Development and application of a molecular marker for pine maternal identification
By detecting SNP sites in pine mitochondria and using PCR technology to identify pine parent trees, the problem of difficulty in distinguishing parent trees in traditional pine identification methods has been solved, achieving efficient and accurate identification of parent trees.
Patent Information
- Application Number
- CN202411468116.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-21
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-10-21
AI Technical Summary
Traditional pine identification methods, based on morphological characteristics, are difficult to accurately distinguish germplasm, especially in overlapping distribution areas and tree species with large genetic variations. Furthermore, existing molecular markers such as SSR and ISSR cannot effectively distinguish between the maternal and paternal parents of hybrid offspring.
The maternal origin of pine trees was identified by analyzing nucleotide polymorphisms in pine mitochondria using methods that detect SNP40, SNP81, SNP318, SNP443, SNP521, and SNP590, combined with PCR technology for amplification and detection.
This method enables accurate identification of pine parent trees, solving the problem of difficulty in distinguishing parent trees in traditional methods and improving identification efficiency and accuracy.
Smart Images

Figure CN119506454B_ABST
Abstract
Description
Technical Field
[0001] This invention specifically relates to the development and application of molecular markers for the identification of pine parent trees. Background Technology
[0002] Traditional classification of pine trees is mainly based on germplasm identification using phenotypic traits. However, morphological characteristics are unreliable in distinguishing some species, primarily because: some species have overlapping natural distributions and no reproductive isolation, but exhibit significant intraspecific genetic variation, making them difficult to differentiate; the morphological characteristics and anatomical traits of offspring from hybridization of different species usually fall between those of the two parents; some pine species show significant variation in morphological traits within their populations, with the same population exhibiting marked morphological changes under different site conditions, affecting observation results; and some interspecific phenotypic differences only manifest at certain growth and development stages, making it impossible to determine the maternal origin in the early stages.
[0003] With the development of molecular markers, mature and reliable techniques have been provided for identifying germplasm with consistent genetic backgrounds. Among all molecular markers, microsatellite markers (simple sequence repeat, SSR) and ISSR (inter-simple sequence repeat) technologies are more stable than RAPD (random amplified polymorphic DNA) and AFLPs (amplified fragment length polymorphisms). SSR is widely used for germplasm identification of closely related species and hybrids, as well as for evaluating the genetic diversity of germplasm. However, its drawbacks include the need to design specific primers, and the high cost of developing a large number of primers. Furthermore, SSR and ISSR can only identify the parental tree species of hybrid offspring, and cannot further distinguish between the paternal and maternal parents of the hybrid offspring. How to identify the maternal origin of pine trees is a technical problem faced by researchers in this field. Summary of the Invention
[0004] The technical problem solved by this invention is how to provide a method for identifying the source of pine parent trees.
[0005] To address the aforementioned technical problems, the present invention provides the following applications.
[0006] Application of substances that detect SNP40, SNP81, SNP318, SNP443, SNP521 and / or SNP590 in the identification of the parent pine of the test or in the preparation of products for the identification of the parent pine of the test;
[0007] SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, and is either C or T.
[0008] SNP81 is a SNP in pine mitochondria, the 81st nucleotide of sequence 1, which is either A or C;
[0009] SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, and it is either C or T.
[0010] SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, and it is either A or C.
[0011] SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, and is either G or T.
[0012] SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, and it is either G or T.
[0013] SNP590 is a SNP in pine mitochondria, the 590th nucleotide of sequence 1, which is either A or C.
[0014] In this application, the pine parent plant can be a source of pine parent plants.
[0015] In the above text, the parent pine tree to be tested can be any one of the following: Scots pine, red pine, oil pine, Korean pine, Xinjiang five-needle pine, Huashan pine, white pine, or North American pine.
[0016] To address the aforementioned technical problems, the present invention also provides the following applications.
[0017] The application is any one of the following:
[0018] 1) Application of substances that detect SNP40 in the preparation of products for identifying whether the parent pine of the test pine tree comes from Pinus armandii;
[0019] 2) Application of substances that detect SNP81 in the preparation of products for identifying whether the parent pine of the test tree is from North American pine trees;
[0020] 3) Application of substances that detect SNP318 in the preparation of products for identifying whether the parent pine of the test pine tree comes from Pinus bungeana;
[0021] 4) Application of substances that detect SNP521 in the preparation of products for identifying whether the parent pine of the test pine tree comes from Korean pine;
[0022] 5) Application of substances that detect SNP40 and SNP590 in the preparation of products for identifying whether the parent pine of the test pine tree comes from Xinjiang five-needle pine;
[0023] 6) Application of substances that detect SNP254 and SNP443 in the preparation of products for identifying whether the parent pine of the test pine comes from Pinus tabuliformis;
[0024] 7) Application of the substance for detecting SNP443 in the preparation of a product to identify whether the parent pine tree to be tested is derived from pine A, wherein pine A is composed of Scots pine and red pine;
[0025] SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, and is either C or T.
[0026] SNP81 is a SNP in pine mitochondria, the 81st nucleotide of sequence 1, which is either A or C;
[0027] SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, and it is either C or T.
[0028] SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, and it is either A or C.
[0029] SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, and is either G or T.
[0030] SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, and it is either G or T.
[0031] SNP590 is a SNP in pine mitochondria, the 590th nucleotide of sequence 1, which is either A or C.
[0032] In the above text, Sequence 1 is a mitochondrial DNA sequence, which includes intron sequences. In actual detection, SNP40, SNP81, SNP254, SNP318, SNP443, SNP521, and SNP590 can be detected and analyzed by detecting the nucleotide sequence of the mRNA transcribed from Sequence 1, the cDNA transcribed from the mRNA, or the amino acid sequence of the protein they encode.
[0033] To address the aforementioned technical problems, the present invention also provides the following method.
[0034] The method is derived from any of the following:
[0035] M1) A method for identifying or assisting in identifying whether the parent pine of the test pine comes from Pinus armandii, including detecting SNP40 in the mitochondria of the test pine, and determining whether the parent pine of the test pine comes from Pinus bungeana based on the detection results, wherein the SNP40 comes from the above-mentioned SNP40;
[0036] If the SNP40 of the pine tree to be tested is T, the parent tree of the pine tree to be tested comes from Pinus armandii; if the SNP40 of the pine tree to be tested is C, the parent tree of the pine tree to be tested does not come from Pinus armandii.
[0037] M2) A method for identifying or assisting in the identification of whether the parent pine of the test pine comes from North American pine, including detecting SNP81 in the mitochondria of the test pine, and determining whether the parent pine of the test pine comes from North American pine based on the detection results, wherein the SNP81 is the aforementioned SNP81;
[0038] If the SNP81 of the pine tree to be tested is A, the parent tree of the pine tree to be tested comes from North American pine; if the SNP81 of the pine tree to be tested is C, the parent tree of the pine tree to be tested does not come from North American pine.
[0039] M3) A method for identifying or assisting in the identification of whether the parent pine tree to be tested comes from Pinus bungeana, including detecting SNP318 in the mitochondria of the pine tree to be tested, and determining whether the parent pine tree to be tested comes from Pinus bungeana based on the detection results, wherein the SNP318 is the aforementioned SNP318;
[0040] If the SNP318 of the pine tree to be tested is C, the parent tree of the pine tree to be tested comes from Pinus bungeana; if the SNP318 of the pine tree to be tested is A, the parent tree of the pine tree to be tested does not come from Pinus bungeana.
[0041] M4) A method for identifying or assisting in the identification of whether the parent pine of the test pine comes from Korean pine, including detecting SNP521 in the mitochondria of the test pine, and determining whether the parent pine of the test pine comes from Korean pine based on the detection results, wherein the SNP521 is the aforementioned SNP521;
[0042] If the SNP521 of the pine tree to be tested is T, the parent tree of the pine tree to be tested comes from Korean pine; if the SNP521 of the pine tree to be tested is G, the parent tree of the pine tree to be tested does not come from Korean pine.
[0043] M5) A method for identifying or assisting in identifying whether the parent pine tree to be tested is from Xinjiang five-needle pine, including detecting SNP40 and SNP590 in the mitochondria of the parent pine tree to be tested, and determining whether the parent pine tree to be tested is from Xinjiang five-needle pine based on the detection results, wherein the SNP40 is from the SNP40 of claim 1, and the SNP590 is from the above-mentioned SNP590.
[0044] If the SNP40 of the pine tree to be tested is C and the SNP590 is C, then the parent tree of the pine tree to be tested comes from Xinjiang five-needle pine; otherwise, the parent tree of the pine tree to be tested does not come from Xinjiang five-needle pine.
[0045] M6) A method for identifying or assisting in the identification of whether the parent pine of the test pine comes from Pinus tabuliformis, including detecting SNP254 and SNP443 in the mitochondria of the test pine, and determining whether the parent pine of the test pine comes from Pinus tabuliformis based on the detection results, wherein SNP254 is the SNP254 described in claim 1, and SNP443 is derived from the above-mentioned SNP443;
[0046] If the SNP254 of the pine tree to be tested is C and the SNP443 is T, then the parent tree of the pine tree to be tested comes from Pinus tabuliformis; otherwise, the parent tree of the pine tree to be tested does not come from Pinus tabuliformis.
[0047] M7) A method for identifying or assisting in the identification of whether the parent pine tree to be tested comes from pine tree A, including detecting SNP443 in the mitochondria of the parent pine tree to be tested, and determining whether the parent pine tree to be tested comes from pine tree A based on the detection results, wherein the SNP443 comes from the above-mentioned SNP443, and the parent pine tree A is composed of red pine and Scots pine;
[0048] If the SNP443 of the pine tree to be tested is G, then the parent tree of the pine tree to be tested comes from pine tree A; otherwise, the parent tree of the pine tree to be tested does not come from pine tree A.
[0049] SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, and is either C or T.
[0050] SNP81 is a SNP in pine mitochondria, the 81st nucleotide of sequence 1, which is either A or C;
[0051] SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, and it is either C or T.
[0052] SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, and it is either A or C.
[0053] SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, and is either G or T.
[0054] SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, and it is either G or T.
[0055] SNP590 is a SNP in pine mitochondria, the 590th nucleotide of sequence 1, which is either A or C.
[0056] In the above text, if the parent pine tree to be tested is red pine, the genome sequence of the pine tree to be tested is sequence 11.
[0057] In the above text, if the parent pine tree to be tested is Pinus sylvestris, the genome sequence of the pine tree to be tested in region 1 is sequence 12.
[0058] In the above text, if the parent pine tree to be tested is Pinus tabuliformis, the genome sequence of the pine tree to be tested in region 1 is sequence 13.
[0059] In the above text, if the parent pine tree to be tested is white pine, the genome sequence of the pine tree to be tested in region 1 is sequence 14.
[0060] In the above text, if the parent pine tree to be tested is Pinus armandii, the genome sequence of the pine tree to be tested in region 1 is sequence 15.
[0061] In the above text, if the parent pine tree to be tested is Korean pine, the genome sequence of the pine tree to be tested in region 1 is sequence 16.
[0062] In the above text, if the parent pine tree to be tested is Xinjiang five-needle pine, the genome sequence of the pine tree to be tested in region 1 is sequence 17.
[0063] In the above text, if the parent pine tree to be tested is a North American pine, the genome sequence of the pine tree to be tested in region 1 is sequence 18.
[0064] To solve the above-mentioned technical problems, the present invention also provides the following
[0065] To address the aforementioned technical problems, the present invention also provides the following products.
[0066] The product is any one of the following:
[0067] P1) Identifying or assisting in the identification of whether the parent pine tree to be tested is a product of Pinus armandii, including the detection of SNPs of the pine tree to be tested, wherein the SNP is SNP40 as described in claim 1;
[0068] P2) Products for identifying or assisting in the identification of whether the parent pine tree to be tested is a North American pine, including substances for detecting SNPs of the parent pine tree to be tested, wherein the SNP is SNP81 as described in claim 1;
[0069] P3) Products for identifying or assisting in identifying whether the parent pine tree to be tested is white pine, including substances for detecting SNPs of the pine tree to be tested, wherein the SNP is SNP318 as described in claim 1;
[0070] P4) Products for identifying or assisting in the identification of whether the parent pine tree to be tested is Korean pine, including substances for detecting SNPs of the pine tree to be tested, wherein the SNP is SNP521 as described in claim 1.
[0071] P5) Products for identifying or assisting in identifying whether the parent pine tree to be tested is from Xinjiang five-needle pine, including substances for detecting SNPs of the pine tree to be tested, wherein the SNPs are SNP40 and SNP590 as described in claim 1;
[0072] P6) Products for identifying or assisting in identifying whether the parent pine tree to be tested is Pinus tabuliformis, including substances for detecting SNPs of the pine tree to be tested, wherein the SNPs are SNP254 and SNP443 as described in claim 1;
[0073] P7) Identify or assist in identifying whether the parent pine tree to be tested is a product of pine tree A, wherein pine tree A is composed of red pine and larch, and includes a substance for detecting the SNP of the pine tree to be tested, wherein the SNP is SNP443 as described in claim 1.
[0074] In the above applications, methods, and products, the product for detecting SNP40, SNP81, SNP254, SNP318, SNP443, SNP521, and / or SNP590 is as follows: D1), D2), D3), or D4):
[0075] D1) Contains in vitro nucleic acid amplification primers that specifically amplify and detect the SNP;
[0076] D2) An in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primers described in D1);
[0077] D3) A kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2);
[0078] D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2), or the kit described in D3).
[0079] The in vitro nucleic acid amplification technology may be polymerase chain reaction (PCR), chain substitution amplification (SDA), ligase chain reaction (LCR), sequence-dependent amplification (NASBA), rolling circle nucleic acid amplification (RCA), loop-mediated isothermal amplification (lamp), helicase-dependent isothermal amplification (HDA), or Qβ replication technology.
[0080] This application uses polymerase chain reaction (PCR) as an amplification method to detect polymorphism.
[0081] The specific amplification described in D1) can detect the nucleotide sequence of SNP1-SNP8 polymorphic sites by the presence or absence of amplification products or by combining the presence or absence of amplification products with auxiliary reagents such as probes.
[0082] In the above applications, methods, and products, the in vitro nucleic acid amplification primers may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moieties (positive or negative) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling.
[0083] In M1 above, if the parent pine tree to be tested is not from Pinus armandii, then the parent pine tree to be tested may be from Pinus sylvestris, Pinus tabuliformis, Pinus tabuliformis, Pinus koraiensis, Pinus koraiensis, Pinus pumilum, Pinus koraiensis, Pinus pumilum, Pinus bungeana, or Pinus thunbergii.
[0084] In the above M2), if the parent pine tree to be tested does not come from North American pine, then the parent pine tree to be tested may come from Scots pine, red pine, oil pine, Korean pine, Xinjiang five-needle pine, white pine or Huashan pine.
[0085] In the above M3), if the parent pine tree to be tested is not a white pine, then the parent pine tree to be tested can be a Chinese pine, a Scots pine, a red pine, a Chinese pine, a Xinjiang five-needle pine, or a North American pine.
[0086] In the above M4), if the parent pine tree to be tested is not from Korean pine, then the parent pine tree to be tested can be from white pine, Chinese pine, Scots pine, red pine, oil pine, Xinjiang five-needle pine or North American pine.
[0087] In the above M5), if the parent pine tree to be tested is not from Xinjiang five-needle pine, then the parent pine tree to be tested can be from Scots pine, red pine, oil pine, Korean pine, Huashan pine, white pine or North American pine.
[0088] In the above M6), if the parent pine tree to be tested is not from Pinus tabuliformis, then the parent pine tree to be tested may be from Pinus bungeana, Pinus armandii, Pinus sylvestris, Pinus tabuliformis, Pinus koraiensis, Pinus koraiensis, Pinus koraiensis, Pinus koraiensis, Pinus koraiensis, or Pinus thunbergii.
[0089] In the above M7), if the parent pine tree to be tested does not come from red pine or larch, then the parent pine tree to be tested may come from white pine, Chinese pine, oil pine, red pine, Xinjiang five-needle pine or North American pine.
[0090] In the above applications, products, or methods, the in vitro nucleic acid amplification primers include amplification primer pair d; the primer pair d consists of primers dF and dR;
[0091] The primer dF is a single-stranded nucleotide molecule with nucleotide sequence 10; the primer dR is a single-stranded nucleotide molecule with nucleotide sequence 11.
[0092] To address the aforementioned technical problems, the present invention also provides the following applications.
[0093] The application of substances that detect the parent pine tree in identifying the parent pine tree or in preparing products for identifying the parent pine tree; the substances that detect the parent pine tree are substances that detect SNP40, SNP81, SNP254, SNP318, SNP443, SNP521 and / or SNP590.
[0094] SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, and is either C or T.
[0095] SNP81 is a SNP in pine mitochondria, the 81st nucleotide of sequence 1, which is either A or C;
[0096] SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, and it is either C or T.
[0097] SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, and it is either A or C.
[0098] SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, and is either G or T.
[0099] SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, and it is either G or T.
[0100] SNP590 is a SNP in pine mitochondria, the 590th nucleotide of sequence 1, which is either A or C.
[0101] To address the aforementioned technical problems, the present invention also provides the following applications.
[0102] Application of Sequence 1 in the preparation of products for identifying parental and / or maternal pine sources.
[0103] Application of Sequence 1 in identifying the parental and / or maternal origin of pine trees.
[0104] Beneficial effects
[0105] This invention discloses the development and application of molecular markers for the identification of pine parent trees. The technical problem addressed is how to identify or assist in the identification of pine parent trees. Specifically, it discloses the application of substances detecting SNP40, SNP81, SNP318, SNP443, SNP521, and / or SNP590 in the identification of pine parent trees to be tested or in the preparation of products for identifying pine parent trees to be tested; wherein SNP40 is a SNP in pine mitochondria, the 40th nucleotide of sequence 1, and is C or T; SNP81 is a SNP in pine mitochondria, the 81st nucleotide of sequence 1, and is A or C; SNP254 is a SNP in pine mitochondria, the 254th nucleotide of sequence 1, and is... C or T; SNP318 is a pine mitochondrial SNP, the 318th nucleotide of sequence 1, which is A or C; SNP443 is a pine mitochondrial SNP, the 443rd nucleotide of sequence 1, which is G or T; SNP521 is a pine mitochondrial SNP, the 521st nucleotide of sequence 1, which is G or T; SNP590 is a pine mitochondrial SNP, the 590th nucleotide of sequence 1, which is A or C. The source of the parent plant to be tested is determined according to the sequence. This invention can be used in industrial and agricultural production. Attached Figure Description
[0106] Figure 1 A comparison diagram of mitochondrial rps4 marker sequences.
[0107] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0108] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0109] In the following examples, DNA sequences were obtained using the Sanger sequencing method. The sequencing results are expressed in the form of four bases: ATCG. The results were verified using Sanger Scanner 2.0 software, and a single peak indicates that the sequencing results are accurate.
[0110] In terms of morphological characteristics, tree species with similar distribution areas may not be distinguishable; the morphological characteristics of the same tree species may vary significantly at different ages or under different site conditions; and the morphological characteristics of offspring produced by hybridization are also difficult to determine from their parents.
[0111] Commonly used molecular markers SSR and ISSR require the design of specific primers, and the development of a large number of primers is costly. Furthermore, these two markers can only identify the parent tree species of the hybrid offspring and cannot further distinguish between the father and mother of the hybrid offspring.
[0112] Eukaryotic cells possess a small genome within their cytoplasm, including mitochondrial DNA and chloroplast DNA, which exhibit a degree of genetic autonomy and can relatively independently determine the inheritance of certain traits. In pine trees, mitochondrial DNA is maternally inherited. Based on this characteristic of pine trees, this invention develops specific primers for common northern pine trees to differentiate mitochondria from different pine species as much as possible. By comparing the DNA sequences of the target fragments, not only can the tree species be distinguished, but the maternal or parental lineage of hybrid offspring can also be determined.
[0113] Example 1: Development of Labeled Primers
[0114] Detection of pine parent plant source:
[0115] Based on mitochondrial genome data from *Pinus stagnum*, needles from common northern Chinese pines such as *Pinus densiflora*, *Pinus sylvestris*, *Pinus tabuliformis*, *Pinus bungeana*, *Pinus koraiensis*, *Pinus armandii*, *Pinus strobus*, and *Pinus sibirica* were used as materials. Mitochondrial-specific markers were screened through single-gene amplification and sequence comparison. The screening principles were as follows: the selected sequences should be able to distinguish different species as much as possible; relatively conserved regions were selected, avoiding large gaps; the selected sequences must have a sequence identical to all species at both ends for primer design; to ensure primer stability, the primer length range was set to 18-25 bp, and the annealing temperature to 50-60℃; considering the limitations of Sanger sequencing technology, the target band range was set to 400-1500 bp. Based on the screening principles, one primer (rps4) was finally determined, as shown in Table 1. The amplification sequences of different primers in different species are as follows:
[0116] This invention discovered a sequence in mitochondria with multiple mutation polymorphism sites, which is named rps4. The specific sequence 1 is as follows:
[0117] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCyCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATmTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCAyATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTyCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATyATkmAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCyAATATCTATTGAAGAkAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAAkAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAkAAAAAAmAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAmAAAkACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA(Sequence 1). Where y is C or T; k is G or T; m is A or C.
[0118] SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, and is either C or T.
[0119] SNP81 is a SNP in pine mitochondria, the 81st nucleotide of sequence 1, which is either A or C;
[0120] SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, and it is either C or T.
[0121] SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, and it is either A or C.
[0122] SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, and is either G or T.
[0123] SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, and it is either G or T.
[0124] SNP590 is a SNP in pine mitochondria, the 590th nucleotide of sequence 1, which is either A or C.
[0125] If the SNP40 of the pine tree being tested is T, then its parent tree is Pinus armandii. If the SNP40 of the pine tree being tested is C, then its parent tree is not Pinus armandii. Its parent tree could be Pinus sylvestris, Pinus tabuliformis, Pinus tabuliformis, Pinus koraiensis, Pinus koraiensis, Pinus koraiensis, Pinus bungeana, or Pinus thunbergii.
[0126] If the SNP81 of the pine tree being tested is A, then its parent tree is a North American pine. If the SNP81 of the pine tree being tested is C, then its parent tree is not a North American pine. Therefore, its parent tree could be Scots pine, red pine, Chinese pine, Korean pine, Xinjiang five-needle pine, white pine, or Huashan pine.
[0127] If the SNP254 of the pine tree being tested is C, then its parent tree is red pine, Scots pine, or Chinese pine. If the SNP254 of the pine tree being tested is T, then its parent tree is not red pine, Scots pine, or Chinese pine. Its parent tree could be North American pine, Korean pine, Xinjiang five-needle pine, whitebark pine, or Huashan pine.
[0128] If the SNP254 of the pine tree to be tested is C and the SNP443 is T, then the parent tree of the pine tree to be tested is Pinus tabuliformis; otherwise, the parent tree of the pine tree to be tested is not Pinus tabuliformis. Its parent tree can be Pinus bungeana, Pinus armandii, Pinus sylvestris, Pinus tabuliformis, Pinus koraiensis, Pinus koraiensis, Pinus koraiensis, or Pinus densiflora.
[0129] If the SNP318 of the pine tree to be tested is C, then its parent tree is white pine. If the SNP318 of the pine tree to be tested is not A, then its parent tree is not white pine. Its parent tree can be Chinese pine, Scots pine, red pine, oil pine, Korean pine, Xinjiang five-needle pine or North American pine.
[0130] If the SNP443 of the pine tree being tested is G, then its parent tree is either Pinus tabuliformis or Pinus sylvestris; if the SNP443 of the pine tree being tested is T, then its parent tree is not Pinus tabuliformis or Pinus sylvestris. Its parent tree can be Pinus tabuliformis, Pinus bungeana, Pinus koraiensis, Pinus pumilus, Pinus armandii, or Pinus densiflora.
[0131] If the SNP521 of the pine tree being tested is T, then its parent tree is Korean pine; if the SNP521 is G, then its parent tree is not Korean pine. Therefore, its parent tree could be white pine, Chinese pine, Scots pine, red pine, oil pine, Xinjiang five-needle pine, or North American pine.
[0132] If the SNP590 of the pine tree being tested is C, then its parent tree is either Chinese pine or Xinjiang five-needle pine. If the SNP590 is A, then its parent tree is not Chinese pine or Xinjiang five-needle pine. Its parent tree could be white pine, Scots pine, red pine, oil pine, Korean pine, or North American pine.
[0133] If the SNP40 of the pine tree being tested is C, and the SNP590 of the pine tree being tested is C, then the parent tree of the pine tree being tested is Xinjiang five-needle pine; otherwise, the parent tree of the pine tree being tested is not Xinjiang five-needle pine. Its parent tree could be Scots pine, red pine, oil pine, Korean pine, Chinese pine, white pine, or North American pine.
[0134] As shown above, SNP40 can distinguish between Chinese pine; SNP81 can distinguish between North American pine; SNP318 can distinguish between white pine; SNP443 can distinguish between Scots pine and red pine / others; SNP521 can distinguish between Korean pine; SNP40 and SNP590 can distinguish between Xinjiang five-needle pine; SNP254 and SNP443 can distinguish between Chinese pine.
[0135] Using the above-described PCR reaction system, PCR conditions, and rps4-F / rps4-R primers, DNA from the following species were amplified and sequenced: *Pinus densiflora*, *Pinus sylvestris*, *Pinus tabuliformis*, *Pinus bungeana*, *Pinus koraiensis*, *Pinus armandii*, *Pinus strobus*, and *Pinus sibirica*. The results are shown below:
[0136] The amplified sequence of *Pinus tabuliformis* is sequence 2, as follows:
[0137] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTCCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAAGAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAATACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGG AACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA
[0138] The amplified sequence of Pinus sylvestris is sequence 3, as follows:
[0139] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTCCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAAGAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAATACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA
[0140] The amplified sequence of *Pinus tabuliformis* is sequence 4, as follows:
[0141] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTCCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA
[0142] The amplified sequence of *Pinus bungeana* is sequence 5, as follows:
[0143] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATCATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGATAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAACAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA
[0144] The amplified sequence of Pinus armandii is sequence 6, as follows:
[0145] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCTCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCATATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCTAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAACAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGACAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA
[0146] The amplified sequence of the red pine tree is sequence 7, as follows:
[0147] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGATAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA
[0148] The amplified sequence of Xinjiang five-needle pine is sequence 8, as follows:
[0149] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAACAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGACAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA
[0150] The amplified sequence of North American pine is sequence 9, as follows:
[0151] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATATTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGAC GTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATGAAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGATAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA
[0152] Table 1 Summary of Mitochondrial Markers
[0153]
[0154] Example 2: Validation of mitochondrial marker primers
[0155] Genomic DNA was extracted from the needles of several pine species, including *Pinus densiflora*, *Pinus sylvestris*, *Pinus tabuliformis*, *Pinus bungeana*, *Pinus koraiensis*, *Pinus armandii*, *Pinus strobus*, and *Pinus sibirica*. The extracted DNA concentration was adjusted to 30 ng / ml to obtain DNA solutions from *Pinus densiflora*, *Pinus sylvestris*, *Pinus tabuliformis*, *Pinus bungeana*, *Pinus koraiensis*, *Pinus armandii*, and *Pinus sibirica*.
[0156] Using rps4-F / rps4-R (upstream primer F / downstream primer R) as primers in Table 1, and genomic DNA solutions from northern pine species (Pinus tabuliformis, Pinus sylvestris, Pinus tabuliformis, Pinus bungeana, Pinus koraiensis, Pinus armandii, Pinus densiflora, and Pinus sylvestris var. chinensis) as templates, PCR was performed under the following conditions: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 45 s; annealing at the optimal temperature for 45 s; extension at 72℃ for 1 min; 35 cycles; and a final extension of 10 min. The reaction system is as follows:
[0157] Genomic DNA (30 ng / ml) 3 μL, upstream primer F (30 ng / ml) 2 μL, downstream primer R (30 ng / ml) 2 μL, 2×Master Mix 25 μL, ddH2O 18 μL.
[0158] The results are as follows Figure 1 As shown, RPS4 can distinguish all tree species except for Pinus tabuliformis and Pinus sylvestris. It can be used for pine species identification and identification of maternal or parent plants of hybrid offspring in the future.
[0159] Example 3: Validation of mitochondrial marker primers (validation of hybrid varieties)
[0160] Hybridization Verification 1
[0161] Genomic DNA was extracted from the needles of 30 hybrid pine trees (male Pinus tabuliformis × female Pinus bungeana) obtained by artificial controlled pollination (emasculation, bagging, and pollination). The extracted DNA concentration was adjusted to 30 ng / ml to obtain genomic DNA solutions from 30 hybrid pine trees.
[0162] Using mitochondrial rps4 (rps4-F / rps4-R) as primers and genomic DNA solutions from 30 hybrid pine trees as templates, PCR was performed under the following conditions: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 45 s; annealing at the optimal temperature (as shown in Table 3) for 45 s; extension at 72℃ for 1 min; 35 cycles; and a final extension at 72℃ for 10 min. The reaction system (50 μL) is as follows:
[0163] Pine DNA (30 ng / ml) 3 μL, upstream primer F (30 ng / ml) 2 μL, downstream primer R (30 ng / ml) 2 μL, 2×Mix enzyme (Novizan P222-03-AA) 25 μL, ddH2O 18 μL, total 50 μL. The gel extraction and sequencing results are as follows:
[0164] The amplification sequences of the rps4-F / rps4-R primer pairs are identical to sequence 5 above, as follows:
[0165] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATCATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGATAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAACAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA
[0166] The results showed that, in the sequence comparison of 30 hybrid pine trees with northern pine trees, the pine trees with SNP318 C had white pine as their parent, which was consistent with the actual situation.
[0167] Hybridization Verification 2
[0168] Genomic DNA was extracted from the needles of 30 hybrid pine trees (Pinus sylvestris var. mongolica × Pinus koraiensis var. chinensis) obtained by artificial controlled pollination (emasculation, bagging, and pollination). The extracted DNA concentration was adjusted to 30 ng / ml to obtain genomic DNA solutions from 30 hybrid pine trees.
[0169] Using mitochondrial rps4 (rps4-F / rps4-R) as primers and genomic DNA solutions from 30 hybrid pine trees as templates, PCR was performed under the following conditions: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 45 s; annealing at the optimal temperature (as shown in Table 3) for 45 s; extension at 72℃ for 1 min; 35 cycles; and a final extension at 72℃ for 10 min. The reaction system (50 μL) is as follows:
[0170] Pine DNA (30 ng / ml) 3 μL, upstream primer F (30 ng / ml) 2 μL, downstream primer R (30 ng / ml) 2 μL, 2×Mix enzyme (Novizan P222-03-AA) 25 μL, ddH2O 18 μL, total 50 μL. The gel extraction and sequencing results are as follows:
[0171] The amplification sequences of the rps4-F / rps4-R primer pairs are identical to sequence 7 above, as follows:
[0172] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGATAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA
[0173] The results showed that among the 30 hybrid pine trees compared with northern pine trees, the hybrid pine tree with SNP521 being T, and its parent tree being Korean pine, which is consistent with the actual situation.
[0174] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The application of substances detecting the SNP40, SNP81, SNP318, SNP443, SNP521 and / or SNP590 genotypes in pine mitochondria in the identification of pine parent trees or in the preparation of products for identifying pine parent trees; characterized in that: The molecular marker is shown in SEQ ID NO: 1; The SNP40 is located at the 40th nucleotide of SEQ ID NO: 1, and it is either C or T; if the SNP40 is T, then the pine parent tree to be tested is from Pinus armandii. The SNP81 is located at the 81st nucleotide of SEQ ID NO: 1, and it is either A or C; if the SNP81 of the pine tree to be tested is A, the parent tree of the pine tree to be tested is a North American pine. The SNP254 is the 254th nucleotide in SEQ ID NO: 1, and it is either C or T. SNP318 is the 318th nucleotide of SEQ ID NO: 1, and it is either A or C; if the SNP318 of the pine tree to be tested is C, the parent tree of the pine tree to be tested comes from Pinus bungeana. The SNP443 is located at the 443rd nucleotide of SEQ ID NO: 1, and it is either G or T; if the SNP443 of the pine tree to be tested is G, then the parent tree of the pine tree to be tested comes from pine tree A, and the pine tree A group is composed of Pinus sylvestris and Pinus tabuliformis; if the SNP254 of the pine tree to be tested is C and the SNP443 is T, then the parent tree of the pine tree to be tested comes from Pinus tabuliformis. The SNP521 is located at the 521st nucleotide of SEQ ID NO: 1, and it is either G or T; if the SNP521 of the pine tree to be tested is T, the parent tree of the pine tree to be tested is Korean pine. The SNP590 is located at the 590th nucleotide of SEQ ID NO: 1, and it is either A or C; if the SNP40 of the pine tree to be tested is C and the SNP590 is C, then the parent tree of the pine tree to be tested comes from Xinjiang five-needle pine.
2. The application according to claim 1, wherein the application is any one of the following: 1) Application of substances that detect the SNP40 genotype in the preparation of products for identifying whether the parent pine of the test pine tree comes from Pinus armandii; 2) Application of the substance for detecting the SNP81 genotype in the preparation of products for identifying whether the parent pine of the test pine tree is from North American pine trees; 3) Application of substances that detect the SNP318 genotype in the preparation of products for identifying whether the parent pine of the test pine tree comes from Pinus bungeana; 4) Application of substances that detect the SNP521 genotype in the preparation of products for identifying whether the parent pine of the test pine tree comes from Korean pine; 5) Application of substances for detecting the SNP40 and SNP590 genotypes in the preparation of products for identifying whether the parent pine of the test pine tree comes from Xinjiang five-needle pine; 6) Application of substances for detecting the SNP254 and SNP443 genotypes in the preparation of products for identifying whether the parent pine of the test pine tree comes from Pinus tabuliformis; 7) The application of the substance for detecting the SNP443 genotype in the preparation of a product to identify whether the pine parent tree to be tested is derived from pine A, wherein pine A consists of Scots pine and red pine.
3. The application according to claim 1 or 2, characterized in that: The substance is described as follows: D1), D2), D3), or D4): D1) Contains in vitro nucleic acid amplification primers that specifically amplify the molecular markers described in claim 1; D2) An in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primers described in D1); D3) A kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2); D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2), or the kit described in D3); The in vitro nucleic acid amplification primers include amplification primer pair d; the primer pair d consists of primers dF and dR; The primer dF is a single-stranded nucleotide molecule with the nucleotide sequence SEQ ID NO: 10; the primer dR is a single-stranded nucleotide molecule with the nucleotide sequence SEQ ID NO:
11.
4. A method for identifying the parent pine tree to be tested, wherein the method is derived from any of the following: M1) A method for identifying or assisting in identifying whether the parent pine tree to be tested is from Pinus armandii, including detecting the genotype of SNP40 as described in claim 1 in the mitochondria of the parent pine tree to be tested, and determining whether the parent pine tree to be tested is from Pinus armandii based on the detection results; If the SNP40 of the pine tree to be tested is T, the parent tree of the pine tree to be tested is from Pinus armandii; If the SNP40 of the pine tree to be tested is C, then the parent tree of the pine tree to be tested does not come from Pinus armandii. M2) A method for identifying or assisting in the identification of whether the parent pine of the test pine comes from North American pine, including detecting the genotype of SNP81 as described in claim 1 in the mitochondria of the test pine, and determining whether the parent pine of the test pine comes from North American pine based on the detection results; If the SNP81 of the pine tree to be tested is A, the parent tree of the pine tree to be tested is a North American pine. If the SNP81 of the pine tree to be tested is C, then the parent tree of the pine tree to be tested does not come from North American pine trees; M3) A method for identifying or assisting in identifying whether the parent pine tree to be tested is derived from Pinus bungeana, including detecting the genotype of SNP318 as described in claim 1 in the mitochondria of the parent pine tree to be tested, and determining whether the parent pine tree to be tested is derived from Pinus bungeana based on the detection results; If the SNP318 of the pine tree to be tested is C, the parent tree of the pine tree to be tested comes from white pine; If the SNP318 of the pine tree to be tested is A, then the parent tree of the pine tree to be tested does not come from the white pine. M4) A method for identifying or assisting in identifying whether the parent pine of the test pine tree comes from Korean pine, including detecting the genotype of SNP521 as described in claim 1 in the mitochondria of the test pine tree, and determining whether the parent pine tree of the test pine tree comes from Korean pine based on the detection results; If the SNP521 of the pine tree to be tested is T, the parent tree of the pine tree to be tested comes from Korean pine; if the SNP521 of the pine tree to be tested is G, the parent tree of the pine tree to be tested does not come from Korean pine. M5) A method for identifying or assisting in identifying whether the parent pine tree to be tested is from Xinjiang five-needle pine, including detecting the genotypes of SNP40 and SNP590 as described in claim 1 in the mitochondria of the parent pine tree to be tested, and determining whether the parent pine tree to be tested is from Xinjiang five-needle pine based on the detection results; If the SNP40 of the pine tree to be tested is C and the SNP590 is C, then the parent tree of the pine tree to be tested comes from Xinjiang five-needle pine; otherwise, the parent tree of the pine tree to be tested does not come from Xinjiang five-needle pine. M6) A method for identifying or assisting in identifying whether the parent pine tree to be tested is from Pinus tabuliformis, including detecting the genotypes of SNP254 and SNP443 as described in claim 1 in the mitochondria of the parent pine tree to be tested, and determining whether the parent pine tree to be tested is from Pinus tabuliformis based on the detection results; If the SNP254 of the pine tree to be tested is C and the SNP443 is T, then the parent tree of the pine tree to be tested comes from Pinus tabuliformis; otherwise, the parent tree of the pine tree to be tested does not come from Pinus tabuliformis. M7) A method for identifying or assisting in identifying whether the pine parent tree to be tested comes from pine tree A, including detecting the genotype of SNP443 as described in claim 1 in the mitochondria of the pine parent tree to be tested, and determining whether the pine parent tree to be tested comes from pine tree A based on the detection results; If the SNP443 of the pine tree to be tested is G, then the parent tree of the pine tree to be tested comes from pine tree A; otherwise, the parent tree of the pine tree to be tested does not come from pine tree A; the pine tree A group consists of Scots pine and red pine.
Citation Information
Patent Citations
SNP molecular marker for identifying aquilaria sinensis, aquilaria yunnanensis and aquilaria malaccensis and application of marker
CN109486978A
Method for rapidly identifying pinus tabulaeformis population through mitochondrial labeling
CN115198027A