Identification method of streptococcus thermophilus CICC 6063 strain as well as primer, kit and application thereof

Abstract

The invention relates to the technical field of microbial identification, in particular to an identification method of a streptococcus thermophilus CICC 6063 strain and development and application of a strain level primer of the streptococcus thermophilus CICC 6063 strain. The invention provides an application of a nucleotide sequence as shown in SEQ ID NO: 1 in identification of a streptococcus thermophilus CICC 6063 strain. The invention provides an identification method of a streptococcus thermophilus CICC 6063 strain. The method comprises the following steps: extracting genome DNA of a to-be-detected strain, designing a primer aiming at a nucleotide sequence shown in SEQ ID NO: 1, amplifying the genome DNA, and judging whether the to-be-detected strain is the streptococcus thermophilus CICC 6063 strain or not by comparing the length of an actual amplification product with the length of a target amplification product and the condition of polymorphic site basic groups. The invention provides a simple and rapid method for identifying a streptococcus thermophilus CICC 6063 strain by utilizing a specific conserved gene sequence of streptococcus. The primer pair provided by the invention can be used for rapidly and accurately identifying the CICC 6063 strain on the strain level.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial identification, and in particular to an identification method, detection primers, a detection kit and related applications of a thermophilic Streptococcus CICC 6063 strain. Background Art

[0002] Streptococcus thermophilus is not only a core strain in the field of dairy fermentation, but also has the ability to rapidly acidify and curdle milk, optimize the texture structure of the product, and significantly shorten the curdling cycle, thanks to its efficient growth and fermentation ability in high temperature environments, thus greatly promoting the industrial production efficiency of dairy products. In addition, the strain also exhibits a series of probiotic properties that are beneficial to human health, including the ability to decompose bile salts, hydrophobic properties, and β-galactosidase activity. These properties not only help regulate the balance of intestinal microorganisms, but also effectively reduce the cholesterol level in the blood and enhance the body's immunity, making an important contribution to maintaining and improving human health.

[0003] Streptococcus thermophilus CICC 6063 is usually used in combination with Lactobacillus helveticus CICC 6064, and it has been reported that Streptococcus thermophilus CICC 6063 and Lactobacillus helveticus CICC 6064 have been used to produce naked oat fermented beverages; recent studies have shown that Streptococcus thermophilus CICC 6063 and Lactobacillus helveticus CICC 6064 can be used in the production of fermented milk to produce a special floral and fruity flavor for yogurt, and is a high-quality starter strain with great development potential.

[0004] In the field of microbiology, there may be significant differences in genetic, physiological and metabolic characteristics between different strains. Through strain-level identification, these differences can be revealed, and the diversity and complexity of microorganisms can be further explored. The strains that are most suitable for specific production conditions can be selected, thereby improving production efficiency, reducing costs and enhancing market competitiveness. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a simple and rapid method for identifying the thermophilic Streptococcus CICC 6063 strain and its detection primers, kit and related applications.

[0006] The present invention proposes the use of the nucleotide sequence shown in SEQ ID NO: 1 in identifying the thermophilic Streptococcus CICC 6063 strain.

[0007] Optionally, the 528th base in the nucleotide sequence shown in SEQ ID NO: 1 is a polymorphic site.

[0008] The present invention provides a method for identifying the thermophilic Streptococcus CICC 6063 strain, which at least comprises the following steps: S1. Extract genomic DNA of the strain to be tested; S2. Design primers for the nucleotide sequence shown in SEQ ID NO: 1, wherein the target amplification product of the primers covers the polymorphic site of SEQ ID NO: 1; S3, using primers to amplify the genomic DNA to obtain actual amplification products; S4. If the length of the actual amplification product is inconsistent with that of the target amplification product, the strain to be tested is identified as non-thermophilic Streptococcus CICC 6063; S5. If the length of the actual amplification product is consistent with that of the target amplification product, sequence the actual amplification product and compare it with the nucleotide sequence shown in SEQ ID NO: 1: If the base of the polymorphic site of the actual amplified product is the same as SEQ ID NO: 1, the strain to be tested is identified as Streptococcus thermophilus CICC 6063; If the base of the polymorphic site of the actual amplified product is different from that of SEQ ID NO: 1, the strain to be tested is identified as non-thermophilic Streptococcus CICC 6063.

[0009] Optionally, in S2, the length of the target amplification product is 536 bp.

[0010] Optionally, in S2, the target amplification product of the primers at least covers bases 384 to 919 of SEQ ID NO:1.

[0011] Optionally, the nucleotide sequences of the primers are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0012] The present invention provides a kit for identifying thermophilic Streptococcus CICC 6063, which uses the nucleotide sequence shown in SEQ ID NO:1 to perform strain identification, including using PCR technology and gene sequencing technology to detect polymorphic sites on the nucleotide sequence shown in SEQ ID NO:1.

[0013] Optionally, the nucleic acid amplification reagent contains at least a primer pair with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3.

[0014] The present invention also provides a primer for identifying the thermophilic Streptococcus CICC 6063 strain, wherein the target amplification product of the primer covers the 528th position of the nucleotide sequence shown in SEQ ID NO:1.

[0015] The present invention also provides a detection kit for identifying thermophilic Streptococcus CICC 6063, wherein the kit comprises the specific primers described in the present invention.

[0016] The technical solution provided by the embodiment of the present invention has the following advantages compared with the prior art: The invention utilizes the unique conservative gene sequence of Streptococcus to propose a simple and rapid method for identifying thermophilic Streptococcus CICC 6063 strain.

[0017] In a preferred technical solution, the primers of the present invention have good specificity for the genus Streptococcus and can accurately and quickly identify the CICC 6063 strain at the "strain" level. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the phylogenetic tree constructed from the conserved gene 6063Scaffolds_6_91175_24 and its 58 closely related sequences in the NCBI library; Figure 2 , Figure 3 , Figure 4 The electropherograms are respectively the exclusive amplification verification electrophoresis of the primer pairs shown by SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 on other species other than the genus Streptococcus. Lanes in the figure: M is DNA Marker, positive control is CICC 6063, 1 is CICC 24208, 2 is CICC 6081, 3 is CICC 6103, 4 is CGMCC 1.2625, 5 is CICC 24878, 6 is CICC 6252, 7 is CGMCC 1.3402, 8 is CICC 6117, 9 is CICC 6263, 10 is CICC 6224, 11 is CICC 24209, 12 is CICC 6132, 13 is CICC6240, 14 is CGMCC 1.1881, 15 is JCM 1096, 16 is CICC 6245, 17 is CGMCC 1.1936, 18 is CGMCC1.3992, 19 is CICC 6069, 20 is CICC 6186, 21 is CICC 6070, 22 is CICC 6250, 23 is CICC24210, 24 is CICC 6071, 25 is CICC 6079, 26 is CGMCC 1.2231, 27 is CGMCC 1.2230, 28 is CGMCC1.2138, 29 is CGMCC 1.2503, 30 is CGMCC 1.2696, 31 is CGMCC 1.2695, 32 is CGMCC 1.2009, 33 is JCM 2418, 34 is CICC 6198, 35 is JCM 1185, 36 is CCUG 33636, 37 is CCUG 15605, and CK is blank.

[0019] Figure 5 This is an electrophoresis diagram for verifying the inclusive amplification of the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 among strains within the species of Streptococcus thermophilus; in the figure, lanes: M is a DNA Marker, 1 is CICC 6063, 2 is CICC 6222, 3 is CICC6038, 4 is CICC 6035, 5 is CICC 6059, 6 is CICC 6218, 7 is CICC 6219, 8 is CICC 6220, 9 is CICC22563, 10 is CICC 25079, 11 is CICC 20375, and CK is blank.

[0020] Figure 6 This is an electrophoresis diagram for verifying exclusive amplification of the primer pair shown in SEQ ID NO: 2 and SEQ ID NO: 3 among species within the genus Streptococcus; in the figure, lanes: M is DNA Marker, 1 is CICC 6063, 2 is CICC 10387, 3 is CICC 10465, 4 is CICC 25094, 5 is CICC 25139, and CK is blank.

[0021] Figure 7 The electrophoresis diagram is amplification verification of CICC 6063 strain with different passage numbers using primers shown in SEQ ID NO: 2 and SEQ ID NO: 3. In each lane in the figure: M is DNA Marker, 1 to 10 are passage numbers of CICC 6063, and CK is blank.

[0022] Figure 8 This is a comparison chart of single nucleotide polymorphism sites between the sequence shown in 6063Scaffolds_6_91175_24 and 39 homologous representative sequences of Streptococcus thermophilus. CICC 6063 (first column, CICC 6063) is used as a template. The same site as the template is marked with "·", and the difference is marked with a differential base. DETAILED DESCRIPTION

[0023] In order to more clearly understand the above-mentioned objectives, features and advantages of the present invention, the scheme of the present invention will be further described below. It should be noted that the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

[0024] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein; it is obvious that the embodiments in the specification are only part of the embodiments of the present invention, rather than all of the embodiments.

[0025] The genome sequence information of Streptococcus thermophilus was retrieved from the strain resource library of China Industrial Microbiological Culture Collection Center (CICC) and NCBI GenBank database (https: / / www.ncbi.nlm.nih.gov / datasets / genome / ). A conserved protein-coding nucleotide sequence (as shown in SEQ ID NO:1) and its SNP site information on the CICC 6063 genome were obtained through comparative genomic analysis. The function of this nucleotide sequence is speculated to be the acetylornithine aminotransferase gene (Acetylornithine aminotransferase, arg D). Its homologous sequences were retrieved through the NCBI NT database. No sequences were found outside the genus Streptococcus, and 166 homologous sequences were found within the genus Streptococcus. Among them, 140 sequences were from the genome of Streptococcus thermophilus, and the sequence coverage of the sequences compared with the gene CICC 6063Scaffolds_6_91175_24 was 100%, and the sequence similarity was greater than 98%; the other 26 sequences were from the genomes of Streptococcus salivarius (21 sequences), Streptococcus vestibules (1 sequence) and Streptococcus (4 sequences), which were closely related to Streptococcus thermophilus. The sequence coverage of the sequences was 100%, and the sequence similarity was 87% to 90%. After de-redundancy processing of the 140 sequences from the genome of Streptococcus thermophilus, 33 representative sequences were obtained. The gene was subjected to phylogenetic tree development analysis with the above 33 representative sequences homologous to Streptococcus thermophilus, and the remaining non-Streptococcus thermophilus homologous sequences (26 sequences), a total of 60 nucleotide sequences. The results are detailed in Figure 1 The results showed that the homologous sequence of the nucleotide sequence shown in SEQ ID NO: 1 only exists in the genus Streptococcus, is conserved and ubiquitous in Streptococcus thermophilus, and does not exist in other Streptococci or has relatively low homology, and is a conserved genetic marker unique to Streptococcus thermophilus.

[0026] Experimental verification shows that the nucleotide sequence shown in SEQ ID NO: 1 and its specific SNP site can be used to achieve horizontal identification of Streptococcus thermophilus CICC 6063 strain. Among them, the 528th base on the nucleotide sequence shown in SEQ ID NO: 1 is a polymorphic site.

[0027] The second aspect of the embodiment of the present invention provides a method for identifying the thermophilic Streptococcus CICC 6063 strain, using primers to specifically amplify the target fragment in Streptococcus; on this basis, the identification of whether the target strain is CICC 6063 must meet the specific SNP site discrimination criteria of the primer amplified fragment. Specifically, the following steps are included: S1. Extract genomic DNA of the strain to be tested; S2. Design primers for the nucleotide sequence shown in SEQ ID NO: 1, wherein the target amplification product of the primers covers the polymorphic site at position 528 of SEQ ID NO: 1; S3, using primers to amplify the genomic DNA of the strain to be tested to obtain an actual amplification product; S4. If the length of the actual amplification product is inconsistent with that of the target amplification product, the strain to be tested is identified as non-thermophilic Streptococcus CICC 6063; S5. If the length of the actual amplification product is consistent with that of the target amplification product, sequence the actual amplification product and compare it with the nucleotide sequence shown in SEQ ID NO: 1: If the base of the polymorphic site of the actual amplified product is the same as SEQ ID NO: 1, the strain to be tested is determined to be Streptococcus thermophilus CICC 6063; If the base of the polymorphic site of the actual amplified product is different from that of SEQ ID NO: 1, the strain to be tested is determined to be non-thermophilic Streptococcus CICC 6063.

[0028] The identification method of the embodiment of the present invention overcomes the disadvantage of the existing method that the 16S rDNA sequence homology needs to be analyzed, and fully utilizes the unique conservative nucleotide sequence of Streptococcus thermophilus to establish a simple and rapid identification method that does not require complex instruments and is suitable for large-scale promotion and application.

[0029] As a further preferred technical solution of the embodiment of the present invention, in S2, for the base of the 528th polymorphic site of SEQ ID NO:1, the embodiment of the present invention obtained a pair of primers with the best amplification effect through primer screening, and the nucleotide sequences are shown in SEQ ID NO:2 and SEQ ID NO:3 (see Table 1). The PCR product amplified by the primer pair is 536 bp in length, and the base of the 125th site of the product (excluding the primer sequence) is G (the SNP site is located in a 15 bp nucleotide sequence TTCAAGG G GAATCAG, underlined).

[0030] Table 1: Specific primer information of CICC 6063 Sequence number Sequence (5'-3') length Starting position End position Tm℃ GC% SEQ ID NO:2 gtctgccactggtcaggata 20 384 403 58.8 55 SEQ ID NO:3 cagacaagacctcttgcaatttaac 25 919 895 58.85 40 SEQ ID NO:4 tcggatccatgtctgccact 20 374 393 60.98 55 SEQ ID NO:5 ctgtctctttatcagacaagacctc 25 931 907 58.67 44 SEQ ID NO:6 catccccgtgtcaatcaagc 20 136 155 59.27 55 SEQ ID NO:7 ccaataccagtctgaacttcg 21 635 615 56.37 47.62 The specific primers for identifying CICC 6063 developed based on the gene sequence in the embodiment of the present invention are specific at the thermophilic Streptococcus species level and can obtain a target product of 536 bp. The strain that amplifies the target band using PCR can be identified as thermophilic Streptococcus. Experiments have confirmed that the primer pair has good detection accuracy and can distinguish closely related strains by 100%. Using the NCBI primer tool Primer-BLAST in Bacteria<taxid:2>) The specificity of the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 was verified on the genome, and each primer was allowed to have no more than 4 base mismatches, and the length of the amplified fragment did not exceed 2000 bp. The primer pairs shown in SEQ ID NO:2 and SEQ ID NO:3 only had results on thermophilic Streptococcus in the NCBI database, indicating that the primer pair had good specificity on thermophilic Streptococcus.

[0031] As an improvement of the embodiment of the present invention, the kit includes a nucleic acid amplification reagent, which contains at least a primer pair of the nucleotide sequence shown in SEQ ID NO: 2 and SEQ ID NO: 3. In addition to the primers, it also includes dNTPs, Buffer and DNA polymerase. Specifically, it can be: primer (10 μmol / L) 1 μL×2, 2×PCR Taqmix 25 μL, ddH2O 21 μL.

[0032] The embodiments of the present invention are further described below through specific examples. The experimental reagents used in the following examples are all commercially available, and the strains used are all existing strains preserved in the China Industrial Microbiological Culture Collection Center (CICC).

[0033] Example 1 This example is used to illustrate the primer design and specificity verification process.

[0034] 1) Primer design and simulation verification: Primers were designed using Primer Premier 6 for the nucleotide sequence of gene SEQ ID NO:1, and the primers were comprehensively evaluated by Oligo 7, and finally three pairs of specific primers were screened out, as shown in Table 1. The NCBI primer tool Primer-BLAST was used to search for the specific primers in bacteria. <taxid:2>) Verify the specificity of the primer pairs shown in SEQ ID NO:2 and SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 within the genome, allow each primer to have less than 4 base mismatches, and the length of the amplified fragment shall not exceed 2000 bp, and screen for primers with good specificity on thermophilic Streptococcus. The results show that the specificity of the three primer pairs is good and can be used for subsequent physical verification.

[0035] 2) Physical verification: In order to comprehensively evaluate the specificity of the three pairs of primers on thermophilic Streptococcus, 37 non-Streptococcus type strains in the "List of Bacteria that Can Be Used in Food" were first selected as experimental verification strains for primer exclusivity verification, and the best primer scheme was selected; then 11 thermophilic Streptococcus strains including CICC 6063 were selected as experimental verification strains for primer intraspecies inclusiveness verification; 4 Streptococcus strains of other species in the genus Streptococcus were selected as experimental verification strains for primer intraspecies exclusive verification. After extracting genomic DNA from all 62 experimental verification strains, the primer sets were used for PCR amplification verification, and the strain information is shown in Table 2.

[0036] Table 2 Information of strains used in the validation experiment Serial number Strain number Chinese name Latin name Model strain 1 CICC 6063-1 Streptococcus thermophilus no 2 CICC 6063-2 Streptococcus thermophilus no 3 CICC 6063-3 Streptococcus thermophilus no 4 CICC 6063-4 Streptococcus thermophilus no 5 CICC 6063-5 Streptococcus thermophilus no 6 CICC 6063-6 Streptococcus thermophilus no 7 CICC 6063-7 Streptococcus thermophilus no 8 CICC 6063-8 Streptococcus thermophilus no 9 CICC 6063-9 Streptococcus thermophilus no 10 CICC 6063-10 Streptococcus thermophilus no 11 CICC 6035 Streptococcus thermophilus no 12 CICC 6038 Streptococcus thermophilus no 13 CICC 6059 Streptococcus thermophilus no 14 CICC 6219 Streptococcus thermophilus no 15 CICC 6220 Streptococcus thermophilus no 16 CICC 6222 Streptococcus thermophilus yes 17 CICC 6247 Streptococcus thermophilus no 18 CICC 22563 Streptococcus thermophilus no 19 CICC 25079 Streptococcus thermophilus no 20 CICC 20364 Streptococcus thermophilus no 21 CICC 10387 Streptococcus mutans yes 22 CICC 10465 Streptococcus agalactiae yes 23 CICC 25139 Streptococcus dysgalactiae subsp.equi yes 24 CICC 25094 Streptococcus pyogenes yes 25 <![CDATA[CICC 24208 T ]]> Lactobacillus helveticus yes 26 <![CDATA[CICC 6081 T ]]> Lactobacillus acidophilus yes 27 <![CDATA[CICC 6103 T ]]> Lactobacillus delbrueckii subsp.bulgaricus subsp yes 28 <![CDATA[CGMCC 1.2625 T ]]> Lactobacillus delbrueckii subsp. lactis subsp yes 29 <![CDATA[CICC 24878 T ]]> Lactobacillus gasseri yes 30 <![CDATA[CICC 6252 T ]]> Lactobacillus johnsonii yes 31 <![CDATA[CGMCC 1.3402 T ]]> Lactobacillus kumiss subsp. subsp yes 32 <![CDATA[CICC 6117 T ]]> Lactobacillus casei yes 33 <![CDATA[CICC 6263 T ]]> Lactobacillus paracasei yes 34 <![CDATA[CICC 6224 T ]]> Lactobacillus rhamnosus yes 35 <![CDATA[CICC 24209 T ]]> Lactobacillus mucilaginosus fermentation yes 36 <![CDATA[CICC 6132 T ]]> Lactobacillus reuteri yes 37 <![CDATA[CICC 6240 T ]]> Lactobacillus plantarum yes 38 <![CDATA[CGMCC 1.1881 T ]]> Lactobacillus salivae yes 39 <![CDATA[JCM 1096 T ]]> Lactobacillus curvatum yes 40 <![CDATA[CICC 6245 T ]]> Lactobacillus sakeensis yes 41 <![CDATA[CGMCC 1.1936 T ]]> Lactococcus lactis subsp. lactis subsp yes 42 <![CDATA[CGMCC 1.3992 T ]]> Lactococcus cremoris yes 43 <![CDATA[CICC 6069 T ]]> Bifidobacterium longum subsp. infantis subsp yes 44 <![CDATA[CICC 6186 T ]]> Bifidobacterium longum subsp. longum subsp yes 45 <![CDATA[CICC 6070 T ]]> Bifidobacterium adolescentis yes 46 <![CDATA[CICC 6250 T ]]> Bifidobacterium animalis yes 47 <![CDATA[CICC 24210 T ]]> Bifidobacterium animalis subsp. lactis subsp yes 48 <![CDATA[CICC 6071 T ]]> Bifidobacterium bifidum yes 49 <![CDATA[CICC 6079 T ]]> Bifidobacterium breve yes 50 <![CDATA[CGMCC 1.2231 T ]]> Propionibacterium freudenreichii subsp. subsp yes 51 <![CDATA[CGMCC 1.2230 T ]]> Propionic acid producing bacteria yes 52 <![CDATA[CGMCC 1.2138 T ]]> Leuconostoc mesenteroides subsp. mesenteroides subsp yes 53 <![CDATA[CGMCC 1.2503 T ]]> Leuconostoc pseudomesenteroides yes 54 <![CDATA[CGMCC 1.2696 T ]]> Pediococcus acidilactici yes 55 <![CDATA[CGMCC 1.2695 T ]]> Pediococcus pentosaceus yes 56 <![CDATA[CGMCC 1.2009 T ]]> Weizmannella coagulans yes 57 <![CDATA[JCM 2418 T ]]> Staphylococcus xylosus yes 58 CICC 22948 Bifidobacterium breve yes 59 <![CDATA[CICC 6198 T ]]> Bifidobacterium longum subsp. subsp yes 60 <![CDATA[JCM 1185 T ]]> Lactobacillus crispatus yes 61 <![CDATA[CCUG 33636 T ]]> Veal mammals cocci yes 62 <![CDATA[CCUG 15605 T ]]> Staphylococcus carnosus yes 2) Specific primers amplify the target fragment The PCR reaction system was 50 μL in total volume: 2 μL DNA template, 1 μL primer (10 μmol / L) × 2, 2×PCRTaqmix 25 μL, 21 μL ddH2O; PCR amplification conditions were 95°C for 5 min; 95°C for 30 s, 60°C for 1 min, 72°C for 40 s, 30 cycles; 72°C for 10 min. The amplified product was subjected to gel electrophoresis, and the results are detailed in Figure 2-7 .

[0037] The exclusive results of non-thermophilic streptococci in the "List of Bacteria that can be used in food" are as follows Figure 2 , Figure 3 , Figure 4 As shown in the figure, the primers shown in SEQ ID NO:2 and SEQ ID NO:3 did not show non-specific amplification in the model strain of non-Streptococcus, indicating that the primers have high amplification efficiency and better specificity; the other two pairs of primers showed amplification products of non-target fragments in the model strain of non-Streptococcus, and the specificity was poor. Therefore, the primers shown in SEQ ID NO:2 and SEQ ID NO:3 were selected to conduct specific amplification verification experiments between species within the genus, and the results are shown in Figure 5 and Figure 6 The PCR products of 11 strains of Streptococcus thermophilus were consistent with the target fragment length ( Figure 5 ), and none of the other 4 Streptococcus strains had bands ( Figure 6 ). The above results show that primers SEQ ID NO: 2 and SEQ ID NO: 3 have high amplification efficiency and good specificity in the thermophilic Streptococcus species, and other species other than thermophilic Streptococcus cannot amplify products.

[0038] 3) Sequencing and identification results The 11 PCR amplification products were sequenced to obtain a nucleotide sequence of 536 bp in length. After comparison analysis, the gene difference site information of CICC 6063 strain was obtained (Table 3). The 125th base (excluding the primer sequence) of the amplification product sequence of non-CICC 6063 strains was "A", which was different from the "G" of CICC 6063 strain. The results showed that the SNP site difference based on the discrimination criteria proposed in the present invention is universal in identifying CICC 6063 strains in thermophilic Streptococcus, and can be used for the identification of thermophilic Streptococcus CICC 6063 "strain" level.

[0039] Table 3: Differential sites of amplified fragments between CICC 6063 strain and other thermophilic Streptococci

[0040] Example 2 This example is used to illustrate the general applicability of polymorphic sites in identifying CICC 6063 strains within the thermophilic Streptococcus species.

[0041] In order to fully test whether the identification criteria of CICC 6063 "strain" level within the species S. thermophilus are generally applicable, a total of 182 S. thermophilus genomes from the NCBI database and the CICC resource library were collected as reference genomes for supplementary verification at the genome level.

[0042] Using SEQ ID NO:1 as a template, we retrieved its homologous sequences on 182 genomes, clustered them according to 100% similarity, removed redundancy, and finally obtained 39 homologous groups. The nucleotide sequences of each thermophilic Streptococcus in each homologous group are exactly the same, so a representative sequence was selected from each group and compared with SEQ ID NO:1 to obtain the gene difference site information, as shown in Table 4.

[0043] The results showed that the base at position 528 of CICC 6063 in SEQ ID NO:1 was different from the bases at the same position in the homologous sequences of other thermophilic Streptococcus, and could be used as a unique genetic marker for strain-level identification, and the discrimination criteria were universal for thermophilic Streptococcus species. Therefore, the primers SEQ ID NO:2 and SEQ ID NO:3, whose amplification products covered these two SNP sites, could clearly identify the CICC 6063 strain at the strain level.

[0044] Example 3

[0045] This example is used to illustrate the genetic stability of polymorphic sites in different generations of CICC 6063 strains.

[0046] 1) Sample information and DNA template extraction The strain CICC 6063 was obtained from the CICC strain resource bank and cultured and passaged using M17 medium at 37°C in an aerobic environment; strains of the 1st to 10th generations were obtained, and genomic DNA of the strains was extracted using a DNA crude extraction reagent (Cat. #9182, TARAKA, Beijing).

[0047] 2) Specific primers amplify the target fragment The PCR reaction system was 50 μL in total volume: 2 μL DNA template, 1 μL primer (10 μmol / L) × 2, 2×PCRTaqmix 25 μL, 21 μL ddH2O; PCR amplification conditions were 95°C for 5 min; 95°C for 30 s, 60°C for 1 min, 72°C for 35 s, 35 cycles; 72°C for 10 min. The PCR products were subjected to 1% agarose gel electrophoresis, and the length of the amplified fragments was consistent with the theoretical design length (536 bp). The results are shown in Figure 7 , where 1-10 are CICC 6063-1 to CICC 6063-10 respectively.

[0048] 3) Sequencing and identification results The PCR amplification product was sequenced to obtain a nucleotide sequence of 536 bp in length, and the 125th base of the product (excluding the primer sequence) corresponds to the 528th base of SEQ ID NO: 1. The results showed that the primers amplified fragments of the same length in the 10 samples of 6063, and the nucleotide sequence matched 100%, which was completely consistent with the PCR product sequence predicted by the conserved sequence SEQ ID NO: 1 on the CICC 6063 genome. This shows that the SNP site based on the discrimination criteria proposed in the present invention is genetically stable in the CICC 6063 strain and can be used as an effective reference for the identification of the CICC 6063 strain.

[0049] In summary, the experimental verification results and sequence verification results show that the effective amplification of the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3 can determine that the strain is Streptococcus thermophilus. Combined with the information of the SNP site on the amplification product, the CICC 6063 strain can be effectively identified at the strain level.

[0050] The above description is only a specific embodiment of the present invention, so that those skilled in the art can understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments described herein, but should conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Use of the nucleotide sequence shown in SEQ ID NO: 1 in identifying the thermophilic Streptococcus CICC 6063 strain, characterized in that: The base at position 528 of the nucleotide sequence shown in SEQ ID NO: 1 is a polymorphic site.

2. The use according to claim 1, characterized in that: The base at position 528 at the corresponding position of the nucleotide sequence shown in SEQ ID NO: 1 is G, and the strain to be tested is identified as Streptococcus thermophilus CICC 6063.

3. A method for identifying the thermophilic Streptococcus CICC 6063 strain, characterized in that: At least the following steps are included: S1. Extract genomic DNA of the strain to be tested; S2. Design primers for the nucleotide sequence shown in SEQ ID NO: 1, wherein the target amplification product of the primers covers the 528th polymorphic site of SEQ ID NO: 1; S3, amplifying the genomic DNA using the primers to obtain an actual amplification product; S4. If the length of the actual amplification product is inconsistent with that of the target amplification product, the strain to be tested is identified as non-thermophilic Streptococcus CICC 6063; S5. If the length of the actual amplification product is consistent with that of the target amplification product, the actual amplification product is sequenced and compared with the nucleotide sequence shown in SEQ ID NO: 1: If the actual amplification product corresponds to the nucleotide sequence shown in SEQ ID NO: 1, the base at position 528 is G, and the strain to be tested is identified as Streptococcus thermophilus CICC 6063; If the base at position 528 of the nucleotide sequence corresponding to SEQ ID NO: 1 of the actual amplification product is not G, the strain to be tested is identified as non-thermophilic Streptococcus CICC 6063.

4. The identification method according to claim 3, characterized in that: In S2, the nucleotide sequences of the primers are shown in SEQ ID NO: 2 and SEQ ID NO: 3, and the length of the target amplification product is about 536 bp.

5. A primer for identifying the thermophilic Streptococcus CICC 6063 strain, characterized in that: The target amplification product of the primers covers position 528 of the nucleotide sequence shown in SEQ ID NO:

1.

6. The primer according to claim 5, characterized in that The primers include primers shown in SEQ ID NO:2 and SEQ ID NO:

3.

7. A detection kit for identifying Streptococcus thermophilus CICC 6063, characterized in that: The kit comprises the primers according to claim 5.

Images