Application of Siglec7 in promoting cell generation and / or exosome release

Abstract

The invention relates to the field of cell engineering, in particular to application of Siglec7 in generation and / or release of exosomes in tumor cells. According to the invention, after a lentiviral vector of an overexpressed Siglec7 gene is constructed, tumor cells are transfected with the lentiviral vector, and finally the tumor cell strain stably expressing Siglec7 is obtained. Through extraction and detection, the cell strain obviously improves the yield of the exosome in unit cell and unit culture medium volume, and the yield of the exosome is obviously improved.

Description

Technical Field

[0001] The present invention belongs to the field of cell engineering, and specifically, relates to the use of Siglec7 in promoting cells to produce and / or release exosomes. More specifically, it relates to the use of a reagent in preparing a kit, the use of a reagent in preparing a drug, and a method for regulating cells to produce and / or release exosomes. Background Art

[0002] Cancer is one of the diseases that threatens the lives of many people around the world. It is the second leading cause of death worldwide after cardiovascular disease. Cancer cells have unique characteristics such as high proliferation rate, self-renewal ability, and the ability to switch between different molecular pathways to generate drug resistance. Based on these characteristics, novel therapeutic approaches including nucleic acid drugs and anticancer drugs have been developed to target cancer cells and inhibit their development.

[0003] Exosomes (EVs) are now widely present in all body fluids and tissues including blood, urine, breast milk, amniotic fluid / synovium / ascites, saliva and adipose tissue. As more and more types of extracellular vesicles are discovered, the definition of exosomes is constantly changing. Donor cells can transfer exogenous substances such as proteins, mRNA, microRNAs (miRNAs) and lipids to recipient cells through exosomes. Therefore, these naturally equipped nanocarriers have been used for drug delivery. Compared with synthetic drug carriers, exosomes isolated from the patient's own cells have higher biocompatibility and lower toxicity. Exosomes can also penetrate into tissues, diffuse into the blood, and even cross the blood-brain barrier (BBB). Exosome-mediated delivery bypasses the p-glycoprotein drug efflux system and can reduce drug resistance. Exosomes are also highly engineerable, and surface protein engineering confers cell and tissue specificity. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art to at least a certain extent. To this end, the present invention provides the use of Siglec7 in the production and / or release of exosomes by tumor cells.

[0005] The present invention is accomplished based on the following findings of the inventors:

[0006] At present, the number of exosomes produced and / or released in tumor cells is relatively small, and the effect of a small number of exosomes on tumor immunotherapy and immunoregulation is not significant. In order to overcome this problem, the inventors constructed a lentiviral vector that overexpressed the Siglec7 gene, transfected it into tumor cells, and finally obtained a tumor cell line that stably expressed Siglec7, thereby increasing the expression of exosomes in tumor cells, thereby improving the effect of tumor immunotherapy and immunoregulation.

[0007] In the first aspect of the present invention, the present invention proposes the use of Siglec7 in promoting cells to produce and / or release exosomes. According to an embodiment of the present invention, stably expressing Siglec7 in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the yield of exosomes.

[0008] In a second aspect of the present invention, the present invention proposes the use of a reagent in preparing a kit. According to the use of an embodiment of the present invention, the reagent is used to regulate the expression or activity of Siglec7, and the kit is used to regulate the production and / or release of exosomes in cells.

[0009] In the third aspect of the present invention, the present invention proposes the use of an agent in the preparation of a drug. According to the use of an embodiment of the present invention, the agent is used to promote the expression or activity of Siglec7 in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

[0010] In a fourth aspect of the present invention, the present invention proposes a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting and treating the cells to be treated with an agent, wherein the agent is used to regulate the expression or activity of Siglec7. According to the method of an embodiment of the present invention, the yield of exosomes produced and / or released by tumor cells can be increased.

[0011] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0013] Figure 1 This is a schematic diagram of the structure of the basic carrier LV3 in Example 1 of the present invention.

[0014] Figure 2 Schematic diagram of the structure of the recombinant lentiviral vector in Example 1 of the present invention.

[0015] Figure 3 This is a light microscopic image (10X) of mouse colon cancer cells in Example 2 of the present invention.

[0016] Figure 4 This is a flow cytometry fluorescence image of LV3 lentivirus 293T cells in Example 2 of the present invention.

[0017] Figure 5 This is a schematic diagram of the exosome extraction process in Example 3 of the present invention.

[0018] Figure 6 This is an electron micrograph of Siglec7 EVs in Example 3 of the present invention.

[0019] Figure 7 This is the particle size analysis of Siglec7 EVs in Example 3 of the present invention.

[0020] Figure 8 This is a test of the number of exosome particles extracted in Example 3 of the present invention, where A is the number of particles in the Control group at a 10-fold dilution, and B is the number of particles in the Siglec7 EVs group at a 20-fold dilution.

[0021] Fig. 9 This is the number of particles in the Control group and Siglec7 EVs group in Example 3 of the present invention.

[0022] Fig.10 This is a Western blot analysis of the expression of exosomal Siglec7 protein in Example 3 of the present invention.

[0023] Fig.11 This is a fluorescence image of mouse colon cancer cells taking up two types of exosomes in Example 3 of the present invention.

[0024] Fig.12 The two exosomes in Example 3 of the present invention inhibit the proliferation of mouse colon cancer cells. DETAILED DESCRIPTION

[0025] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0026] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of the present invention, unless otherwise specified, the meaning of "plurality" is two or more.

[0027] In this document, the terms “contain”, “include” or “comprise” are open expressions, that is, they include the contents specified in the present invention but do not exclude other contents.

[0028] As used herein, the terms "optionally", "optional" or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0029] The present invention proposes the use of Siglec7 in promoting cells to produce and / or release exosomes, the use of the reagent in preparing a kit, the use of the reagent in preparing a drug, and a method for regulating cells to produce and / or release exosomes, which will be described in detail below.

[0030] Use of Siglec7 in promoting cell production and / or release of exosomes

[0031] In the first aspect of the present invention, the present invention proposes the use of Siglec7 in promoting cells to produce and / or release exosomes. According to an embodiment of the present invention, stably expressing Siglec7 in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the yield of exosomes.

[0032] According to an embodiment of the present invention, the nucleotide sequence of Siglec7 is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting and misplacing one or more bases in the sequence shown in SEQ ID NO: 1.

[0033] (SEQ ID NO: 1).

[0034] According to an embodiment of the present invention, the cell is a tumor cell.

[0035] Use of reagents in preparing kits

[0036] In a second aspect of the present invention, the present invention proposes the use of a reagent in preparing a kit. According to an embodiment of the present invention, the reagent is used to regulate the expression or activity of Siglec7, and the kit is used to regulate the production and / or release of exosomes in cells.

[0037] According to an embodiment of the present invention, the reagent is used to promote the expression or activity of Siglec7, and the kit is used to promote the production and / or release of exosomes in cells.

[0038] According to an embodiment of the present invention, the reagent includes at least one of a viral vector and a virus for overexpressing Siglec7.

[0039] According to an embodiment of the present invention, the reagent is used to inhibit the expression or activity of Siglec7, and the kit is used to inhibit the production and / or release of exosomes in cells.

[0040] According to an embodiment of the present invention, the reagent includes siRNA for inhibiting the expression of Siglec7.

[0041] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO:2.

[0042] CAGAAGAGTAACCGGAAGGATTA (SEQ ID NO: 2).

[0043] Use of reagents in the preparation of drugs

[0044] In the third aspect of the present invention, the present invention proposes the use of an agent in the preparation of a drug. According to an embodiment of the present invention, the agent is used to promote the expression or activity of Siglec7 in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

[0045] According to an embodiment of the present invention, the reagent includes at least one of a viral vector and a virus for overexpressing Siglec7.

[0046] Methods for regulating cell production and / or release of exosomes

[0047] In a fourth aspect of the present invention, the present invention provides a method for regulating cell production and / or release of exosomes. According to an embodiment of the present invention, the method comprises: contacting and treating the cells to be treated with a reagent, wherein the reagent is used to regulate the expression or activity of Siglec7. According to the method of an embodiment of the present invention, the yield of cell production and / or release of exosomes can be increased.

[0048] According to an embodiment of the present invention, the cell is a tumor cell.

[0049] According to an embodiment of the present invention, the reagent is used to promote the expression or activity of Siglec7, and the reagent includes at least one of a viral vector and a virus for overexpressing Siglec7.

[0050] According to an embodiment of the present invention, the reagent is used to inhibit the expression or activity of Siglec7, and the reagent includes siRNA for inhibiting the expression of Siglec7.

[0051] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO:2.

[0052] According to an embodiment of the present invention, the culture medium used for culturing cells is serum-free 1640 culture medium.

[0053] According to an embodiment of the present invention, the method for producing and / or releasing exosomes is as follows: selecting mouse colon cancer cells transfected with a recombinant lentiviral vector in the P3 generation logarithmic growth phase, and when the cells grow to 70%-80%, continuing to culture with serum-free 1640 medium, ultracentrifuging, and obtaining exosomes.

[0054] The present invention uses the LV3 vector as the basic vector to construct a lentiviral vector that overexpresses the Siglec7 gene, transfects it into tumor cells, and obtains a stably expressed Siglec7 cell line. Through exosome extraction and detection, the cell line significantly improves the exosome yield per unit cell and unit culture medium volume, and the exosome yield is improved. In addition, the present invention purifies and separates exosomes through the GFP tag carried by the lentivirus, which solves the defects of traditional methods to a certain extent and promotes the scientific research and clinical level of tumor cell exosomes.

[0055] Tumor cells

[0056] In a fifth aspect of the present invention, the present invention provides a tumor cell. According to an embodiment of the present invention, Siglec7 is overexpressed in the tumor cell. According to the tumor cell of the embodiment of the present invention, the production of exosomes can be increased.

[0057] Among them, it needs to be explained that the Siglec7 protein was identified as a putative adhesion molecule that acts as a mediator of sialic acid-dependent cell binding. It preferentially binds α-2,3- and α-2,6-linked sialic acids and interacts with disialogangliosides such as disialylgalactosyl globuloside, disialyllactotetraosylceramide, and disialylGalNAclactotetraosylceramide. The sialic acid recognition site of Siglec7 may be masked due to cis interactions with sialic acid on the surface of the same cell. In the immune response, it acts as an inhibitory receptor, inducing tyrosine phosphorylation upon ligand binding and recruiting cytoplasmic phosphatases through its SH2 domain, thereby blocking signal transduction and inhibiting the cytotoxicity of natural killer cells. Siglec-7 may also play a role in hematopoiesis, inhibiting CD34 + Differentiation of cell precursors toward the myelomonocytic lineage and blocks proliferation of leukemic myeloid cells in vitro. In addition, it interacts with PTPN6 / SHP-1 upon phosphorylation.

[0058] According to an embodiment of the present invention, the tumor cell is selected from at least one of colon cancer cells, breast cancer cells, luminal B-type breast malignant tumor cells and melanoma cells.

[0059] According to an embodiment of the present invention, the tumor cell is at least one of a mouse colon cancer cell, a mouse breast cancer cell, and a mouse luminal B-type breast malignant tumor cell.

[0060] According to an embodiment of the present invention, the tumor cells are mouse colon cancer cells.

[0061] According to an embodiment of the present invention, the mouse colon cancer cells overexpressing Siglec7 are prepared by the following method: constructing a recombinant lentivirus overexpressing Siglec7 and transfecting the mouse colon cancer cells.

[0062] Specifically, the tumor cells overexpressing Siglec7 gene of the present invention are prepared by the following method:

[0063] Using the pLV3 vector as the basic vector, a recombinant plasmid pLV3-Siglec7 that overexpresses the Siglec7 gene was constructed. The recombinant lentivirus was packaged by transfecting the 293T cell line and named LV3-Siglec7. The recombinant lentivirus LV3-Siglec7 was transfected into tumor cells to obtain a tumor cell line that stably expresses Siglec7.

[0064] The present invention also provides a method for preparing the above-mentioned tumor cells overexpressing the Siglec7 gene, which is prepared by the following method:

[0065] Using the pLV3 vector as the basic vector, a recombinant plasmid pLV3-Siglec7 overexpressing the Siglec7 gene was constructed. The recombinant lentivirus was packaged by transfecting the 293T cell line and named LV3-Siglec7. The recombinant lentivirus LV3-Siglec7 was transfected into tumor cells to obtain a cell line stably expressing Siglec7.

[0066] According to an embodiment of the present invention, the Siglec7 gene is the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence obtained by deleting, replacing, inserting, inverting and ectopic one or more bases of the sequence shown in SEQ ID NO: 1.

[0067] According to an embodiment of the present invention, the lentivirus is LV3.

[0068] In the present invention, the recombinant lentivirus overexpressing the Siglec7 gene is constructed, named pLV3-Siglec7, and is transfected into tumor cells to screen and obtain tumor cell lines that highly express Siglec7.

[0069] The present invention uses pLV3 vector as the basic vector, constructs a recombinant plasmid of the overexpressed Siglec7 gene, pLV3-Siglec7, transfects 293T cell lines to package and obtain a recombinant lentivirus, named LV3-Siglec7, and transfects the recombinant lentivirus LV3-Siglec7 into tumor cells to obtain a stably expressed Siglec7 cell line. The cell line was tested to significantly increase the exosome yield per unit cell and unit culture medium volume, and the exosome yield was significantly increased.

[0070] According to an embodiment of the present invention, the Siglec7 overexpression is achieved by at least one of the following methods: viral / non-viral vector-mediated gene / mRNA transfection technology, transposase or recombinase-mediated gene integration, and gene editing or transcriptional activation based on the CRISPR / CAS system.

[0071] According to an embodiment of the present invention, the gene / mRNA transfection technology is achieved by utilizing at least one of the following methods: liposome or LNP-mediated transfection, calcium phosphate-mediated transfection, cationic transfection agent-mediated transfection, virus-like particle VLP-mediated transfection, electroporation transfection, lentiviral vector for gene delivery, adeno-associated virus vector for gene delivery, adenoviral vector for gene delivery and Sendai virus vector for gene delivery.

[0072] The scheme of the present invention will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used are not indicated by the manufacturer and are all conventional products that can be obtained commercially.

[0073] Example 1: Construction of Siglec7 lentivirus

[0074] According to the sequence information of Siglec7 gene (Gene ID: 999), the Siglec7 gene shown in SEQ ID NO: 2 was cloned and the Figure 1 The pLV3 shown in the figure was used as the basic vector to construct the recombinant vector pLV3-Siglec7 containing the Siglec7 gene, and the recombinant vector pLV3-Siglec7 was packaged by transfecting the 293T cell line to generate the Figure 2 LV3-Siglec7 lentivirus as indicated.

[0075] Example 2: Tumor cells stably expressing Siglec7

[0076] The lentivirus LV3-Siglec7 constructed in Example 1 was transfected into mouse colon cancer cells (Cat. No.: CL-0071, Wuhan Pronocell Life Science Co., Ltd.) (virus infection multiplicity MOI value: 20-100) to obtain tumor cells overexpressing the Siglec7 gene, which were cultured in 1640 medium to observe the growth and Siglec7 expression. The results are as follows: Figure 3 and Figure 4 As shown, the results show that the cell viability cultured in the present invention is greater than 90%, and the Siglec7 fluorescence expression is normal when detected by flow cytometry.

[0077] Example 3: Extraction and identification of exosomes from tumor cells

[0078] (1) Extraction of exosomes from tumor cells:

[0079] Tumor cells in the logarithmic growth phase of P3 generation (Control group) and tumor cells overexpressing Siglec7 constructed in Example 2 (Siglec7 EVs group) were selected for culture and exosomes were extracted.

[0080] The specific method is as follows: When the cell confluence reaches 70%-80%, wash the cells with PBS, select serum-free 1640 medium for 48 hours, and then extract exosomes by ultracentrifugation. Take 100mL of cell culture medium and centrifuge at 1000g for 10 minutes to remove cell debris, then centrifuge at 10000g for 30 minutes to remove apoptotic bodies, then collect all supernatants through a 0.22μm filter membrane, and finally centrifuge at 100000g for 70 minutes to discard the supernatant, resuspend the precipitate with 1mL PBS, and then centrifuge at 100000g for 70 minutes to discard the supernatant, resuspend the PBS to obtain exosomes, and store them at -80℃ after aliquoting. The process diagram is as follows Figure 5 shown.

[0081] (2) Electron microscopy detection of exosomes derived from tumor cells:

[0082] The extracted exosomes were resuspended in 20-30 μL PBS, 10 μm was added to the copper grid of the transmission electron microscope for precipitation for 5 min, the floating liquid was removed with filter paper, 10 μm of phosphotungstic acid counterstaining solution was added to the copper grid of the transmission electron microscope for precipitation for 5 min, the floating liquid was removed with filter paper, and the mixture was dried at room temperature and observed on the microscope. The results are as follows: Figure 6 shown.

[0083] Figure 6 The electron microscopy image shows that the size of exosomes is about 50-150nm, and the exosomes are spherical in shape, indicating that there is no difference between the overexpressed Siglec7 exosomes and the control group, which is consistent with the structure of exosomes.

[0084] (3) Analysis of the particle size of exosomes derived from tumor cells:

[0085] The extracted exosomes were resuspended in 2 mL of PBS and placed in a Nano ZS90 Plus (Malvern, UK) for exosome size analysis. Figure 7 As shown, the particle size of the exosomes detected is between 100-150nm, which corresponds to the size of the exosomes detected by TEM and is consistent with the particle size range of the exosomes.

[0086] (4) Detection of exosome particle number from tumor cells:

[0087] The extracted exosomes were resuspended in 2 mL of PBS, and the control and Siglec7 EVs groups were diluted 10 times and 20 times, respectively, for nanoflow cytometry testing. The test showed that the number of particles in the control group was 2.28E+9Particles / mL when diluted 10 times; the number of particles in the Siglec7 EVs group could reach 3.34E+9Particles / mL when diluted 20 times. Figure 8 , Fig. 9 The results showed that the number of exosome particles extracted from tumor cells in the Siglec7 EVs group was significantly higher than that in the Control group.

[0088] (5) Western blot detection of exosomes derived from tumor cells:

[0089] Add protein lysis buffer to the extracted exosome precipitate, place on ice for 10-20 minutes, shake 4-6 times, 20-30 seconds each time. Then centrifuge at 4°C and 11000 rpm for 3-5 minutes, take the supernatant and transfer it to a new centrifuge tube, perform Western blot to detect Siglec7 protein expression, the results are as follows: Fig.10 The results showed that the expression of Siglec7 protein could be detected in the Siglec7 EVs group extracted by ultracentrifugation.

[0090] (6) Cellular exosome uptake experiment:

[0091] The exosome fluorescent material Dil (Biyuntian Biotechnology Co., Ltd., catalog number: C1036) was prepared and mixed with the exosomes extracted above to allow the exosomes to be connected with the dye, and then the excess dye was washed away. A small amount of exosomes containing Dil fluorescent dye were added to the cultured tumor cells, and the culture was continued for 1-4 hours. The supernatant was aspirated and washed with PBS for 2-3 times, and then placed under an inverted fluorescence microscope for detection. The results are as follows Fig.11 As shown, obvious red fluorescence signals of Dil can be observed in exosomes overexpressing Siglec7 compared with the control group.

[0092] (7) Effects of exosomes on tumor cell proliferation:

[0093] Control and Siglec7 EVs were used to culture mouse colon cancer cells, and the proliferation of mouse colon cancer cells was detected by CCK8 (Biyuntian Biotechnology Co., Ltd., C0037). The results are as follows Fig.12 The results showed that Siglec7EVs had an inhibitory effect on cancer cells. After 96 hours of co-culture, the survival rate of cancer cells in the Siglec7EVs group was only about 60%.

[0094] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0095] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. Use of Siglec7 in promoting cells to produce and / or release exosomes.

2. The use according to claim 1, characterized in that The nucleotide sequence of Siglec7 is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting or ectopically positioning one or more bases in the sequence shown in SEQ ID NO: 1; Preferably, the cells are tumor cells.

3. Use of a reagent in preparing a kit, wherein the reagent is used to regulate the expression or activity of Siglec7, and the kit is used to regulate the production and / or release of exosomes in cells.

4. The use according to claim 3, wherein the reagent is used to promote the expression or activity of Siglec7, and the kit is used to promote the production and / or release of exosomes in cells; Optionally, the reagent includes at least one of a viral vector and a virus for overexpressing Siglec7.

5. The use according to claim 3, wherein the reagent is used to inhibit the expression or activity of Siglec7, and the kit is used to inhibit the production and / or release of exosomes in cells; Optionally, the reagent includes siRNA for inhibiting Siglec7 expression; Optionally, the nucleotide sequence of the target site directed by the siRNA is as shown in SEQ ID NO:

2.

6. Use of an agent in the preparation of a drug, wherein the agent is used to promote the expression or activity of Siglec7 in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells; Optionally, the reagent includes at least one of a viral vector and a virus for overexpressing Siglec7.

7. A method for regulating cell production and / or release of exosomes, characterized in that: include: contacting the cells to be treated with a reagent, wherein the reagent is used to regulate the expression or activity of Siglec7; Optionally, the cell is a tumor cell.

8. The method according to claim 7, wherein the agent is used to promote the expression or activity of Siglec7, and the agent comprises at least one of a viral vector and a virus for overexpressing Siglec7.

9. The method according to claim 7, wherein the agent is used to inhibit the expression or activity of Siglec7, and the agent comprises siRNA for inhibiting the expression of Siglec7; Optionally, the nucleotide sequence of the target site directed by the siRNA is as shown in SEQ ID NO:2.

Images