Application of CDH1 in promoting cell production and / or exosome release

Abstract

The invention relates to the field of cell engineering, in particular to application of CDH1 in promoting cell production and / or exosome release. According to the invention, after the lentiviral vector of the over-expressed CDH1 gene is constructed, tumor cells are transfected by the lentiviral vector, and finally the tumor cell strain capable of stably expressing CDH1 is obtained. Through extraction and detection, the cell strain obviously improves the yield of the exosome in unit cell and unit culture medium volume, and the yield of the exosome is obviously improved.

Description

Technical Field

[0001] The present invention belongs to the field of cell engineering, and specifically, relates to the use of CDH1 in promoting cells to produce and / or release exosomes. More specifically, it relates to the use of the reagent in preparing a kit, the use of the reagent in preparing a drug, and a method for regulating cells to produce and / or release exosomes. Background Art

[0002] Cancer is one of the diseases that threatens the lives of many people around the world. It is the second leading cause of death worldwide after cardiovascular disease. Cancer cells have unique characteristics such as high proliferation rate, self-renewal ability, and the ability to switch between different molecular pathways to generate drug resistance. Based on these characteristics, novel therapeutic approaches including nucleic acid drugs and anticancer drugs have been developed to target cancer cells and inhibit their development.

[0003] The novel structures of extracellular vesicles (EVs) play an important role in cancer treatment. These structures can be secreted in all prokaryotic and eukaryotic cells. EVs include exosomes, microparticles, shedding vesicles, apoptotic bodies, tolerosomes, proteasomes, and protrusion bodies. There are two different mechanisms for their formation. In the first mechanism, EVs are directly produced from the cell membrane. In the second mechanism, EVs appear in the exocytosis of multivesicular bodies as part of the endocytic system. EVs participate in the biological functions of cells and play an important role in pathological conditions. They can transfer various molecules between cells, so special attention should be paid to their role in diseases, especially cancer. Due to the good engineering and delivery properties of exosomes, they can produce better effects on tumor immunotherapy and immunomodulation. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art to at least some extent. To this end, the present invention provides the use of CDH1 in promoting cells to produce and / or release exosomes.

[0005] The present invention is accomplished based on the following findings of the inventors:

[0006] At present, the number of exosomes produced and / or released in tumor cells is small, and the effect of small number of exosomes on tumor immunotherapy and immunoregulation is not significant. In order to overcome this problem, the inventors constructed a lentiviral vector that overexpressed the CDH1 gene, transfected it into tumor cells, and finally obtained a tumor cell line that stably expressed CDH1, increased the expression of exosomes in tumor cells, and thus improved the effect of tumor immunotherapy and immunoregulation.

[0007] In the first aspect of the present invention, the present invention proposes the use of CDH1 in promoting cells to produce and / or release exosomes. According to an embodiment of the present invention, stably expressing CDH1 in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the yield of exosomes.

[0008] In a second aspect of the present invention, the present invention provides a use of a reagent in preparing a kit. According to the use of an embodiment of the present invention, the reagent is used to regulate the expression or activity of CDH1, and the kit is used to regulate the production and / or release of exosomes in cells.

[0009] In the third aspect of the present invention, the present invention proposes the use of an agent in the preparation of a drug. According to the use of an embodiment of the present invention, the agent is used to promote the expression or activity of CDH1 in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

[0010] In a fourth aspect of the present invention, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting and treating the cells to be treated with an agent, wherein the agent is used to regulate the expression or activity of CDH1. According to the method of an embodiment of the present invention, the yield of exosomes produced and / or released by tumor cells can be increased.

[0011] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0013] Figure 1 This is a schematic diagram of the structure of the basic carrier LV3 in Example 1 of the present invention.

[0014] Figure 2 Schematic diagram of the structure of the recombinant lentiviral vector in Example 1 of the present invention.

[0015] Figure 3 This is a light microscopic image (10X) of mouse colon cancer cells in Example 2 of the present invention.

[0016] Figure 4 This is a flow cytometry fluorescence image of LV3 lentivirus 293T cells in Example 2 of the present invention.

[0017] Figure 5 This is a schematic diagram of the exosome extraction process in Example 3 of the present invention.

[0018] Figure 6This is an electron micrograph of CDH1 EVs in Example 3 of the present invention.

[0019] Figure 7 This is the particle size analysis of CDH1 EVs in Example 3 of the present invention.

[0020] Figure 8 This is a test of the number of exosome particles extracted in Example 3 of the present invention, where A is the number of particles in the Control group at a 10-fold dilution, and B is the number of particles in the CDH1 EVs group at a 20-fold dilution.

[0021] Fig. 9 This is the number of particles in the Control group and CDH1 EVs group in Example 3 of the present invention.

[0022] Fig.10 This is a Western blot analysis of the expression of exosomal CDH1 protein in Example 3 of the present invention.

[0023] Fig.11 This is a fluorescence image of mouse colon cancer cells taking up two types of exosomes in Example 3 of the present invention.

[0024] Fig.12 The two exosomes in Example 3 of the present invention inhibit the proliferation of mouse colon cancer cells. DETAILED DESCRIPTION

[0025] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0026] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of the present invention, unless otherwise specified, the meaning of "plurality" is two or more.

[0027] In this document, the terms “contain”, “include” or “comprise” are open expressions, that is, they include the contents specified in the present invention but do not exclude other contents.

[0028] As used herein, the terms "optionally", "optional" or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0029] The present invention proposes the use of CDH1 in promoting cells to produce and / or release exosomes, the use of the reagent in preparing a kit, the use of the reagent in preparing a drug, and a method for regulating cells to produce and / or release exosomes, which will be described in detail below.

[0030] Use of CDH1 in promoting cell production and / or release of exosomes

[0031] In the first aspect of the present invention, the present invention proposes the use of CDH1 in promoting cells to produce and / or release exosomes. According to an embodiment of the present invention, stably expressing CDH1 in cells can increase the exosome yield per unit cell and per unit culture medium volume, and increase the yield of exosomes.

[0032] According to an embodiment of the present invention, the nucleotide sequence of CDH1 is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting and misplacing one or more bases in the sequence shown in SEQ ID NO: 1.

[0033] (SEQ ID NO: 1).

[0034] According to an embodiment of the present invention, the cell is a tumor cell.

[0035] Use of reagents in preparing kits

[0036] In a second aspect of the present invention, the present invention provides a use of a reagent in preparing a kit. According to an embodiment of the present invention, the reagent is used to regulate the expression or activity of CDH1, and the kit is used to regulate the production and / or release of exosomes in cells.

[0037] According to an embodiment of the present invention, the reagent is used to promote the expression or activity of CDH1, and the kit is used to promote the production and / or release of exosomes in cells.

[0038] According to an embodiment of the present invention, the reagent includes at least one of a viral vector, a virus and a bioactive factor for overexpressing CDH1. According to an embodiment of the present invention, the reagent further includes but is not limited to gene transfection, signal pathway regulation, and cell culture condition optimization regulation to promote the expression of CDH1.

[0039] According to an embodiment of the present invention, the bioactive factor includes β-hydroxybutyrate.

[0040] According to an embodiment of the present invention, the reagent is used to inhibit the expression or activity of CDH1, and the kit is used to inhibit the production and / or release of exosomes in cells.

[0041] According to an embodiment of the present invention, the reagent includes siRNA for inhibiting the expression of CDH1.

[0042] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO:2.

[0043] CACTGCCAACTGGCTGGAGATTA (SEQ ID NO: 2).

[0044] Use of reagents in the preparation of drugs

[0045] In the third aspect of the present invention, the present invention proposes the use of an agent in preparing a drug. According to an embodiment of the present invention, the agent is used to promote the expression or activity of CDH1 in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

[0046] According to an embodiment of the present invention, the reagent includes at least one of a viral vector, a virus and a bioactive factor for overexpressing CDH1. According to an embodiment of the present invention, the reagent further includes but is not limited to gene transfection, signal pathway regulation, and cell culture condition optimization regulation to promote the expression of CDH1.

[0047] According to an embodiment of the present invention, the bioactive factor includes β-hydroxybutyrate.

[0048] Methods for regulating cell production and / or release of exosomes

[0049] In a fourth aspect of the present invention, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting and treating the cells to be treated with a reagent, wherein the reagent is used to regulate the expression or activity of CDH1. According to the method of an embodiment of the present invention, the yield of exosomes produced and / or released by cells can be increased.

[0050] According to an embodiment of the present invention, the cell is a tumor cell.

[0051] According to an embodiment of the present invention, the reagent is used to promote the expression or activity of CDH1, and the reagent includes at least one of a viral vector, a virus and a biologically active factor for overexpressing CDH1. According to an embodiment of the present invention, the reagent further includes but is not limited to gene transfection, signal pathway regulation, and cell culture condition optimization regulation to promote the expression of CDH1.

[0052] According to an embodiment of the present invention, the bioactive factor includes β-hydroxybutyrate.

[0053] According to an embodiment of the present invention, the reagent is used to inhibit the expression or activity of CDH1, and the reagent includes siRNA for inhibiting the expression of CDH1.

[0054] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO:2.

[0055] According to an embodiment of the present invention, the culture medium used for culturing cells is serum-free 1640 culture medium.

[0056] According to an embodiment of the present invention, the method for producing and / or releasing exosomes is as follows: selecting mouse colon cancer cells transfected with a recombinant lentiviral vector in the P3 generation logarithmic growth phase, and when the cells grow to 70%-80%, continuing to culture with serum-free 1640 medium, ultracentrifuging, and obtaining exosomes.

[0057] The present invention uses the LV3 vector as the basic vector to construct a lentiviral vector that overexpresses the CDH1 gene, which is transfected into tumor cells to obtain a CDH1 cell line that stably expresses. Through exosome extraction and detection, the cell line significantly improves the exosome yield per unit cell and per unit culture medium volume, and the exosome production is improved. In addition, the present invention purifies and separates exosomes through the GFP tag carried by the lentivirus, which solves the defects of traditional methods to a certain extent and promotes the scientific research and clinical level of tumor cell exosomes.

[0058] Tumor cells

[0059] In a fifth aspect of the present invention, the present invention provides a tumor cell. According to an embodiment of the present invention, CDH1 is overexpressed in the tumor cell. According to the tumor cell of the embodiment of the present invention, the production of exosomes can be increased.

[0060] Among them, it needs to be explained that the CDH1 (E-cadherin) gene is a tumor suppressor gene located on chromosome 16 (16q22.1). As an adhesion molecule and calcium-dependent, its expression status is related to the differentiation and invasion capabilities of various tumors. The loss of expression of this gene will lead to a stronger proliferation ability of tumor cells, an enlarged gap between cells, easier shedding, and a stronger epithelial-mesenchymal transition (EMT) ability. In normal cells, E-cadherin mainly exerts its tumor-suppressing effect by binding to E-cadherim and separating it from LEF (lymphoid enhancer factor) / TCF (T cell factor) with the function of proliferating WNT signaling pathway transcription genes. In addition, the loss of the CDH1 gene will bring higher cell viability to A549 cells, that is, the metastasis and invasion capabilities of lung adenocarcinoma cells will be enhanced.

[0061] According to an embodiment of the present invention, the tumor cell is at least one of a colon cancer cell, a breast cancer cell, a luminal B-type breast malignant tumor cell and a melanoma cell.

[0062] According to an embodiment of the present invention, the tumor cell is at least one of a mouse colon cancer cell, a mouse breast cancer cell, and a mouse luminal B-type breast malignant tumor cell.

[0063] According to an embodiment of the present invention, the tumor cells are mouse colon cancer cells.

[0064] According to an embodiment of the present invention, the mouse colon cancer cells overexpressing CDH1 are prepared by the following method: constructing a recombinant lentivirus overexpressing CDH1 and transfecting the mouse colon cancer cells.

[0065] Specifically, the tumor cells overexpressing the CDH1 gene of the present invention are prepared by the following method:

[0066] Using the pLV3 vector as the basic vector, a recombinant plasmid pLV3-CDH1 that overexpressed the CDH1 gene was constructed and transfected into the 293T cell line to obtain a recombinant lentivirus, named LV3-CDH1. The recombinant lentivirus LV3-CDH1 was transfected into tumor cells to obtain a tumor cell line that stably expressed CDH1.

[0067] The present invention also provides a method for preparing the above-mentioned tumor cells overexpressing the CDH1 gene, which is prepared by the following method:

[0068] Using pLV3 vector as the basic vector, a recombinant plasmid pLV3-CDH1 overexpressing the CDH1 gene was constructed and transfected into 293T cell lines to obtain a recombinant lentivirus, named LV3-CDH1. The recombinant lentivirus LV3-CDH1 was transfected into tumor cells to obtain a cell line stably expressing CDH1.

[0069] According to an embodiment of the present invention, the CDH1 gene is the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence obtained by deleting, replacing, inserting, inverting and ectopic one or more bases of the sequence shown in SEQ ID NO: 1.

[0070] According to an embodiment of the present invention, the lentivirus is LV3.

[0071] In the present invention, the recombinant lentivirus overexpressing the CDH1 gene is constructed, named pLV3-CDH1, and is transfected into tumor cells to screen and obtain tumor cell lines that highly express CDH1.

[0072] The present invention uses pLV3 vector as the basic vector, constructs a recombinant plasmid of overexpressed CDH1 gene, pLV3-CDH1, transfects 293T cell line to package to obtain recombinant lentivirus, named LV3-CDH1, and transfects the recombinant lentivirus LV3-CDH1 into tumor cells to obtain a CDH1 cell line with stable expression. The cell line was tested to significantly increase the exosome yield per unit cell and unit culture medium volume, and the exosome yield was significantly increased.

[0073] According to an embodiment of the present invention, the CDH1 overexpression is achieved by at least one of the following methods: viral / non-viral vector-mediated gene / mRNA transfection technology, transposase or recombinase-mediated gene integration, and gene editing or transcriptional activation based on the CRISPR / CAS system.

[0074] According to an embodiment of the present invention, the gene / mRNA transfection technology is achieved by utilizing at least one of the following methods: liposome or LNP-mediated transfection, calcium phosphate-mediated transfection, cationic transfection agent-mediated transfection, virus-like particle VLP-mediated transfection, electroporation transfection, lentiviral vector for gene delivery, adeno-associated virus vector for gene delivery, adenoviral vector for gene delivery and Sendai virus vector for gene delivery.

[0075] The scheme of the present invention will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used are not indicated by the manufacturer and are all conventional products that can be obtained commercially.

[0076] Example 1: Construction of CDH1 lentivirus

[0077] According to the CDH1 gene sequence information (Gene ID: 999), the CDH1 gene shown in SEQ ID NO: 2 was cloned and Figure 1 The pLV3 shown in the figure was used as the basic vector to construct the recombinant vector pLV3-CDH1 containing the CDH1 gene, and the recombinant vector pLV3-CDH1 was packaged by transfecting the 293T cell line to generate the Figure 2 LV3-CDH1 lentivirus as indicated.

[0078] Example 2: CDH1 stably expressed tumor cells

[0079] The lentivirus LV3-CDH1 constructed in Example 1 was transfected into mouse colon cancer cells (Wuhan Pronocell Life Science Co., Ltd., catalog number: CL-0071) (virus infection multiplicity MOI value: 20-100) to obtain tumor cells overexpressing the CDH1 gene, which were cultured in 1640 medium to observe the growth and CDH1 expression. The results are as follows: Figure 3 and Figure 4 As shown, the results show that the cell viability cultured in the present invention is as high as 90% or more, and CDH1 fluorescence expression is normal when detected by flow cytometry.

[0080] Example 3: Extraction and identification of exosomes from tumor cells

[0081] (1) Extraction of exosomes from tumor cells:

[0082] The P3 generation overexpressing tumor cells (Control group) and the CDH1 overexpressing tumor cells constructed in Example 2 (CDH1 EVs group) were selected for culture and exosome extraction.

[0083] The specific method is as follows: When the cell confluence reaches 70%-80%, wash the cells with PBS, select serum-free 1640 medium for 48 hours, and then extract exosomes by ultracentrifugation. Take 100mL of cell culture medium and centrifuge at 1000g for 10 minutes to remove cell debris, then centrifuge at 10000g for 30 minutes to remove apoptotic bodies, then collect all supernatants through a 0.22μm filter membrane, and finally centrifuge at 100000g for 70 minutes to discard the supernatant, resuspend the precipitate with 1mL PBS, and then centrifuge at 100000g for 70 minutes to discard the supernatant, resuspend the PBS to obtain exosomes, and store them at -80℃ after aliquoting. The process diagram is as follows Figure 5 shown.

[0084] (2) Electron microscopy detection of exosomes derived from tumor cells:

[0085] The extracted exosomes were resuspended in 20-30 μL PBS, 10 μm was added to the copper grid of the transmission electron microscope for precipitation for 5 min, the floating liquid was removed with filter paper, 10 μm of phosphotungstic acid counterstaining solution was added to the copper grid of the transmission electron microscope for precipitation for 5 min, the floating liquid was removed with filter paper, and the mixture was dried at room temperature and observed on the microscope. The results are as follows: Figure 6 shown.

[0086] Figure 6 The electron microscopy image showed that the size of exosomes was about 50-150nm, and the exosomes were spherical in shape, indicating that there was no difference between the overexpressed CDH1 exosomes and the conventional group, which was consistent with the structure of exosomes.

[0087] (3) Analysis of the particle size of exosomes derived from tumor cells:

[0088] The extracted exosomes were resuspended in 2 mL of PBS and placed in a Nano ZS90 Plus (Malvern, UK) for exosome size analysis. Figure 7 As shown, the particle size of the exosomes detected is between 100-150nm, which corresponds to the size of the exosomes detected by TEM and is consistent with the particle size range of the exosomes.

[0089] (4) Detection of exosome particle number from tumor cells:

[0090] The extracted exosomes were resuspended in 2 mL of PBS, and the control and CDH1 EVs groups were diluted 10 times and 20 times, respectively, for nanoflow cytometry testing. The test showed that the number of particles in the control group was 2.28E+9Particles / mL when diluted 10 times; the number of particles in the CDH1 EVs group could reach 3.34E+9Particles / mL when diluted 20 times. Figure 8 , Fig. 9The results showed that the number of exosome particles extracted from tumor cells in the CDH1 EVs group was significantly higher than that in the Control group.

[0091] (5) Western blot detection of exosomes derived from tumor cells:

[0092] Add protein lysis buffer to the extracted exosome precipitate, place on ice for 10-20 minutes, shake 4-6 times, 20-30 seconds each time. Then centrifuge at 4°C and 11000 rpm for 3-5 minutes, take the supernatant and transfer it to a new centrifuge tube, perform Western blot to detect CDH1 protein expression, the results are as follows: Fig.10 The results showed that the expression of CDH1 protein could be detected in the CDH1 EVs group extracted by ultracentrifugation.

[0093] (6) Cellular uptake of exosomes:

[0094] The exosome fluorescent material Dil (Biyuntian Biotechnology Co., Ltd., catalog number: C1036) was prepared and mixed with the exosomes extracted above to allow the exosomes to be connected with the dye, and then the excess dye was washed away. A small amount of exosomes containing Dil fluorescent dye were added to the cultured tumor cells, and the culture was continued for 1-4 hours. The supernatant was aspirated and washed with PBS for 2-3 times, and then placed under an inverted fluorescence microscope for detection. The results are as follows Fig.11 As shown, obvious red fluorescence signals of Dil can be observed in the exosomes overexpressing CDH1 compared with the control group.

[0095] (7) Effects of exosomes on tumor cell proliferation:

[0096] Control and CDH1 EVs were used to culture mouse colon cancer cells, and the proliferation of mouse colon cancer cells was detected by CCK8 (Biyuntian Biotechnology Co., Ltd., C0037). The results are as follows Fig.12 The results showed that CDH1 EVs had an inhibitory effect on cancer cells. After 96 hours of co-culture, the survival rate of cancer cells in the CDH1 EVs group was only about 70%.

[0097] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0098] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. Use of CDH1 in promoting cells to produce and / or release exosomes.

2. The use according to claim 1, characterized in that The nucleotide sequence of CDH1 is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting or misplacing one or more bases in the sequence shown in SEQ ID NO: 1; Preferably, the cells are tumor cells.

3. Use of a reagent in preparing a kit, wherein the reagent is used to regulate the expression or activity of CDH1, and the kit is used to regulate the production and / or release of exosomes in cells.

4. The use according to claim 3, wherein the reagent is used to promote the expression or activity of CDH1, and the kit is used to promote the production and / or release of exosomes in cells; Optionally, the reagent includes at least one of a viral vector, a virus and a biologically active factor for overexpressing CDH1; Optionally, the bioactive factor comprises beta-hydroxybutyrate.

5. The use according to claim 3, wherein the reagent is used to inhibit the expression or activity of CDH1, and the kit is used to inhibit the production and / or release of exosomes in cells; Optionally, the reagent includes siRNA for inhibiting CDH1 expression; Optionally, the nucleotide sequence of the target site directed by the siRNA is as shown in SEQ ID NO:

2.

6. Use of an agent in the preparation of a drug, wherein the agent is used to promote the expression or activity of CDH1 in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells; Optionally, the reagent includes at least one of a viral vector, a virus and a biologically active factor for overexpressing CDH1; Optionally, the bioactive factor comprises beta-hydroxybutyrate.

7. A method for regulating cell production and / or release of exosomes, characterized in that: include: contacting the cells to be treated with a reagent, wherein the reagent is used to regulate the expression or activity of CDH1; Optionally, the cell is a tumor cell.

8. The method according to claim 7, wherein the reagent is used to promote the expression or activity of CDH1, and the reagent comprises at least one of a viral vector, a virus and a biologically active factor for overexpressing CDH1; Optionally, the bioactive factor comprises beta-hydroxybutyrate.

9. The method according to claim 7, wherein the reagent is used to inhibit the expression or activity of CDH1, and the reagent comprises siRNA for inhibiting the expression of CDH1; Optionally, the nucleotide sequence of the target site directed by the siRNA is as shown in SEQ ID NO:2.

Images