precision diagnosis and treatment nanoparticles GMT-GN, GMT-G and GMT-N

[0104] (1) Preparation steps of GMT-GN by thin film dispersion method: accurately weigh 3.5 mg of cationic liposome DOTAP, 1 mg of soybean lecithin, 0.5 mg of cholesterol, and DSPE-mPEG 2000(Distearoylphosphatidylethanolamine-polyethylene glycol) 0.25 mg and nintedanib 0.2 mg were fully dissolved in 2 mL of chloroform. The chloroform solution was completely evaporated by a rotary evaporator in a 40°C water bath to form a thin film of the above-mentioned carrier material, which was evenly distributed in a round-bottom beaker. 3 mL of ultrapure water was added to the round-bottom beaker, and after ultrasonic oscillation in a water bath for 10 minutes, the nanoformulation was fully homogenized using an ultrasonic crusher for 10 minutes (to obtain GMT-N) to form a suspension. 5 μg of the diagnostic gene Ft was dissolved in enzyme-free ultrapure water and quickly added to the nanoformulation suspension and fully mixed. Then, the mixture was allowed to stand at room temperature for 2 hours to obtain the precise diagnosis and treatment nanoformulation GMT-GN. The preparation flow chart is as follows: Figure 2 shown.

[0105] (2) Preparation steps of GMT-G by thin film dispersion method: accurately weigh 3.5 mg of cationic lipid DOTAP, 1 mg of soybean lecithin, 0.5 mg of cholesterol, and DSPE-mPEG 2000 0.25 mg was fully dissolved in 2 mL of chloroform, and the chloroform solution was completely evaporated by a rotary evaporator in a 40°C water bath to form a thin film of the above-mentioned carrier material, which was evenly distributed in a round-bottom beaker. 3 mL of ultrapure water was added to the round-bottom beaker, and after ultrasonic oscillation in a water bath for 10 minutes, the nanoformulation was fully homogenized by an ultrasonic crusher for 10 minutes to form a suspension, and the diagnostic gene Ft was dissolved in enzyme-free ultrapure water and allowed to stand at room temperature for 2 hours to obtain the precise diagnosis and treatment nanoformulation GMT-G.

[0106] (3) Preparation steps of GMT-N by thin film dispersion method: accurately weigh 3.5 mg of cationic lipid DOTAP, 1 mg of soybean lecithin, 0.5 mg of cholesterol, and DSPE-mPEG 2000 0.25 mg of nifedipine and 0.2 mg of nintedanib were fully dissolved in 2 mL of chloroform, and the chloroform solution was completely evaporated by a rotary evaporator in a 40°C water bath to form a thin film of the above-mentioned carrier material, which was evenly distributed in a round-bottom beaker. 3 mL of ultrapure water was added to the round-bottom beaker, and after ultrasonic oscillation in a water bath for 10 minutes, an ultrasonic crusher was used to fully homogenize the nanoformulation for 10 minutes to obtain GMT-N.

[0107] Nintedanib is a hydrophobic anti-pulmonary fibrosis drug. In some embodiments, imatinib, gefitinib, dasatinib, sorafenib, ibrutinib, sildenafil, minoxidil, treprostinil, atorvastatin, azithromycin, rapamycin, vildagliptin, olopatadine, and idebenone can also be used.

[0108] In some of the embodiments, hydrophilic anti-pulmonary fibrosis drugs can also be used, selected from at least one of pirfenidone, metformin, N-acetylcysteine, ambroxol, minocycline, linopril, losartan, cangrelor, doxycycline, and minocycline.

[0109] Example 2

[0110] Particle size, potential and morphological characteristics of the precision diagnosis and treatment nanoparticle preparation GMT-GN

[0111] GMT-GN was obtained according to the preparation method described in Example 1 (1). 1 mL of GMT-GN solution was accurately aspirated and the particle size and potential of the nanoformulation were measured using a Malvern potential particle size analyzer. The results are as follows: Figure 3 As shown, the obtained GMT-GN solution has a uniform particle size; after the GMT-GN solution is slowly dripped into the copper mesh, the morphological characteristics of the nanoparticles are evaluated by transmission electron microscopy. The results show that the outer layer of the GMT-GN particles contains a hydrated layer, and the morphology is uniform and spherical. The particle size of the nanoparticles is between 130.6±0.566nm ( Figure 3 The nanoparticles are positively charged, indicating that they have the ability to efficiently load the diagnostic gene Ft ( Figure 3 (B).

[0112] Example 3

[0113] Loading efficiency of the precise diagnosis and treatment nanoparticle GMT-GN for the diagnostic gene Ft

[0114] After obtaining GMT-N according to the preparation method described in Example 1 (3), GMT-GN loaded with diagnostic genes of different masses were obtained according to the ratio of diagnostic gene Ft to DOTAP in GMT-N of 1:5, 1:10, 1:20, 1:50 and 1:100 respectively. The loading efficiency of GMT-GN for diagnostic genes of different masses Ft was investigated by agarose gel electrophoresis, that is, the ultimate loading capacity of GMT-GN. The results showed that the loading efficiency of the precise diagnostic nanoparticle preparation GMT-GN for diagnostic gene Ft still reached 100% at a relatively small ratio of 1:5 ( Figure 4 ).

[0115] Example 4

[0116] Loading of anti-pulmonary fibrosis drugs in the precision diagnosis and treatment nanoparticle GMT-GN

[0117] GMT-GN was obtained according to the preparation method described in Example 1 (1). 200 μL of GMT-GN solution was accurately pipetted and added into 800 μL of dimethyl sulfoxide and mixed thoroughly. The ultraviolet absorption curve of the nanoformulation was detected by ultraviolet visible spectrophotometer. 2000The results showed that the anti-pulmonary fibrosis drug nintedanib was successfully loaded into GMT-GN. Figure 5 It is the UV absorption curve.

[0118] Example 5

[0119] Delivery efficiency of diagnostic genes and anti-pulmonary fibrosis drugs by the precision diagnosis and treatment nanoparticle GMT-GN

[0120] (1) Diagnostic gene Ft uptake and lysosomal escape

[0121] ① Uptake experiment: GMT-G was obtained according to the preparation method described in Example 1 (2). During the preparation process, ethidium bromide (EB) was used to stain the diagnostic gene Ft to trace the uptake of GMT-G by cells. A549 cells were cultured at 5×10 4 A549 cells were seeded in a confocal culture dish and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 hours. After the cells in the dish were fully confluent, EB-labeled GMT-G (quantified by Ft: 5 μg, Ft:DOTAP=1:20) was added. After incubation for 1 hour and 4 hours, the culture medium was discarded and the uptake of EB-labeled GMT-G by A549 cells at different time points was detected by confocal microscopy ( Figure 6 Middle A);

[0122] ② Lysosomal escape experiment: GMT-G was obtained according to the preparation method described in Example 1 (2). During the preparation process, the diagnostic gene Ft was stained with EB to trace the lysosomal escape behavior of GMT-G in cells. A549 cells were cultured at 5×10 4 100 μg / well were seeded in confocal culture dishes and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. After the cells in the dish were fully confluent, EB-labeled GMT-G (quantified by Ft: 5 μg, Ft:DOTAP=1:20) was added. After incubation for 1 h and 4 h, the culture medium was discarded, and the lysosome dye LysoTracker Green was used to stain the lysosomes of the cells. The lysosomal escape of EB-labeled GMT-G in A549 cells was detected using a confocal microscope ( Figure 6 (B).

[0123] (2) Anti-pulmonary fibrosis drug uptake and lysosomal escape

[0124] ① Uptake experiment: GMT-N was obtained according to the preparation method described in (3) of Example 1. During the preparation process, a fluorescent molecule (coumarin 6, green fluorescence) was used as a model drug instead of nintedanib to evaluate the uptake behavior and lysosomal escape behavior of GMT-N at the cellular level. A549 cells were cultured at 5×10 4A549 cells were seeded with 100 μg / well in a confocal culture dish and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. After the cells in the dish were fully confluent, GMT-N labeled with coumarin 6 (quantified by coumarin 6: 20 μg) was added. After incubation for 1 h and 4 h, the culture medium was discarded. The uptake of GMT-N labeled with coumarin 6 by A549 cells at different time points was detected by confocal microscopy ( Figure 6 Middle C);

[0125] ② Lysosomal escape experiment: GMT-N was obtained according to the preparation method described in Example 1 (3). During the preparation process, a fluorescent molecule (coumarin 6, green fluorescence) was used as a model drug instead of nintedanib to evaluate the uptake behavior and lysosomal escape behavior of GMT-N at the cellular level. A549 cells were cultured at 5×10 4 The cells were seeded in confocal culture dishes and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. After the cells were fully spread in the dish, GMT-N labeled with coumarin 6 (quantified by coumarin 6: 20 μg) was added. After incubation for 1 h and 4 h, the culture medium was discarded. Lysosomes of the cells were stained with LysoTracker Red, and the lysosomal escape of GMT-N labeled with coumarin 6 in A549 cells was detected using a confocal microscope ( Figure 6 (middle D).

[0126] In this example, coumarin 6 or Ft can be efficiently taken up within 4 hours, and GMT-N or GMT-G can effectively promote the escape of coumarin 6 or Ft from the lysosomes of A549 cells, indicating that GMT-GN is highly efficient in delivering anti-pulmonary fibrosis drugs and diagnostic gene Ft, which is beneficial for subsequent further treatment.

[0127] Example 6

[0128] Transfection efficiency of the diagnostic gene Ft by the precision diagnosis and treatment nanoparticle GMT-G

[0129] GMT-G was obtained according to the preparation method described in Example 1 (2). A549 cells were cultured at 2×10 5 The cells were seeded per well in a six-well plate and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 hours. After the cells were fully spread in the plate, the culture medium was discarded. GMT-G loaded with different mass ratios of diagnostic gene Ft (quantified by Ft: 5 μg) was diluted with a culture medium without 10% serum and added to each well of the culture plate. After further incubation in a cell culture incubator at 37°C and 5% CO2 for 4 hours, the culture medium containing GMT-G was discarded and 1 mL of culture medium containing 10% serum was added to continue culturing for 24 hours. The transfection efficiency of GMT-G on diagnostic gene Ft in A549 cells at different time points (48 hours and 72 hours) was evaluated using an inverted fluorescence microscope. Figure 7 ).

[0130] In this embodiment, when the mass ratio of DOTAP to diagnostic gene Ft in GMT-G is 20:1, it has a better transfection effect than commercially available transfection reagents. If the ratio is further increased, it will cause certain damage to A549 cells. In addition, the transfection efficiency of GMT-G is further improved with the increase of transfection time.

[0131] Example 7

[0132] Precision diagnosis and treatment of nanoparticles GMT-G in vitro for accurate diagnosis and evaluation of damaged AECs II type II alveolar epithelial cells

[0133] GMT-G was obtained according to the preparation method described in Example 1 (2). BEAS-2B cells were cultured at 5×10 4 BEAS-2B cells were seeded per well in a confocal culture dish and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 hours. After the BEAS-2B cells filled the cell plate, the culture medium was discarded. The BEAS-2B cells were treated with 500μM hydrogen peroxide solution for 4 hours to construct a BEAS-2B oxidative stress model, and normal BEAS-2B cells were used as a control. GMT-G (quantified by Ft: 5μg, Ft:DOTAP=1:20) was added to the culture plate and incubated for 4 hours at 37°C and 5% CO2. The culture medium containing GMT-G was discarded, the culture plate was washed three times with PBS, and 1mL of culture medium containing 10% serum (containing hydrogen peroxide: concentration of 500μM) was added. After continuing to culture for 48 hours, the confocal microscope was used to evaluate the precise diagnostic efficiency of GMT-G for damaged AECs II at the in vitro level. The results are as follows Figure 8 shown.

[0134] In this embodiment, after GMT-G promotes efficient transfection of the diagnostic gene Ft in the damaged BEAS-2B, the overexpressed caspase-3 protein in the cell specifically recognizes and cuts off the sensitive peptide sequence -DEVD- in the efficiently expressed Ft protein EYFP-SGGGDEVDGGGS-ECFP, and the confocal microscope can detect the fluorescence of CFP and YFP at the same time; while in normal BEAS-2B cells, only a very small amount of caspase-3 is contained, so the sensitive peptide -DEVD- will not be recognized and cut off by caspase-3, and the fluorescent protein CFP transfers energy to YFP. At this time, the confocal microscope only receives the fluorescence of YFP, indicating that the detected cells are normal cells. Figure 8 The results showed that the diagnostic gene Ft loaded in GMT-G can accurately identify damaged AECs II and normal AECs II in fibrosis. Figure 8 ).

[0135] Example 8

[0136] Evaluation of the efficacy of precision diagnosis and treatment nanoparticles GMT-GN and GMT-G in repairing damaged mitochondrial membrane potential of AECs II in vitro

[0137] GMT-GN was obtained according to the preparation method described in Example 1(1), and GMT-G was obtained according to the preparation method described in Example 1(2). A549 cells were cultured at 2×10 5 100 μM hydrogen peroxide solution was added to construct a cellular oxidative stress environment after A549 cells were fully grown in the cell culture incubator at 37°C and 5% CO2 for 4 hours. GMT-GN (quantified by Ft: 5 μg, Ft:DOTAP=1:20) and GMT-G (quantified by Ft: 5 μg, Ft:DOTAP=1:20) were added to each culture plate. After 4 hours in a cell culture incubator at 37°C and 5% CO2, the culture medium containing GMT-GN and GMT-G was discarded, and 1 mL of culture medium containing 10% serum (containing hydrogen peroxide solution: concentration of 500 μM) was added to continue culturing for 48 hours. At the same time, untreated normal cells were used as controls ( Fig. 9 ).

[0138] In this embodiment, the precision diagnosis and treatment nanoformulation has a significant repair effect on the mitochondrial membrane potential under oxidative stress. Hydrogen peroxide solution causes cellular oxidative stress, resulting in a decrease in mitochondrial membrane potential. The precision diagnosis and treatment nanoformulation achieves precise diagnosis by consuming caspase-3 in damaged AECs II. The diagnostic gene Ft in GMT-GN and the anti-pulmonary fibrosis drug nintedanib synergistically restore the mitochondrial membrane potential of damaged AECs II, achieving the effect of precise diagnosis and treatment; GMT-G only treats through precise diagnosis, and the effect is weaker than GMT-GN.

[0139] Example 9

[0140] Evaluation of the anti-pulmonary fibrosis effects of precision diagnosis and treatment nanoformulations GMT-G and GMT-GN and the control group GMT-N on mice with pulmonary fibrosis

[0141] GMT-GN was obtained according to the preparation method described in Example 1 (1), GMT-G was obtained according to the preparation method described in Example 1 (2), and GMT-N was obtained according to the preparation method described in Example 1 (3). The mice with pulmonary fibrosis were treated by tracheal administration, wherein the treatment strategy was to administer the drug through the trachea once every three days, for a total of four times. The duration from the start of administration to the end of the experiment was 21 days. After the experiment, the mice were euthanized, and the lung tissues of the mice were collected and fixed with 4% paraformaldehyde. H&E staining and Masson staining were used to evaluate the pharmacodynamics of the diagnostic and therapeutic effects of the precision diagnosis and treatment nanoformulations GMT-G and GMT-GN and the control group GMT-N ( Fig.10 ).

[0142] In this embodiment, under the action of the precision diagnosis and treatment nano-preparations GMT-G and GMT-GN, the degree of fibrosis in mice in the GMT-GN group was the smallest, followed by GMT-G. The anti-pulmonary fibrosis effects of the two groups of precision diagnosis and treatment nano-preparations were significantly better than those of mice with pulmonary fibrosis in the model group, and close to the effects of mice in the GMT-N treatment group. The main manifestations are that the results of H&E staining show that GMT-GN can significantly inhibit the infiltration of inflammatory cells in fibrotic lung tissue, thereby reducing the level of inflammation in fibrotic tissue in mice; Masson sections further reveal that the degree of collagen deposition in the lung tissue of mice treated with the GMT-GN group is significantly reduced, close to the level of normal mice; the anti-pulmonary fibrosis effect of GMT-G is weaker than that of GMT-GN as a whole, but better than that of mice with pulmonary fibrosis in the model group, and close to the effects of mice in the GMT-N treatment group. The results show that the application of precision diagnosis and treatment nano-preparations can reverse the development of pulmonary fibrosis to a certain extent, and after adding clinical therapeutic drugs, it can play a greater role in the anti-pulmonary fibrosis effect of precision diagnosis and synergistic treatment.

[0143] The present invention specifically designs diagnostic genes according to the pathological conditions of the disease to achieve the purpose of accurate diagnosis at the molecular level, and effectively delivers diagnostic genes and anti-pulmonary fibrosis drugs through nanoformulations, further improving the anti-pulmonary fibrosis effect of the precision diagnosis and treatment nanoformulations. In addition, the precision diagnosis and treatment nanoformulations can selectively load clinical therapeutic drugs or emerging drugs required for the disease according to the disease model, the preparation process is simple, and the materials are easy to obtain. The precision diagnosis and treatment nanoformulations have the potential for wide application.

[0144] It should be understood that the various forms of processes shown above can be used to reorder, add or delete steps. For example, the steps described in the present invention can be executed in parallel, sequentially or in different orders, as long as the desired results of the technical solution of the present invention can be achieved, and this document does not limit this.

[0145] The above specific implementations do not constitute a limitation on the protection scope of the present invention. It should be understood by those skilled in the art that various modifications, combinations, sub-combinations and substitutions can be made according to design requirements and other factors. Any modification, equivalent substitution and improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for preparing a nanoparticle preparation with a diagnostic gene, characterized in that: The specific steps include: a. Constructing a recombinant plasmid expressing fluorescent protein 1-Linker1-DEVD-Linker2-fluorescent protein 2 to obtain the diagnostic gene Ft; b. Take cationic lipid CL, amphiphilic lecithin, liposomal phospholipids, cholesterol and hydrophilic / hydrophobic anti-pulmonary fibrosis drugs fully dissolved in a water-immiscible organic solvent, the organic solvent was rotary evaporated under water bath conditions to form a thin film, ultrapure water was added for water bath ultrasonic oscillation, and then ultrasonic crusher fully homogenized into a suspension; c. The diagnostic gene Ft is dissolved in enzyme-free ultrapure water and added to the suspension and mixed thoroughly, and then allowed to stand at room temperature to obtain the nanoparticle preparation GMT-GN with the diagnostic gene.

2. The preparation method according to claim 1, characterized in that: The base sequence of the DEVD is shown in SEQ ID No.

4.

3. The preparation method according to claim 1, characterized in that: The fluorescent protein is selected from EYFP, ECFP, EBFP or EGFP, and the fluorescent protein 1 and the fluorescent protein 2 are different from each other.

4. The preparation method according to claim 3, characterized in that: Linker is selected from glycine-serine polymers: GGSG, SGGG, (GGGGS)n, (GGGS)n, (GGS)n, (GS)n or (G)n, wherein n is selected from 1, 2, 3, 4, 5 or 6; alanine-serine polymers and α-helical linkers: (EAAAK)n, wherein n is selected from 1, 2, 3, 4, 5 or 6.

5. The preparation method according to any one of claims 1 to 4, characterized in that: By mass ratio, the cationic lipid CL: amphiphilic lecithin P: DSPE-xPEGy: cholesterol: hydrophilic / hydrophobic anti-pulmonary fibrosis drug is 14:4:1:2:0.

8.

6. The preparation method according to claim 5, characterized in that: The cationic lipid CL is selected from at least one of DOTAP, DOTMA, DODMA, DC-cholesterol, and Dlin-MC3-DMA.

7. The preparation method according to claim 5, characterized in that: The amphiphilic lecithin is selected from at least one of soybean lecithin, egg yolk lecithin, hydrogenated lecithin, deoxy lecithin and isolecithin.

8. The preparation method according to claim 5, characterized in that: The liposome phospholipid is DSPE-xPEGy, wherein x is selected from at least one of -CH3, -NH2, -COOH, -MAL, and -OCH3; and the molecular weight of y is selected from at least one of 1000, 2000, and 5000.

9. The nanoparticle preparation with diagnostic gene obtained by the preparation method according to any one of claims 1 to 8.

10. Use of the nano preparation with diagnostic gene according to claim 9 in the preparation of anti-pulmonary fibrosis drugs.

Images