Duplex PCR (polymerase chain reaction) primer group for detecting nosema bombycis and beauveria bassiana and application

Abstract

The invention discloses a duplex PCR primer group for detecting nosema bombycis and beauveria bassiana. The duplex PCR primer group comprises an upstream primer and a downstream primer which are used for detecting nosema bombycis, and an upstream primer and a downstream primer which are used for detecting beauveria bassiana, wherein the nucleotide sequences of the upstream primer and the downstream primer for detecting the nosema bombycis are respectively as shown in SEQ ID No. 1 and SEQ ID No. 2; the nucleotide sequences of the upstream primer and the downstream primer for detecting the beauveria bassiana are respectively shown as SEQ ID No. 3 and SEQ ID No. 4. The invention further provides application, a kit and a detection method. According to the present invention, the requirements of simultaneous diagnosis and monitoring of the nosema bombycis and the beauveria bassiana can be met, and characteristics of strong specificity, high sensitivity, wide detection range, high detection efficiency and rapid and simple operation are provided.

Description

Technical Field

[0001] The present invention relates to the technical field related to Nosema bombycis and Beauveria bassiana, and more specifically, to a dual PCR primer set for detecting Nosema bombycis and Beauveria bassiana and its use. Background Art

[0002] Bombyx mori nematode disease is a disease caused by Nosema bombycis ( Nosema bombycis, Nb ) is a chronic infectious silkworm disease caused by infection with the bacteria. It has the characteristics of a long incubation period and a wide range of transmission. Bombyx mori microsporidia can be transmitted through embryos and oral ingestion. The pathogen can infect the oocytes of silkworms, causing the offspring silkworm eggs to be congenitally infected, resulting in vertical transmission of the disease. The breeding environment is contaminated by pathogens and is easily cross-infected with wild insects, making it difficult to eliminate the microsporidia in the silkworm area. After the disease occurs, the silkworms produce less silk or even no silk. Severe cases die during the silkworm stage, while mild cases can survive to the moth stage, but lay poisonous silkworm eggs, which seriously affects the supply of silkworm seeds and the quality of cocoons and silk, bringing great harm to the silkworm industry and causing a devastating blow to silkworm seed production. The disease has been listed as a Class II infectious disease and parasitic disease in the "List of Quarantine Diseases of Animals Entering the People's Republic of China", and is the only statutory quarantine object for silkworm seed production. It has also been listed as a Class III animal disease in the "Animal Epidemic Prevention Law of the People's Republic of China". The prevention and control of this disease has always been the focus of research at home and abroad. Since the current mulberry silkworm production mainly adopts the small-scale family unit of individual farming and breeding mode, the degree of intensification and standardization is low, resulting in the occurrence of silkworm microparticle disease in production. At present, the inspection and quarantine of silkworm seeds mainly rely on the mother moth microscopic examination method. However, this method is time-consuming and labor-intensive, and has deficiencies in timeliness, sensitivity and specificity. The ground samples have many impurities and are easily confused with fungal spores in the mother moth samples. It depends on the experience and judgment of the inspectors, and may cause misdetection and missed detection. In addition, this method can only use the intermediate product mother moth as the inspection object, and there are problems such as false positives caused by other fungi, which are still the limitations of this diagnostic technology.

[0003] at present, NbThe detection methods include: morphological examination including microscopic examination of mother moth and special staining; molecular biological detection including conventional PCR, fluorescence quantitative PCR and loop-mediated isothermal amplification (LAMP); immunological detection including indirect ELISA, double antibody sandwich ELISA, immunochromatographic test strips, carbon agglutination method, nanogold colorimetry and mass spectrometry technology; PCR-ELISA detection method; nucleic acid lateral chromatography test strips, etc. Among them, the microscopic examination of mother moth is time-consuming and labor-intensive, and has shortcomings in timeliness, sensitivity and specificity. Fluorescence quantitative PCR detection has high sensitivity, but requires expensive real-time fluorescence quantitative PCR instrument, which has application limitations. Although the detection method based on LAMP technology has the advantages of high sensitivity and no need for large-scale biological equipment, its primer design is relatively complex, and due to the large amount of primers added, primer dimers and false positives are prone to occur, which requires high professionalism of the detection personnel and the detection environment. The double antibody sandwich ELISA detection method has the possibility of cross-reaction. The immunofluorescence detection method can specifically detect Bombyx mori microsporidia at different developmental stages in in vitro cultured cell lines, but the immunofluorescence method has problems such as no signal, high background, and nonspecific staining, and requires a fluorescence microscope to observe Bombyx mori microsporidia, and the instrument is expensive and has great limitations. The sensitivity or color development of various test strips needs to be further optimized, and the grinding liquid needs to be subjected to differential centrifugation before it can be used for detection, which has high requirements for reagents and centrifuges. Nanogold colorimetry requires extraction Nb Total protein is time-consuming and cumbersome. The acquisition of samples in the early stage of mass spectrometry technology requires professionals and takes a long time. The PCR-ELISA detection method requires an enzyme marker to collect signals, which has high requirements for equipment. In view of the serious harm of silkworm microparticle disease to the sericulture industry and the huge economic losses to cocoon production, it is urgent to establish a rapid and highly sensitive detection method.

[0004] Silkworm rigor mortis is a common infectious disease caused by pathogenic fungi that penetrate the silkworm's body through the skin. It is prone to outbreaks in all ages. The pathogens are diverse, and the spores are often spread by wind or directly contact the silkworm's body to cause infection and disease, especially in humid areas and rainy seasons. The pathogens of silkworm rigor mortis in Guangxi include Beauveria bassiana, Aspergillus, Paecilomyces and Cordyceps. Among them, Beauveria bassiana ( Beauveria bassiana, Bb ) is the main pathogen of white muscardine disease, accounting for 86.67%. Beauveria bassiana is the earliest discovered insect pathogenic fungus, and in fungal taxonomy, it belongs to the phylum Ascomycota ( Ascomycota ) Sordariomycetes )Hypocreales Hypocreales )Cordyceps Cordycipitaceae ) Beauveria Beauveria). After Beauveria bassiana enters the host, the hyphae multiply by directly absorbing the nutrients of the host's body fluids. In the late stage of infection, it directly destroys the host insect's tissues and organs as nutrients, and produces toxic secondary metabolites such as beauvericin, causing the host insect to die due to physiological metabolic disorders. The mortality rate of Beauveria bassiana to silkworms is still very high within 60 days of its presence in the body of the diseased silkworm, which can cause secondary infection of Beauveria bassiana. Beauveria bassiana can cause white muscardine disease in economic insects such as silkworms, causing significant economic losses to the sericulture industry and other economic insect industries, seriously affecting the stable development of the sericulture industry. It is listed as a Class II infectious disease in the "List of Quarantine Diseases of Animals Entering the People's Republic of China" and is also listed as a Class III animal disease in the "Animal Epidemic Prevention Law of the People's Republic of China".

[0005] at present, Bb The detection methods are as follows: Traditionally, the diagnosis of spores is mainly based on the morphological identification of the disease symptoms by naked eyes and combined with microscopic examination of fungal spores under a microscope. However, it is difficult to identify pathogens with similar symptoms and small morphological differences between species from a morphological perspective, and it is impossible to make timely predictions on the occurrence of the disease.

[0006] Therefore, it is necessary to design a technical solution that can overcome the above-mentioned defects. Summary of the invention

[0007] An object of the present invention is to provide a dual PCR primer set for detecting bombyx mori microsporidia and Beauveria bassiana and its use, which can meet the needs of simultaneous diagnosis and monitoring of bombyx mori microsporidia and Beauveria bassiana, and has strong specificity, high sensitivity, low instrument requirements and quick and easy operation.

[0008] In order to achieve these objects and other advantages of the present invention, according to a first aspect of the present invention, the present invention provides a dual PCR primer set for detecting Bombyx mori Nosema and Beauveria bassiana, comprising an upstream primer and a downstream primer for detecting Bombyx mori Nosema, and an upstream primer and a downstream primer for detecting Beauveria bassiana; wherein the nucleotide sequences of the upstream primer and the downstream primer for detecting Bombyx mori Nosema are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively; and the nucleotide sequences of the upstream primer and the downstream primer for detecting Beauveria bassiana are shown as SEQ ID No. 3 and SEQ ID No. 4, respectively.

[0009] Furthermore, it is used to detect Nosema bombyx mori and / or Beauveria bassiana.

[0010] According to the second aspect of the present invention, the present invention provides a kit for detecting Nosema bombyx mori and Beauveria bassiana, comprising the dual PCR primer set.

[0011] Furthermore, it also includes Taq DNA polymerase, MgCl2, nano PCR buffer, and ddH2O.

[0012] Furthermore, it also includes MgCl2, rapid PCR premix, and ddH2O.

[0013] According to the third aspect of the present invention, the present invention provides a method for detecting Bombyx mori microsporidia and Beauveria bassiana, characterized in that it comprises: S1: extracting DNA of a sample to be tested; S2: performing dual PCR amplification or dual nano-PCR amplification using the dual PCR primer set described in claim 1; S3: analyzing the PCR reaction products using agarose gel electrophoresis.

[0014] Furthermore, the conditions for the double PCR amplification included: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, for a total of 35 cycles, and extension at 72°C for 5 min.

[0015] Furthermore, the conditions for the dual nano-PCR amplification included: denaturation at 95°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min, for 30 cycles.

[0016] The present invention has at least the following beneficial effects: 1. High specificity. The present invention has strong specificity against Nosema bombyx mori ( Nb ) and Beauveria bassiana ( Bb ), but it was negative for the common silkworm pathogens, such as Bombyx mori cytoplasmic polyhedrosis virus (BmCPV), Bombyx mori nuclear polyhedrosis virus (BmNPV), and septicemia septicaemia (SM), and it was also negative for the DNA amplification of healthy silkworms.

[0017] 2. High sensitivity. The PCR primer set of the present invention for detecting Nosema bombycis and Beauveria bassiana has a minimum dilution of 10 for the nano-PCR detection of Nosema bombycis. -8 The minimum plasmid copy number is 2.53×10 2 copies / μL, while the minimum dilution for conventional PCR detection is 10 -7 The minimum plasmid copy number is 2.53×10 3 copies / μL; the minimum dilution for Beauveria bassiana nano-PCR detection is 10 -8 The minimum plasmid copy number is 2.90×10 2 copies / μL, while the minimum dilution for conventional PCR detection is 10 -7 The minimum plasmid copy number is 2.90×10 3The minimum detection line of the present invention for Nosema bombyx mori and Beauveria bassiana is 10 times that of conventional PCR technology. If the degree of infection cannot be determined and the pathogen DNA content of the test samples is unequal or low, the test samples can be initially tested using dual PCR, and then the samples with negative test results can be retested using nano dual PCR, which can reduce the missed detection rate and save costs.

[0018] 3. Wide detection range. Compared with the common PCR using universal primers for Bombyx mori microsporidia, the amplification range is wider. It can not only amplify the target genes of Bombyx mori microsporidia with large mutations, but also effectively amplify the target genes of other insect microsporidia. It can realize the cross-infection detection of microsporidia of silkworms and wild insects, and understand the types of infected microsporidia through subsequent sequencing analysis, providing a scientific basis for the precise prevention and control of Bombyx mori microsporidia.

[0019] 4. Save time and effort. At present, the detection of Bombyx mori and Beauveria bassiana is a single pathogen detection. To detect two pathogens, two PCR amplifications are required, which is time-consuming, labor-intensive and has high detection costs. The detection method established by the present invention can quickly and efficiently identify and diagnose the two pathogens, Bombyx mori and Beauveria bassiana, which is more economical and simple to operate, and provides technical support for the unified monitoring and prevention and control of the two silkworm diseases.

[0020] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Primer screening - primer amplification, A: each pair of primers is used for PCR amplification separately, B: primers are combined in pairs to form 10 sets of primer combinations for double PCR amplification; Figure 2 It is the primer screening - the sensitivity of the primers for Nosema bombyx mori, A: Primer Nb.L1, B: Primer Nb.L2, C: Primer Nb.C1, D: Primer Nb.C2, E: Primer Nb.C3; Figure 3 Primer screening - sensitivity of Beauveria bassiana primers, A: primer Bb.L1, B: primer Bb.L2; Figure 4 It is the construction of positive plasmids pMD-Nb and pMD-Bb; Figure 5 It is a dual PCR detection method - verification of recombinant positive plasmid; Figure 6It is the optimization of the dual PCR detection method - annealing temperature, number of cycles, and primer dosage. A: annealing temperature, B: number of cycles, C: primer dosage; Figure 7 It is a dual PCR detection method - specificity and sensitivity test of silkworm pathogens and other insect microsporidia, A: silkworm pathogen specificity, B: other insect microsporidia specificity, C: sensitivity; Figure 8 It is the double nano-PCR detection method - verification of recombinant plasmid; Fig. 9 It is the optimization of the dual nano-PCR detection method - Taq DNA polymerase, 25mM MgCl2 dosage, annealing temperature, and number of cycles, A Taq DNA polymerase, B 25mM MgCl2, C annealing temperature, D number of cycles; Fig.10 It is a dual nano-PCR detection method - optimization of primer dosage. A: Set the primer dosage: 1-10 pmol for each upstream and downstream primer, and increase by 1 pmol in sequence. B: Set the Bb.L1-F and Bb.L1-R primer dosage to 4 pmol, and the Nb.C1-F and Nb.C1-R primer dosage to 2-10 pmol, and increase by 2 pmol in sequence. C: Set the Nb.C1-F and Nb.C1-R primer dosage to 8 pmol, and the Bb.L1-F and Bb.L1-R primer dosage to 2 pmol, 4 pmol and 6 pmol respectively. Fig.11 It is a dual nano-PCR detection method - specificity and sensitivity test of silkworm pathogens and other insect microsporidia, A: silkworm pathogen specificity, B: other insect microsporidia specificity, C: sensitivity; Fig.12 These are clinical sample tests, A: Dual PCR clinical sample test-1, B: Dual nano-PCR clinical sample test-1, C: Dual PCR clinical sample test-2, D: Dual nano-PCR clinical sample test-2. DETAILED DESCRIPTION

[0022] The present invention is further described in detail below in conjunction with embodiments so that those skilled in the art can implement the invention with reference to the description.

[0023] It should be understood that the terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0024] The embodiments of the present application provide a dual PCR primer set for detecting Bombyx mori microsporidia and Beauveria bassiana, including an upstream primer and a downstream primer for detecting Bombyx mori microsporidia, and an upstream primer and a downstream primer for detecting Beauveria bassiana; wherein the nucleotide sequences of the upstream primer and the downstream primer for detecting Bombyx mori microsporidia are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively; the nucleotide sequences of the upstream primer and the downstream primer for detecting Beauveria bassiana are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively; specifically, SEQ ID No. 1 is 5'-TAACAAGACTATGACGGATAACG-3'; SEQ ID No. 2 is 5'-CACTACATCTGTCTAAATGAGGG -3'; SEQID No. 3 is 5'-TTCTGTGAACCTACCTATCGTT-3'; SEQ ID No. 4 is 5'-GATTCACTGGATTCTGCAATTC-3'.

[0025] The embodiments of the present application also provide the use of a dual PCR primer set for detecting Nosema bombyx mori and / or Beauveria bassiana.

[0026] The embodiments of the present application also provide a kit for detecting Nosema bombyx mori and Beauveria bassiana, comprising the dual PCR primer set.

[0027] In another embodiment, the kit further includes Taq DNA polymerase, MgCl2, nano PCR buffer, ddH2O; that is, dual nano PCR is used, specifically including: 2×Nano-QPCR buffer 6 μL, Taq DNA polymerase 0.6 μL, 25mMMgCl2 0.6 μL, Bombyx mori microsporidia specific primers Nb.C1-F (10 pmo1 / L), Nb.C1-R (10 pmo1 / L) 0.8 μL each and Beauveria bassiana specific primers Bb.L1-F (10 pmo1 / L), Bb.L1-R (10 wmo1 / L) 0.6 μL each, 1 μL of DNA template to be detected, and ddH2O supplemented to 12 μL; In another embodiment, MgCl2, rapid PCR premix, and ddH2O are also included; that is, conventional PCR is used, specifically including: 2 × Rapid Taq Master Mix 6 μL, Bombyx mori Nosema-specific primers Nb.C1-F (10 pmo1 / L), Nb.C1-R (10 pmo1 / L) and Beauveria bassiana-specific primers Bb.L1-F (10 pmo1 / L), Bb.L1-R (10 pmo1 / L), 0.4 μL each, 1 μL of the DNA template to be detected, and ddH2O is added to 12 μL.

[0028] The embodiments of the present application provide a method for detecting Nosema bombyx mori and Beauveria bassiana, comprising: S1: Extract DNA from the sample to be tested; S2: performing dual PCR amplification or dual nano-PCR amplification using the dual PCR primer set; S3: PCR products were analyzed by agarose gel electrophoresis; the target fragments of 733 bp and 230 bp corresponded to Nosema bombyx mori and Beauveria bassiana, respectively.

[0029] In another embodiment, the conditions for duplex PCR amplification include: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 15 s, for a total of 35 cycles, and 72°C extension for 5 min.

[0030] In another embodiment, the conditions for dual nano-PCR amplification include: denaturation at 95° C. for 10 s, annealing at 60° C. for 30 s, and extension at 72° C. for 1 min, for 30 cycles.

[0031] The following is a description of a specific implementation method.

[0032] The SSU rRNA sequence of Bombyx mori and the ITS sequence of Beauveria bassiana are highly conserved, so the SSU rRNA sequence of Bombyx mori and the ITS sequence of Beauveria bassiana were selected to design primers. According to the complete open reading frame sequence of the gene, the primer combination and reaction system were designed, synthesized, screened, and optimized to prepare the corresponding nano-PCR detection kit. The specific research experimental steps are as follows: 1. Material preparation Bombyx mori microsporidia, Beauveria bassiana, Bombyx mori nuclear polyhedrosis virus, Bombyx mori cytoplasmic polyhedrosis virus, and Bacillus vesiculosus; DNA extraction kit, 2 × Rapid Taq Master Mix, DL2000 DNA Marker, plasmid extraction kit, nano-PCR kit (containing: 2 × Nano-QPCR buffer, 25mM MgCl2), agarose gel purification and recovery kit, Taq DNA polymerase, pMD18-T, genetically engineered bacteria Escherichia coli DH5α, ampicillin, and Bioweste agarose.

[0033] 2. Primer design The SSU rRNA sequences of Nosema bombycis (accession numbers OR597059.1 and JF443688.1) and the ITS sequences of Beauveria bassiana (accession numbers OR578513.1 and OR558353.1) were downloaded from NCBI, and the primers were designed as follows; (1) 5 groups Nb Primers: 1. Nb.L1-F GGTAATACTTGTTCCGATAGTGTG (SEQ ID No. 5) Nb.L1-RTTATGATCCTGCTAATGGTTCTCC (SEQ ID No. 6) 2. Nb.L2-F GACTATGACGGATAACGGTATTACT (SEQ ID No. 7) Nb.L2-R GAACAGGGACTCATTCAATTCTACT (SEQ ID No. 8) 3. Nb.C1-F TAACAAGACTATGACGGATAACG (SEQ ID No. 1) Nb.C1-R CACTACATCTGTCTAAATGAGGG (SEQ ID No. 2) 4. Nb.C2-F AATGAGTCCCTGTTCTTTGT (SEQ ID No. 9) Nb.C2-R GTATCTGGATAAGAGAAGTATGTTG (SEQ ID No. 10) 5. Nb.C3-F GGTTGATTCTGCCTGACG (SEQ ID No. 11) Nb.C3-RATTATACCATGTTATACCTGGTAAA (SEQ ID No. 12) (2) 2 groups Bb Primers: 1. Bb.L1-F TTCTGTGAACCTACCTATCGTT (SEQ ID No. 3) Bb.L1-R GATTCACTGGATTCTGCAATTC (SEQ ID No. 4) 2. Bb.L2-F ACTCTTGTATTCCAGCATCTTC (SEQ ID No. 13) Bb.L2-R CTGTATTACTACGCAGAGGTCG (SEQ ID No. 14) Primer screening results: First, PCR amplification was performed for each primer pair of Bombyx mori and Beauveria bassiana. According to the agarose gel bands after electrophoresis, all seven primer pairs were able to amplify clear and bright specific bands and the target fragment size was consistent with expectations. The amplified products were sequenced and sequence alignment confirmed that they were Nb SSU rRNA gene and Bb The target fragment of ITS gene indicates that the primer design is successful. Figure 1 -A.

[0034] Then, double PCR amplification was attempted. The primers of Nosema bombycis and Beauveria bassiana were combined in pairs to form 10 primer combinations for double PCR amplification. According to the agarose gel bands after electrophoresis, all 10 primer combinations were able to amplify clear and bright specific bands, and the size of the target fragment was consistent with expectations, as shown in Figure 2. Figure 1 -B.

[0035] Finally, the sensitivity tests were performed separately for the seven primer pairs. The concentrations of the DNA templates of Nosema bombycis and Beauveria bassiana were 44.8 ng / μL and 56 ng / μL, respectively. The DNA standards of Nosema bombycis and Beauveria bassiana were diluted 10 μg / μL with nuclease-free water using the gradient dilution method. -1 ~10 -10 Ten-fold dilutions were performed for PCR amplification. According to the agarose gel bands after electrophoresis, the sensitivity of primers Nb.L1 and Nb.C3 was 4.48 × 10 -4 ng / μL, among which Nb.C3 has the problem of mixed bands, see Figure 2 -A, E; the sensitivity of primers Nb.L2 and Nb.C2 were both 4.48 × 10 -5 ng / μL, and there were obvious primer dimers. Figure 2 -B, D; while the sensitivity of Nb.C1 is 4.48 ×10-6 ng / μL, see Figure 2 -C. In addition, the sensitivity of primers Bb.L1 and Bb.L2 were 5.6 × 10 -7 ng / μL and 5.6 × 10 -6 ng / μL, see Figure 3 -A, B.

[0036] After the 7 pairs of primers were combined in pairs for double PCR amplification, they were able to amplify the corresponding target fragments, indicating that the amplification efficiency and primer matching between the 7 pairs of primers were good; since the final selected primers were used for detection, the final screening of primer combinations was performed by primer sensitivity. In summary, the Bombyx mori specific primer Nb.C1 and the Beauveria bassiana specific primer Bb.L1 were selected as the final primer combinations for optimizing double and double nano-PCR.

[0037] 3. Construction of positive plasmid DNA of Nosema bombycis and Beauveria bassiana were extracted respectively, and the DNA concentration was determined by spectrophotometer. PCR amplification of Nosema bombycis and Beauveria bassiana DNA was performed using primers Nb.C1 for Nosema bombycis and primers Bb.L1 for Beauveria bassiana to obtain the corresponding target fragments; the recovered target fragments were connected to the pMD-18T vector and transformed into DH5α Escherichia coli competent cells, and white positive colonies were screened by plating. The clones identified as positive by colony PCR were selected for culture and plasmid extraction, and the positive plasmids pMD-Nb and pMD-Bb were constructed, and the accuracy of the templates was verified by sequencing, see Figure 4 .

[0038] 4. Dual PCR detection method 1) Identification of recombinant positive plasmids Double PCR amplification was performed using the recombinant positive plasmids pMD-Nb and pMD-Bb as templates. Double PCR reaction system 12μL: 2 × Rapid Taq Master Mix 6 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 10 μmol / L each, pMD-Nb and pMD-Bb 1 μL each, ddH2O to 12 μL. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 52℃ annealing for 15 s, 72℃ extension for 15 s, a total of 35 cycles; 72℃ extension for 5 min. Detection by 1.2% agarose gel electrophoresis showed that the target fragments of 733 bp and 230 bp could be obtained, respectively, which were consistent with the expected size, see Figure 5 .

[0039] 2) Optimization of annealing temperature The recombinant positive plasmids pMD-Nb and pMD-Bb were used as templates, and the annealing temperatures were set at 50℃, 51℃, 52℃, 54℃, 55℃, 56℃, 58℃, 60℃, 62℃ and 64℃ for optimization. Duplex PCR reaction system 12 μL: 2 × RapidTaq Master Mix 6 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 10 μmol / L each, pMD-Nb and pMD-Bb 1 μL each, ddH2O supplemented to 12 μL. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, set temperature gradient annealing for 15 s, 72℃ extension for 15 s, a total of 35 cycles; 72℃ extension for 5 min. The results of 1.2% agarose gel electrophoresis showed that at 60°C, the target bands amplified by pMD-Nb and pMD-Bb were brighter, and 60°C was the optimal annealing temperature. Figure 6 -A.

[0040] 3) Optimize the number of cycles The recombinant positive plasmids pMD-Nb and pMD-Bb were used as templates, and the number of cycles was set to 20 cycles, 25 cycles, 30 cycles, 35 cycles and 40 cycles for optimization. Duplex PCR reaction system 12 μL: 2 × Rapid Taq Master Mix 6 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 10 μmol / L each, pMD-Nb and pMD-Bb 1 μL each, ddH2O to 12 μL. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, set the number of cycles; 72℃ extension for 5 min. The results of 1.2% agarose gel electrophoresis showed that the target bands amplified by pMD-Nb and pMD-Bb were brighter when the number of cycles was 35 cycles, and 35 cycles was the optimal number of cycles. Figure 6 -B.

[0041] 4) Optimization of primer dosage The recombinant positive plasmids pMD-Nb and pMD-Bb were used as templates, and the primer dosage was set to 1pmol, 2pmol, 3pmol, 4pmol, 5pmol, 6pmol, 7pmol, 8pmol, 9pmol and 10pmol for each upstream and downstream primer for optimization. The double PCR reaction system was 12μL: 2× Rapid Taq Master Mix 6μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R were set with primer dosages, pMD-Nb and pMD-Bb were 1μL each, and ddH2O was added to 12μL. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, for a total of 35 cycles; 72℃ extension for 5 min. The results of 1.2% agarose gel electrophoresis showed that when the primer dosage was 4 pmol each for the upstream and downstream primers, the target bands amplified by pMD-Nb and pMD-Bb were brighter. The optimal primer dosage was 4 pmol each for Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R. Figure 6 -C.

[0042] 5) Specificity test To verify the specificity of the double PCR detection method for silkworm pathogens, the optimized PCR conditions were used, and the DNA samples of Nosema bombyx mori, Beauveria bassiana, Bombyx mori nuclear polyhedrosis virus, Bombyx mori cytoplasmic polyhedrosis virus, Bacillus septicemia and healthy silkworms stored in the laboratory were used as templates, and nuclease-free water was used as a blank control for PCR amplification. The double PCR reaction system was 12 μL: 2 × Rapid Taq Master Mix 6 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 4 μmol / L each, each DNA sample 2 μL, ddH2O supplemented to 12 μL. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, a total of 35 cycles; 72℃ extension for 5 min. The results of 1.2% agarose gel electrophoresis showed that the target fragments of 733 bp and 230 bp were amplified for Nosema bombyx mori and Beauveria bassiana, respectively, while no amplified bands were found for B. mori nuclear polyhedrosis virus, B. mori cytoplasmic polyhedrosis virus, B. brevisus, healthy silkworm DNA and blank control, indicating that the detection method has good specificity. Figure 7 -A.

[0043] Secondly, to verify the specificity of the dual PCR detection method for other insect microsporidia, the optimized PCR conditions were used, and 10 positive DNA samples of other insect microsporidia that were sequenced and stored in the laboratory were used as templates, and nuclease-free water was used as a blank control for PCR amplification. Dual PCR reaction system 12 μL: 2 × Rapid Taq MasterMix 6 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 4 μmol / L, each DNA sample 2 μL, ddH2O to 12 μL. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, a total of 35 cycles; 72℃ extension for 5 min. The results of 1.2% agarose gel electrophoresis showed that dual PCR could amplify bands for 6 of the other insect microsporidia, but 5 of the bands were shallow and there was a risk of missed detection. It made a preliminary diagnosis of the pathogens that caused the cross-infection of silkworms and played a certain role in predictive detection. Figure 7 -B.

[0044] 6) Sensitivity test The concentrations of the recombinant plasmids pMD-Nb and pMD-Bb were determined by spectrophotometry to be 95 ng / μL and 93 ng / μL, respectively. After conversion to the number of copies, the plasmid concentrations were 2.53×10 10 copies / μL and 2.90×10 10 copies / μL. Each recombinant plasmid was diluted tenfold with nuclease-free water, and the plasmid DNA of each dilution was used as a template for dual PCR sensitivity detection. Dual PCR reaction system 12 μL: 2 × Rapid TaqMaster Mix 6 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 4 μmol / L each, pMD-Nb and pMD-Bb 1 μL each, ddH2O supplemented to 12 μL. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, a total of 35 cycles; 72℃ extension for 5 min. Detected by 1.2% agarose gel electrophoresis, the observation results showed that the minimum copy numbers of pMD-Nb and pMD-Bb were 2.53×10 3 copies / μL and 2.90×10 3 copies / μL, see Figure 7 -C.

[0045] 5. Dual Nano-PCR Detection Method 1) Verification of recombinant plasmid Dual nano-PCR amplification was performed using the recombinant positive plasmids pMD-Nb and pMD-Bb as templates. Dual nano-PCR reaction system 12 μL: 2 × Nano-QPCR buffer 6 μL, Taq DNA polymerase 0.5 μL, 25mM MgCl2 0.5 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 0.4 μL each, pMD-Nb and pMD-Bb 4 μmol / L each, ddH2O to 12 μL. Reaction conditions: 95℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 30 cycles. Detection by 1.2% agarose gel electrophoresis showed that the target fragments of 733 bp and 230 bp could be obtained, respectively, which were consistent with the expected size, see Figure 8 .

[0046] 2) Optimization of Taq DNA polymerase dosage Using the recombinant positive plasmids pMD-Nb and pMD-Bb as templates, the amount of Taq DNA polymerase was set to 0.2 μL, 0.4 μL, 0.6 μL, 0.8 μL and 1 μL for optimization. Dual nano-PCR reaction system 12 μL: 2 × Nano-QPCRbuffer 6 μL, Taq DNA polymerase set amount, 25mM MgCl20.5 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 4 μmol / L each, pMD-Nb and pMD-Bb 1 μL each, ddH2O supplemented to 12 μL. Reaction conditions: 95℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, a total of 30 cycles. The results of 1.2% agarose gel electrophoresis showed that when the dosage of Taq DNA polymerase was 0.6 μL, the target bands amplified by pMD-Nb and pMD-Bb were brighter, and 0.6 μL was the optimal dosage of Taq DNA polymerase. Fig. 9 -A.

[0047] 3) Optimization of 25mM MgCl2 dosage Using the recombinant positive plasmids pMD-Nb and pMD-Bb as templates, the dosage of 25mM MgCl2 was set to 0.2 μL, 0.4 μL, 0.6 μL, 0.8 μL, 1 μL, 1.2 μL, 1.4 μL, 1.6 μL and 1.8 μL for optimization. Dual nano-PCR reaction system 12 μL: 2 × Nano-QPCR buffer 6 μL, Taq DNA polymerase 0.6 μL, 25mM MgCl2 set dosage, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 4 μmol / L each, pMD-Nb and pMD-Bb 1 μL each, ddH2O supplemented to 12 μL. Reaction conditions: 95℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, a total of 30 cycles. The results of 1.2% agarose gel electrophoresis showed that when the dosage of 25mM MgCl2 was 0.6 μL, the target bands amplified by pMD-Nb and pMD-Bb were brighter, and 0.6 μL was the optimal dosage of 25mM MgCl2. Fig. 9 -B.

[0048] 4) Annealing temperature optimization The recombinant positive plasmids pMD-Nb and pMD-Bb were used as templates, and the annealing temperatures were set at 50℃, 51℃, 52℃, 54℃, 55℃, 56℃, 58℃, 60℃, 62℃ and 64℃ for optimization. The double nano-PCR reaction system was 12 μL: 2×Nano-QPCR buffer 6 μL, Taq DNA polymerase 0.6 μL, 25mM MgCl2 0.6 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 4 μmol / L each, pMD-Nb and pMD-Bb 1 μL each, and ddH2O was added to 12 μL. Reaction conditions: 95℃ denaturation for 10 s, set temperature gradient annealing for 30 s, 72℃ extension for 1 min, and a total of 30 cycles. The results of 1.2% agarose gel electrophoresis showed that at 60°C, the target bands amplified by pMD-Nb and pMD-Bb were brighter, and 60°C was the optimal annealing temperature. Fig. 9 -C.

[0049] 5) Optimize the number of cycles Using the recombinant positive plasmids pMD-Nb and pMD-Bb as templates, the number of cycles was set to 20 cycles, 25 cycles, 30 cycles, 35 cycles and 40 cycles for optimization. Dual nano-PCR reaction system 12 μL: 2× Nano-QPCR buffer 6 μL, Taq DNA polymerase 0.6 μL, 25mM MgCl2 0.6 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 4 μmol / L each, pMD-Nb and pMD-Bb 1 μL each, ddH2O supplemented to 12 μL. Reaction conditions: 95℃ denaturation 10 s, 60℃ annealing 30 s, 72℃ extension 1 min, set the number of cycles. The results of 1.2% agarose gel electrophoresis showed that the target bands amplified by pMD-Nb and pMD-Bb were brighter and had no diffusion when the cycle number was 30 cycles. 30 cycles was the optimal cycle number. Fig. 9 -D.

[0050] 6) Optimization of primer dosage Dual nano-PCR reaction system 12 μL: 2 × Nano-QPCR buffer 6 μL, Taq DNA polymerase 0.6 μL, 25mM MgCl2 0.6 μL, primers Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R, 1 μL each of pMD-Nb and pMD-Bb, ddH2O to 12 μL. Reaction conditions: 95℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles in total.

[0051] ① Using the recombinant positive plasmids pMD-Nb and pMD-Bb as templates, the primer dosage was set to 1 pmol, 2 pmol, 3 pmol, 4 pmol, 5 pmol, 6 pmol, 7 pmol, 8 pmol, 9 pmol and 10 pmol of the upstream and downstream primers for primer dosage optimization. The results of 1.2% agarose gel electrophoresis showed that when the primer dosage was 4 pmol of the upstream and downstream primers, the target bands amplified by pMD-Nb and pMD-Bb were brighter, as shown in Figure 2. Fig.10 -A.

[0052] ② In order to improve the amplification efficiency of dual nano-PCR, the dosage of dual nano-primers was carefully optimized. Using the recombinant positive plasmids pMD-Nb and pMD-Bb as templates, the dosage of Bb.L1-F and Bb.L1-R primers was set to 4 pmol, and the dosage of Nb.C1-F and Nb.C1-R primers was set to 2 pmol, 4 pmol, 6 pmol, 8 pmol and 10 pmol respectively for primer dosage optimization. Detection by 1.2% agarose gel electrophoresis showed that when the dosage of Bb.L1-F and Bb.L1-R primers was kept at 4 pmol, the target band of the pMD-Nb PCR amplification product was the brightest when the dosage of Nb.C1-F and Nb.C1-R primers was 8 pmol, as shown in Figure 2. Fig.10 -B.

[0053] ③Using the recombinant positive plasmids pMD-Nb and pMD-Bb as templates, the primer dosage of Nb.C1-F and Nb.C1-R was set to 8 pmol, and the primer dosage of Bb.L1-F and Bb.L1-R was set to 2 pmol, 4 pmol and 6 pmol respectively for primer dosage optimization. The results of 1.2% agarose gel electrophoresis showed that when the primer dosage of Nb.C1-F and Nb.C1-R was kept at 8 pmol, the target band of the pMD-Bb PCR amplification product was the brightest when the primer dosage of Bb.L1-F and Bb.L1-R was 6 pmol, as shown in Figure 3. Fig.10 -C.

[0054] In summary, 8 pmol of Nb.C1-F and Nb.C1-R, and 6 pmol of Bb.L1-F and Bb.L1-R in the duplex nano-PCR reaction system were the optimal primer amounts.

[0055] 7) Specificity test To verify the specificity of the dual nano-PCR detection method for silkworm pathogens, the optimized nano-PCR conditions were used, and the DNA samples of Nosema bombyx mori, Beauveria bassiana, Bombyx mori nuclear polyhedrosis virus, Bombyx mori cytoplasmic polyhedrosis virus, Bombyx mori septicemia and healthy silkworms stored in the laboratory were used as templates, and nuclease-free water was used as a blank control for PCR amplification. Dual nano-PCR reaction system 12 μL: 2 × Nano-QPCR buffer 6 μL, Taq DNA polymerase 0.6 μL, 25mM MgCl2 0.6 μL, Nb.C1-F and Nb.C1-R 8 μmol / L each, Bb.L1-F and Bb.L1-R 6 μmol / L each, each DNA sample 2 μL, ddH2O supplemented to 12 μL. Reaction conditions: 95℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, a total of 30 cycles. The results of 1.2% agarose gel electrophoresis showed that the target fragments of 733 bp and 230 bp were amplified for Nosema bombyx mori and Beauveria bassiana, respectively, while no amplified bands were found for B. mori nuclear polyhedrosis virus, B. mori cytoplasmic polyhedrosis virus, B. brevisus, healthy silkworm DNA and blank control, indicating that the detection method has good specificity. Fig.11 -A.

[0056] Secondly, to verify the specificity of the dual nano-PCR detection method for other insect microsporidia, the optimized nano-PCR conditions were used to sequence 10 copies of other insect microsporidia preserved in the laboratory, including Nosema longitudinally colored moth ( Nosema fumiferanae ), Nosema xylostella ( Nosema plutellae ), Microsporidium sp.Oise , Deformed Microsporidia ( Vairimorpha imperfecta ), Microsporidia armigera ( Nosema heliothidis ), Nosema litura ( Nosema spodopterae ), Vairimorpha sp. , Nosema orientalis Vairimorpha ceranae ), Nosema anastomosporida ( Nosema antheraeae ), Nose mylittaDNA samples were used as templates, and nuclease-free water was used as a blank control for PCR amplification. Dual nano-PCR reaction system 12 μL: 2× Nano-QPCR buffer 6 μL, Taq DNA polymerase 0.6 μL, 25mM MgCl2 0.6 μL, Nb.C1-F and Nb.C1-R 8 μmol / L, Bb.L1-F and Bb.L1-R 6 μmol / L, each DNA sample 2 μL, ddH2O supplemented to 12 μL. Reaction conditions: 95℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, a total of 30 cycles. Detected by 1.2% agarose gel electrophoresis, the observation results showed that dual nano-PCR can amplify all 10 other insect microsporidia bands, and they are clear and bright. This shows that the double nano-PCR has a wider amplification range than the double PCR, and can conduct more extensive predictive detection of other insect microsporidial pathogens, make preliminary diagnosis of pathogens that cause cross-infection in silkworms, and can prevent and control the spread of silkworm microsporidia early and accurately. In addition, the double nano-PCR has higher amplification efficiency than the double PCR, and the bands are clear and bright, which can effectively reduce the chance of missed detection. Fig.11 -B.

[0057] 8) Sensitivity test Each recombinant plasmid was diluted 10 times with nuclease-free water, and the plasmid DNA of each dilution was used as a template for dual nano-PCR sensitivity detection. Dual nano-PCR reaction system 12 μL: 2 × Nano-QPCRbuffer 6 μL, Taq DNA polymerase 0.6 μL, 25mM MgCl2 0.6 μL, Nb.C1-F and Nb.C1-R 8 μmol / L each, Bb.L1-F and Bb.L1-R 6 μmol / L each, pMD-Nb and pMD-Bb 1 μL each, ddH2O supplemented to 12 μL. Reaction conditions: 95℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, a total of 30 cycles. Detected by 1.2% agarose gel electrophoresis, the observation results showed that the minimum copy number of pMD-Nb and pMD-Bb was 2.53×10 2 copies / μL and 2.90×10 2 copies / μL, which is 10 times more sensitive than the duplex PCR detection method. Fig.11 -C.

[0058] 6. Clinical sample testing 1) Verify the amplification range of duplex PCR for samples that were positive under microscopic examination but negative for PCR amplification of SSU rDNA gene using universal primers for Nosema bombycis (18f 5'-CACCAGGTTGATTCTGCC-3' and 1537r: 5'-TTATGATCCTGCTAATGGTTC-3', see SEQ ID No. 15 and SEQ ID No. 16, respectively) DNA was extracted from 17 samples, and the extracted DNA was used as a template for dual PCR and dual nano-PCR amplification. Dual PCR reaction system 12 μL: 2 × Rapid Taq Master Mix 6 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 4 μmol / L, pMD-Nb and pMD-Bb 1 μL, ddH2O to 12 μL. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, a total of 35 cycles; 72℃ extension for 5 min. Dual nano-PCR reaction system 12 μL: 2 × Nano-QPCR buffer 6 μL, Taq DNA polymerase 0.6 μL, 25mM MgCl2 0.6 μL, Nb.C1-F and Nb.C1-R 8 μmol / L, Bb.L1-F and Bb.L1-R 6 μmol / L, pMD-Nb and pMD-Bb 1 μL, ddH2O to 12 μL. Reaction conditions: 95℃ denaturation 10 s, 60℃ annealing 30 s, 72℃ extension 1 min, 30 cycles in total. Detection by 1.2% agarose gel electrophoresis showed that 6 positive bands could be amplified using the dual PCR detection method. The 6 amplified PCR positive products were sent for testing. The sequencing results showed that 5 of them were other insect microsporidia, which were considered to be cross-infection of microsporidia. Fig.12 -A; 7 positive bands were amplified using the dual nano-PCR detection method, proving that the amplification efficiency and sensitivity of the dual nano-PCR detection method were superior to those of the dual PCR detection method; the 7 amplified PCR positive products were sent for testing, and the sequencing results were analyzed by NCBI blast, showing that 6 of them were other insect microsporidia, including Microsporidia vespermidorus ( Nosema fumiferanae ) ， Nosema plutella xylostella ( Nosema Plutella ), Vairimorpha sp. , Nosema sp. , Microsporidia spp. Vairimorpha imperfecta). Although it is not clear whether cross-infection of silkworms with other insect microsporidia will cause serious pathogenic effects, according to current research reports combined with molecular epidemiological investigation and production conditions, cross-infection with microsporidia is common and may have varying degrees of impact on silkworm production. Fig.12 -B.

[0059] 2) Testing of 108 clinical samples that were negative under microscopic examination DNA was extracted from 108 samples that were negative under the mother moth microscopic examination method, and the extracted DNA was used as a template for dual PCR and dual nano-PCR amplification. Dual PCR reaction system 12 μL: 2 × Rapid TaqMaster Mix 6 μL, Nb.C1-F, Nb.C1-R, Bb.L1-F and Bb.L1-R 4 μmol / L each, pMD-Nb and pMD-Bb 1 μL each, ddH2O to 12 μL. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, a total of 35 cycles; 72℃ extension for 5 min. Dual nano-PCR reaction system 12 μL: 2×Nano-QPCRbuffer 6 μL, Taq DNA polymerase 0.6 μL, 25mM MgCl2 0.6 μL, Nb.C1-F and Nb.C1-R 8 μmol / L, Bb.L1-F and Bb.L1-R 6 μmol / L, pMD-Nb and pMD-Bb 1 μL, ddH2O to 12 μL. Reaction conditions: 95℃ denaturation 10 s, 60℃ annealing 30 s, 72℃ extension 1 min, 30 cycles in total. Detection by 1.2% agarose gel electrophoresis showed that 24 positive bands could be amplified using the dual PCR detection method. In contrast, the missed detection rate of the mother moth microscopic inspection method reached 22.22%. Six PCR positive products were randomly selected for testing, and the sequencing results were Nosema bombyx mori, see Fig.12 -C; The dual nano-PCR detection method can amplify 30 positive bands. In contrast, the missed detection rate of the mother moth microscopic inspection method reached 27.78%. In addition, the bands are clearer and brighter than those of the dual PCR detection method, proving that the amplification efficiency and sensitivity of the dual nano-PCR detection method are better than those of the dual PCR detection method. Fig.12 -D.

[0060] The risk assessment judgment standard of mother moth quarantine is divided into two categories: original species and hybrid silkworm species. Original species require that the corresponding silkworm species detected by mother moths must be eliminated, and the macro-safety control conditions are increased, that is, the diseased moth rate of the seed production batch (28 moths as a group) shall not exceed 0.2%; hybrid species are judged by the secondary sampling inspection method with a misjudgment risk rate of less than 1.5% based on the test that 0.5% of the silkworm eggs produced by infected mother moths mixed with the silkworm eggs produced by healthy mother moths can significantly affect the cocoon yield. As a key technology for the prevention and control of pebrine disease in the silkworm, mother moth inspection has played a very important role in the development of my country's sericulture industry, and its safety of risk assessment has been sufficiently affirmed. In production, the control conditions for original species and seed production batches are relatively strict. The use of double nano-PCR for re-testing negative samples can reduce missed detection and false detection. Under strict control conditions and the need to reduce costs, double PCR can be used to detect negative samples under microscopy, and then double nano-PCR can be used to re-test the double PCR negative samples to minimize missed detection and false detection rates.

[0061] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A dual PCR primer set for detecting Nosema bombyx mori and Beauveria bassiana, characterized in that: The method comprises an upstream primer and a downstream primer for detecting microsporidia of Bombyx mori, and an upstream primer and a downstream primer for detecting Beauveria bassiana; The nucleotide sequences of the upstream primer and the downstream primer for detecting Nosema bombyx mori are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively; The nucleotide sequences of the upstream primer and the downstream primer for detecting Beauveria bassiana are shown as SEQ ID No. 3 and SEQ ID No. 4, respectively.

2. The use of the dual PCR primer set according to claim 1, characterized in that: For detection of Nosema bombyx mori and / or Beauveria bassiana.

3. A kit for detecting Nosema bombyx mori and Beauveria bassiana, characterized in that: The dual PCR primer set according to claim 1 is included.

4. The kit for detecting Nosema bombyx mori and Beauveria bassiana according to claim 3, characterized in that: Also included are Taq DNA polymerase, MgCl2, NanoPCR buffer, and ddH2O.

5. The kit for detecting Nosema bombyx mori and Beauveria bassiana according to claim 3, characterized in that: Also includes MgCl2, fast PCR master mix, and ddH2O.

6. A method for detecting Nosema bombyx mori and Beauveria bassiana, characterized in that: include: S1: Extract DNA from the sample to be tested; S2: performing dual PCR amplification or dual nano-PCR amplification using the dual PCR primer set of claim 1; S3: Analyze the PCR reaction products using agarose gel electrophoresis.

7. The method for detecting Nosema bombyx mori and Beauveria bassiana according to claim 6, characterized in that: The conditions for duplex PCR amplification included: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, for a total of 35 cycles, and extension at 72°C for 5 min.

8. The method for detecting Nosema bombyx mori and Beauveria bassiana according to claim 6, characterized in that: The conditions for duplex nanoPCR amplification included 30 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min.

Images