Application of ERK5 gene as target spot in preparation of medicine for preventing or treating white matter injury

Abstract

The invention discloses application of an ERK5 gene as a target spot in preparation of a medicine for preventing or treating white matter injury. The invention creatively discovers the application of the ERK5 gene in early warning of white matter injury under various pathological conditions and medicine preparation. The ERK5 gene is highly expressed in microglial cells in a white matter damage demyelination area, and can be applied to early warning of white matter damage. The ERK5 gene is knocked down to relieve oxidative stress, ferroptosis and mitochondrial injury of microglial cells in white matter injury, so that the ERK5 gene can be applied to preparation of drugs for white matter injury and has good clinical application value.

Description

Technical Field

[0001] The present invention relates to the field of drug treatment for brain white matter damage, and in particular to an application of an ERK5 gene as a target in the preparation of a drug for preventing or treating brain white matter damage. Background Art

[0002] The white matter of the brain is mainly composed of nerve fibers, axons, myelin sheaths and glial cells. White matter lesions (WMLs) are defined as clinical syndromes characterized by scattered punctate or fused patchy changes that are widely distributed in the subcortical white matter, periventricular and centrum semiovale. According to the different causes and pathophysiological processes of white matter lesions, they can be divided into leukoaraiosis, age-related leukoencephalopathy, toxic leukoencephalopathy, subcortical arteriosclerotic encephalopathy, etc. Its main pathological characteristics are the destruction, loss or formation of myelin sheaths in central nervous system fibers, and demyelinating changes exist in the common pathological stages of many diseases including multiple sclerosis (MS), Alzheimer's disease (AD), vascular cognitive impairment and dementia (VCID), etc., and are closely related to glial cells (microglia, oligodendrocytes and astrocytes). The pathogenesis of white matter injury is mainly low perfusion damage, blood-brain barrier damage, immune inflammatory response, endothelial dysfunction and oxidative stress. In recent years, with the development of medical imaging technology, the detection rate of WMLs has become higher and higher. Surveys show that the prevalence of WMLs in people over 60 years old exceeds 30%. The different distribution ranges of white matter in the brain lead to very different clinical manifestations after lesions: periventricular white matter damage is mostly cap-shaped, thin line-shaped or halo-shaped. Smaller cap-shaped or dot-shaped ones may be asymptomatic and progress slowly; deep white matter damage is mostly dot-shaped, sheet-shaped or large-scale fusion-shaped. The lesions progress rapidly and can produce multiple clinical manifestations such as cognitive dysfunction, abnormal emotional fluctuations, unstable gait, urinary incontinence, etc., which bring serious socioeconomic and family problems to daily life.

[0003] Extracellular signal-regulated kinase 5 (ERK5) is a specific MAPK pathway that has been less studied than other common MAPK cascades such as ERK1 / 2, JNK, and p38. ERK5 was initially thought to be activated by stress-related stimuli, similar to other stress-activated protein kinases. However, it has now become clear that the ERK5 cascade can also be activated by mitogens, confirming its central role in many stress- and mitogen-induced cellular processes.

[0004] Previous studies on ERK5 have focused on its role in tumors. It belongs to the MAPK signaling pathway together with BRAF (a serine / threonine protein kinase that is closely related to the occurrence and development of tumors) and is closely related to processes such as the proliferation and survival of cancer cells. According to statistics, the gene MAPK7 that edits ERK5 was found to be amplified in 50% of liver cancer patients. ERK5 is highly expressed in breast cancer and prostate cancer. Related studies have shown that compared with patients with low ERK5 expression, patients with high expression have a 20-month shorter survival time. However, the biological function and clinical significance of the ERK5 gene in brain white matter damage remain unknown.

[0005] Therefore, exploring the disease warning role of the ERK5 gene in white matter damage is crucial for the treatment strategy of white matter damage. Summary of the invention

[0006] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an ERK5 gene as a target for use in the preparation of a drug or medicament for preventing or treating white matter damage. To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0007] The present invention provides an application of an ERK5 gene as a target in the preparation of a medicine for preventing or treating brain white matter damage.

[0008] Furthermore, the diseases related to white matter damage include but are not limited to ischemic white matter damage, inflammatory demyelinating diseases of the central nervous system, and poisoning-related leukoencephalopathy.

[0009] Furthermore, the ischemic white matter injury includes but is not limited to white matter injury caused by acute ischemic stroke, white matter injury caused by chronic hypoperfusion, cerebral small vessel disease, and cerebral ischemic lesions;

[0010] The central nervous system inflammatory demyelinating diseases include but are not limited to multiple sclerosis, neuromyelitis optica, and acute disseminated encephalomyelitis;

[0011] The poisoning-related leukoencephalopathy includes but is not limited to carbon monoxide poisoning, chemotherapy drugs, radiation, and drug-related leukoencephalopathy;

[0012] The infection-related leukoencephalopathy includes, but is not limited to, Lyme disease, progressive multifocal leukoencephalopathy (PML), and human immunodeficiency virus (HIV)-related leukoencephalopathy.

[0013] The present invention also provides use of a medicament for knocking down ERK5 gene expression in preparing an article for preventing or treating brain white matter damage.

[0014] Furthermore, the agent is small interfering RNA or recombinant adenovirus AAV-ERK5 or an inhibitor.

[0015] The present invention also provides a small interfering RNA for knocking down the expression of the ERK5 gene, wherein the small interfering RNA has a nucleotide sequence complementary to the ERK5 gene.

[0016] Furthermore, the nucleotide sequence of the small interfering RNA (si-ERK5) is CCUUACCAGGGAGCGCAUUAATT, as shown in SEQ ID NO:1.

[0017] The present invention also provides an application of the above-mentioned small interfering RNA in the preparation of medicines for preventing or treating brain white matter damage.

[0018] The present invention also provides a medicine for treating brain white matter damage, characterized in that the active ingredient of the medicine includes the above-mentioned small interfering RNA.

[0019] Furthermore, the dosage form of the drug is an injection.

[0020] The present invention also provides a recombinant adenovirus AAV-ERK5 for knocking down ERK5 gene expression, wherein the recombinant adenovirus AAV-ERK5 is a recombinant adenovirus AAV with mir30 shRNA inserted into the genome of the adenovirus AAV, wherein the nucleotide sequence of mir30 shRNA is CCTTACCAGGGAGCGCATTAA, as shown in SEQ ID NO:2.

[0021] The construction method of the above-mentioned recombinant adenovirus AAV-ERK5 is as follows:

[0022] Step 1. Interference target design and sequence synthesis: According to the general principles of mir30 shRNA design and the transcript of the ERK5 gene, the target was designed and the sequence was synthesized: CCTTACCAGGGAGCGCATTAA.

[0023] Step 2: Preparation of linearized expression vector: The expression vector pAAV-CBG-DIO-EGFP-miR30shRNA-WPRE was digested with restriction endonucleases. The digestion products were subjected to agarose gel electrophoresis to detect the digestion effect.

[0024] Step 3: Connect the target fragment into the expression vector and transform DH5α competent cells.

[0025] Step 4: Pick the transformants grown on the plate and resuspend them in 10 μl LB culture medium, and take 1 μl as a template for colony PCR identification.

[0026] Step 5: Sequencing and verification of positive clones obtained by colony identification. After the positive clones are verified, high-purity plasmids are extracted.

[0027] The present invention also provides an application of a kit for detecting ERK5 gene expression in preparing a product for assisting in detecting or evaluating brain white matter damage.

[0028] Beneficial effects of the present invention:

[0029] The present invention creatively discovered the application of ERK5 gene in early warning of white matter damage under various pathological conditions and in drug preparation. ERK5 gene is highly expressed in microglia in the demyelinated area of ​​white matter damage and can be used for early warning of white matter damage. Knocking down ERK5 gene alleviates oxidative stress and ferroptosis of microglia and mitochondrial damage in white matter damage, so that it can be used in the preparation of drugs for white matter damage, and has good clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is a statistical diagram of the positive area of ​​ERK5 expression in different white matter injury models.

[0031] Figure 2 This is a correlation analysis diagram between the ERK5 positive area and the degree of demyelination.

[0032] Figure 3 This is a statistical chart of ERK5 positive cells in LPC, BCAS, and MCAO models.

[0033] Figure 4 The expression statistics of ERK5 and pERK5 are shown in Figure 2.

[0034] Figure 5 Fluorescence intensity statistics of mitoSOX, FerroOrgance and lipid ROS

[0035] Figure 6 This is a statistical chart of white matter damage degree scores.

[0036] Figure 7 is a statistical diagram of the degree of microglial activation.

[0037] Figure 8 Statistical graph of fluorescence intensity of 8-OHdG and 4-HNE. DETAILED DESCRIPTION

[0038] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0039] Example 1 ERK5 is upregulated in white matter injury and the expression of ERK5 is correlated with white matter injury

[0040] 1. In this example, bilateral carotid artery stenosis surgery was used to establish a mouse model of white matter injury. The specific method is as follows:

[0041] After the mice were anesthetized with isoflurane, the skin was cut along the midline of the neck, the thyroid gland was peeled off, and the mouse trachea and bilateral common carotid arteries were exposed. A micro spring with an inner diameter of 0.18 mm, a pitch of 0.50 mm, and a total length of 2.5 mm was wrapped around the bilateral common carotid arteries of the mice, the incision was closed, the skin was sutured, and the cerebral blood flow was monitored. A 40% decrease in blood flow indicated that the BCAS mouse model was successfully established. One month was selected as the observation time point for white matter damage.

[0042] 2. In this example, a mouse model of ischemic white matter injury caused by middle cerebral artery occlusion (MCAO) was established by middle cerebral artery occlusion (MCAO). The specific method is as follows:

[0043] After the mice were anesthetized with isoflurane, the thyroid gland was stripped, and the mouse trachea and bilateral common carotid arteries were exposed. A silicone suture with an inner diameter of 0.18 mm was inserted into the internal carotid artery through the distal end of the right external carotid artery of the mouse, the incision was closed, the skin was sutured, and the cerebral blood flow was monitored. A decrease of 80% represented the successful establishment of the MCAO mouse model, and 14 days was selected as the observation time point for white matter damage caused by middle cerebral artery embolism.

[0044] 3. This example uses lysophosphatidylcholine (LPC) injected into the corpus callosum to construct a mouse model of focal white matter injury. The specific method is as follows:

[0045] Mice were anesthetized with isoflurane and mounted on a stereotaxic frame. Demyelination of the corpus callosum was induced by stereotaxic injection of 2 μL of 1% LPC in PBS at a rate of 0.5 μL / min. The first injection site was 1.0 mm lateral, 0.3 mm anterior to bregma, and 2.0 mm deep. The second injection site was 1.0 mm lateral, 0.8 mm anterior to bregma, and 2.2 mm deep. After injection, the needle was kept in each position for another 10 minutes to minimize backflow. Mice in the sham group were stereotaxically injected with an equal volume of PBS at the same site. Day 10 was selected as the observation time point for focal white matter damage.

[0046] The process of white matter damage is accompanied by obvious demyelination. dMBP, the damaged myelin basic protein, is expressed in large quantities in the area of ​​white matter damage. Frozen sections of the brains of mice with BCAS modeling for 1 month, MCAO modeling for 14 days, and LPC modeling for 10 days were taken, and immunofluorescence staining was performed using dMBP and ERK5 antibodies; the specific steps are as follows:

[0047] After the frozen sections were warmed up at room temperature, they were washed with phosphate buffer for 5 minutes. Next, the membrane was permeated with Triton X-100 immunofluorescence permeabilization solution at room temperature for 15 minutes. Subsequently, the specimens were blocked with immunofluorescence rapid blocking solution at room temperature for 15 minutes. After the antibodies were diluted and mixed with the primary antibody diluent, 10 μL of the diluent was added to each sample, and the secondary antibody was incubated for one hour at room temperature in the dark after incubation at 4°C for 12 hours. Finally, the positive areas of ERK5 and dMBP were observed and counted.

[0048] like Figure 1 The results showed that the positive area of ​​ERK5 in the demyelination area in the white matter injury increased significantly at 1 month after BCAS modeling, 14 days after MCAO modeling and 10 days after LPC modeling.

[0049] like Figure 2 The results showed that the area of ​​ERK5 was correlated with the demyelination area (LPC model and MCAO model) and the white matter damage score (BCAS model).

[0050] It can be seen from this that ERK5 is upregulated in white matter damage and the expression of ERK5 is correlated with white matter damage, suggesting that ERK5 may have a suggestive significance for white matter damage under different pathological conditions.

[0051] Example 2 ERK5 is mainly expressed in microglia in the white matter injury area

[0052] Demyelination is closely related to glial cells. Microglia are immune active cells. They can be activated early to release inflammatory factors when ischemic, causing persistent neuroinflammatory reactions and causing damage to white matter neurons. Oligodendrocytes have the function of wrapping axons and forming myelin in the CNS. When ischemic, a large number of oligodendrocytes undergo apoptosis and are easily damaged by inflammatory factors, causing demyelination of the white matter. Astrocytes are closely related to the formation of the blood-brain barrier and the formation of neuronal synapses. The specific steps are as follows:

[0053] Mouse brain tissue sections were immunofluorescently stained with oligodendrocyte protein Olig2 (a marker for primary and mature oligodendrocytes), glial fibrillary acidic protein GFAP (a marker for astrocytes), IBA1 (a marker for microglia), anti-neurofilament NF (a marker for myelinated neurons) and ERK5 antibodies.

[0054] like Figure 3 The results showed that the proportion of ERK5+IBA1+ cells increased significantly compared with astrocytes, oligodendrocytes and myelin neurons, indicating that ERK5 is mainly expressed in microglia in the white matter injury area.

[0055] The expression of ERK5 in microglia was further observed in vitro.

[0056] First, an in vitro white matter injury model was constructed. The specific steps are as follows:

[0057] The brain tissue of neonatal mice was peeled off, chopped and digested, and cultured in a 37°C incubator containing 5% CO2 for 14 days. Primary microglia were collected. The primary microglia without any treatment were designated as the Sham group, and the primary microglia were stimulated with 10 μg / ml exogenous myelin as the myelin group to simulate the brain white matter injury environment in vitro.

[0058] Then, extract the proteins of microglia for Western Blotting detection. The specific steps are as follows:

[0059] Place the electrophoresis gel in the electrophoresis tank, add electrophoresis solution until the level of the electrophoresis solution is higher than the sample loading holes on the inside of the two glass pieces, and perform electrophoresis after loading. After the electrophoresis is completed, make an electrotransfer clip according to the transfer structure of "sponge pad-filter paper-gel-PVDF membrane-filter paper-sponge pad". Place the electrotransfer in the transfer tank filled with transfer solution, and transfer the membrane in a foam box filled with ice water. After the transfer is completed, take out the NC membrane, wash it in TBST once, and then block it with a universal blocking solution for 15-30 minutes. After the blocking is completed, wash it with TBST 3 times, 5 minutes each time, then put it in the antibody incubation box containing the primary antibody, mark it, and place it steadily on a pendulum shaker at 4℃ overnight. After the incubation is completed, wash it with TBST 3 times, 5 minutes each time, then put it in the antibody incubation box containing the secondary antibody, mark it, and react it at room temperature for 1 hour. After the incubation is completed, wash it with TBST 3 times, 5 minutes each time, and add ECL exposure solution to develop color in the gel system after washing.

[0060] like Figure 4 The results showed that the expression of ERK5 increased on microglia after stimulation with exogenous myelin debris, and the expression of the activated form of ERK5 (phosphorylated ERK5, pERK5) also increased significantly.

[0061] The above results show that ERK5 is highly expressed in microglia in the demyelinated area of ​​white matter injury, suggesting that ERK5 may be involved in the neural injury process caused by microglia in white matter injury.

[0062] Example 3 Knockdown of ERK5 alleviates mitochondrial damage, ferroptosis and oxidative stress in microglia in brain white matter injury

[0063] Studies have shown that increased mitochondrial complex I activity in microglia is closely related to the occurrence and development of chronic neuroinflammation. Increased CI activity will increase the production of ROS in microglia, thereby aggravating neuroinflammation and related neurotoxic damage. In addition, ferroptosis stimulation can also trigger an inflammatory response in microglia, thereby participating in demyelinating lesions. mitoSOX is a commonly used cell fluorescent probe and a live cell permeable dye. It can be used to detect changes in intracellular reactive oxygen species (ROS) levels. FerroOrange is a ferrous ion probe that can be used to detect changes in intracellular ferrous iron levels. Lipid ROS is a probe for detecting lipid free radicals, which can reflect mitochondrial damage.

[0064] Small interfering RNA (siRNA) is a double-stranded RNA with a length of 20-25 nucleotides. It has many biological applications and is currently mainly used to interfere with RNA to achieve the purpose of regulating gene expression (knockdown). Its essence is the specific binding and degradation of siRNA and the corresponding mRNA, thereby achieving the purpose of blocking the continued translation of mRNA.

[0065] The nucleotide sequence of the designed small interfering RNA (i.e., si-ERK5) is CCUUACCAGGGAGCGCAUUAATT, as shown in SEQ ID NO: 1; the small interfering RNA is used to knock down ERK5, and the specific method is as follows:

[0066] Step 1. Prepare reagent 1: Prepare 3.75 μL of transfection reagent lipo3000 and 1.25 μL of culture medium opti-men12, mix well and incubate at room temperature for 5 minutes to obtain reagent 1 (volume 125 μL).

[0067] Step 2. Prepare reagent 2: Prepare 5 μL of si-ERK5 or si-NC (control RNA) and 120 μL of culture medium opti-men, mix well and incubate at room temperature for 5 minutes to obtain si-ERK5 reagent (volume 125 μL) or si-NC reagent (volume 125 μL), respectively.

[0068] Step 3. Prepare the transfection system (si-NC system or si-ERK5 system): Add reagent 2 to reagent 1, mix well, and incubate at 37° C. for 15 minutes to obtain the si-NC system and si-ERK5 system, respectively.

[0069] Step 4, transfection: myelin + si-NC group: take out the primary microglia that have been stimulated with exogenous myelin (6-well plate), and add 250 μL of negative control si-NC system and 1750 μL of 10% FBS high glucose to each well;

[0070] Myelin+si-ERK5 group: Primary microglial cells (6-well plate) that had been stimulated with exogenous myelin were taken out, and then 250 μL of si-RNA system and 1750 μL of 10% FBS high glucose were added to knock down the expression of ERK5.

[0071] Flow cytometry was used to detect the fluorescence intensity of mitoSOX, FerroOrgance and lipid ROS in microglia of each group.

[0072] like Figure 5 The results showed that compared with the Sham group, myelin group and myelin+si-NC group, the mean fluorescence intensity of mitoSOX, FerroOrgance and lipid ROS in the myelin+si-ERK5 group was significantly reduced, suggesting that knocking down ERK5 can help alleviate mitochondrial damage, ferroptosis and oxidative stress of microglia in white matter injury.

[0073] Example 4 Construction of recombinant adenovirus AAV-ERK5 for knocking down ERK5 gene expression

[0074] The recombinant adenovirus AAV-ERK5 used for knocking down the expression of the ERK5 gene is a recombinant adenovirus AAV in which mir30 shRNA is inserted into the genome of the adenovirus AAV, wherein the nucleotide sequence of mir30 shRNA is CCTTACCAGGGAGCGCATTAA, as shown in SEQ ID NO:2.

[0075] The construction method of the above-mentioned recombinant adenovirus AAV-ERK5 is as follows:

[0076] Step 1. Interference target design and sequence synthesis: According to the general principles of mir30 shRNA design and the transcript of the ERK5 gene, the target was designed and the sequence was synthesized: CCTTACCAGGGAGCGCATTAA.

[0077] Step 2: Preparation of linearized expression vector: The expression vector pAAV-CBG-DIO-EGFP-miR30shRNA-WPRE was digested with restriction endonucleases. The digestion products were subjected to agarose gel electrophoresis to detect the digestion effect.

[0078] Step 3: Connect the target fragment into the expression vector and transform DH5α competent cells.

[0079] Step 4: Pick the transformants grown on the plate and resuspend them in 10 μl LB culture medium, and take 1 μl as a template for colony PCR identification.

[0080] Step 5: Sequencing is performed on the positive clones obtained by colony identification to verify the correct positive clones, and high-purity plasmids are extracted to obtain recombinant adenovirus AAV-ERK5.

[0081] Example 5: Recombinant adenovirus AAV-ERK5 knocks down ERK5 gene to alleviate white matter damage

[0082] Specifically, 2 weeks before BCAS surgery, expression of Cx3cr1 CreER AAV 1 μl was injected into the bilateral corpus callosum of mice (coordinates: midline ± 1.0 mm; 1.0 mm in front of the bregma; 2.2 mm deep). The final injection volume of the virus was 1.0E+10 vg / mouse. Specifically:

[0083] BCAS-AAV-NC group: BCAS mice were injected with negative control AAV-NC;

[0084] BCAS-AAV-ERK5 group: BCAS mice were injected with recombinant adenovirus AAV-ERK5 to knock down the ERK5 gene of mice.

[0085] LFB staining was used to evaluate the severity of white matter damage.

[0086] like Figure 6 The results showed that compared with the BCAS-AAV-NC group, the white matter damage score in the BCAS-AAV-ERK5 group was significantly reduced, suggesting that knocking down the ERK5 gene can help alleviate white matter damage.

[0087] Example 6 Knockdown of ERK5 gene by recombinant adenovirus AAV-ERK5 alleviates neuroinflammatory response in white matter injury

[0088] Neuroinflammatory response is considered to be an important pathological mechanism for white matter lesions. Neuroinflammation is a basic immune response, which is manifested by enhanced glial cell activation, proinflammatory cytokine secretion, blood-brain barrier permeability and peripheral leukocyte invasion, thereby protecting the body from endogenous and exogenous damage. Microglia are innate immune cells of the central nervous system, and their activation can mediate neuroinflammatory response.

[0089] Immunofluorescence staining was used to perform stereological analysis of microglia (Iba-1) in the damaged area of ​​mouse white matter to evaluate the activation of microglia.

[0090] like Figure 7The results showed that compared with the BCAS-AAV-NC group, the aggregation of microglia in the white matter region of BCAS mice in the BCAS-AAV-ERK5 white matter injury group was reduced, the cell body area was reduced, and the roundness was also significantly reduced, indicating that microglial activation was significantly reduced after knocking down the ERK5 gene. This shows that in the context of white matter injury, knocking down the ERK5 gene can reduce the activation of microglia, thereby alleviating neuroinflammation.

[0091] Example 7 Knockdown of ERK5 gene by recombinant adenovirus AAV-ERK5 alleviates oxidative stress and ferroptosis in white matter damage

[0092] 8-Hydroxydeoxyguanosine (8-OHdG) is a ROS-induced modification of DNA purine residues. It is a sensitive indicator of oxidative DNA damage and a common biomarker of oxidative stress. 4-Hydroxynonenal (4-HNE) is an important lipid peroxidation marker of ferroptosis and accumulates in large quantities during ferroptosis. Immunofluorescence staining of 8-OHdG, 4-HNE and Iba-1 mouse brain tissue sections was performed to detect oxidative stress and ferroptosis levels.

[0093] Immunofluorescence staining of 8-OHdG, 4-HNE and Iba-1 mouse brain tissue sections was performed to detect the levels of oxidative stress and ferroptosis in microglia.

[0094] like Figure 8 The results showed that compared with the BCAS-AAV-NC group, the fluorescence intensity of 8-OHdG and 4-HNE in the BCAS-AAV-ERK5 group was significantly reduced, indicating that knocking down the ERK5 gene can help alleviate oxidative stress and ferroptosis in white matter damage.

[0095] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. Use of ERK5 gene as a target in the preparation of a drug for preventing or treating brain white matter damage.

2. The use according to claim 1, characterized in that: The diseases related to white matter damage include, but are not limited to, ischemic white matter damage, inflammatory demyelinating diseases of the central nervous system, and poisoning-related leukoencephalopathy.

3. Use of a drug for knocking down ERK5 gene expression in the preparation of an article for preventing or treating brain white matter damage.

4. The use according to claim 3, characterized in that: The agent is small interfering RNA or recombinant adenovirus AAV-ERK5 or an inhibitor.

5. A small interfering RNA for knocking down ERK5 gene expression, characterized in that: The small interfering RNA has a nucleotide sequence complementary to the ERK5 gene.

6. The small interfering RNA according to claim 5, characterized in that: The nucleotide sequence of the small interfering RNA is CCUUACCAGGGAGCGCAUUAATT.

7. Use of the small interfering RNA according to claim 5 or 6 in the preparation of a medicine for preventing or treating brain white matter damage.

8. A drug for treating white matter damage, characterized in that: The active ingredient of the drug includes the small interfering RNA according to claim 5 or 6.

9. A recombinant adenovirus AAV-ERK5 for knocking down ERK5 gene expression, characterized in that: The recombinant adenovirus AAV-ERK5 is a recombinant adenovirus AAV in which mir30 shRNA is inserted into the genome, wherein the nucleotide sequence of mir30 shRNA is CCTTACCAGGGAGCGCATTAA.

10. Use of a kit for detecting ERK5 gene expression in the preparation of a product for assisting in the detection or evaluation of brain white matter damage.

Images