Blueberry salt-tolerant gene as well as encoding protein and application thereof

Abstract

The invention discloses a blueberry salt-tolerant gene as well as an encoding protein and application thereof. The invention provides a protein which is as follows (a1) or (a2): (a1) a protein as shown in SEQ ID NO: 2 in a sequence table; (a2) a protein which is obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein shown in SEQ ID NO: 2 in the sequence table, has the same function and is derived from the protein shown in SEQ ID NO: 2; the invention provides a novel blueberry salt-tolerant gene as well as a nucleotide sequence and a corresponding protein amino acid sequence thereof, which can be applied to screening and cultivating blueberry salt-tolerant varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a blueberry salt-tolerance gene, a coded protein and an application thereof. Background Art

[0002] Blueberry (Vaccinium spp.) is a plant of the genus Vaccinium in the family Ericaceae. Its fruit is rich in anthocyanins, flavonoids and other physiologically active ingredients. It has strong antioxidant properties, improves immunity and other health benefits. It has extremely high economic and health value and is one of the leading industries of my country's emerging economic forests. Blueberry is very sensitive to salt stress, and soil salinization leads to limited cultivation and poor plant growth. However, research on the mechanism of blueberry's response to salt stress is still very limited, and mainly focuses on physiological research. The key genes of blueberry tolerance to salt stress and their molecular and genetic mechanisms are rarely reported. Mining blueberry salt-tolerant genes and analyzing their mechanisms of action are the basis for screening and breeding excellent blueberry salt-tolerant varieties. Salt stress is one of the common abiotic stresses in nature, with a wide distribution range and great harm to plant growth. Long-term growth of plants in salinized soils will cause osmotic stress, ion toxicity and oxidative stress and other secondary stresses, which will seriously inhibit their growth and development and even lead to death. In my country, there are 10.0×10 7 hm 2 Nearly 1 / 4 of the existing arable land is salinized to varying degrees, and soil salinization is increasing year by year due to factors such as irrigation dependence and improper use of fertilizers. Therefore, the development of molecular markers related to blueberry salt tolerance and the use of salt-tolerant molecular aided tree species are of great significance to blueberry production.

[0003] Sodium ion (Na + ) is the most abundant soluble cation in saline soil. Under salt stress conditions, plant leaves will accumulate excessive Na + , resulting in K + / Na + The ratio decreases, causing ion poisoning. + The exclusion of K is the key to plant maintenance + / Na + Homeostasis, an important mechanism for coping with salt stress, Na + Ion transporters and their regulators play an important role in this process, but so far, the regulation of Na in blueberry leaves has not been fully explored. + Therefore, it is necessary to identify the genes that regulate Na in blueberry leaves under salt stress. + Content and K + / Na + The ratio of genes is an important task to analyze the salt tolerance mechanism of blueberry. Summary of the invention

[0004] The purpose of the present invention is to provide a blueberry salt-tolerance gene and its encoded protein and application.

[0005] In a first aspect, the present invention provides a protein, which is as follows (a1) or (a2) or (a3) ​​or (a4):

[0006] (a1) the protein shown in SEQ ID NO: 2 in the sequence listing;

[0007] (a2) the protein shown in SEQ ID NO: 2 in the sequence list is subjected to substitution and / or deletion and / or addition of one or more amino acid residues and a protein derived therefrom having the same function;

[0008] (a3) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0009] (a4) A protein derived from blueberry and having 98% or more identity with (a1) and having the same function.

[0010] In a second aspect, the present invention provides a nucleic acid molecule encoding the protein of the first aspect.

[0011] The nucleic acid molecule described above is a DNA molecule of (b1) or (b2) or (b3) or (b4):

[0012] (b1) Coding region such as SEQ ID NO: DNA molecule shown in 1;

[0013] (b3) a DNA molecule that hybridizes with the DNA molecule defined in (b1) or (b2) under stringent conditions and encodes the protein of claim 1;

[0014] (b4) A DNA molecule derived from blueberry and having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule defined in (b1) or (b2) and encoding the protein of claim 1.

[0015] In a third aspect, the present invention provides a recombinant vector, an expression cassette or a recombinant bacterium containing the nucleic acid molecule described in the second aspect.

[0016] In a fourth aspect, the present invention provides the use of the protein described in the first aspect, the nucleic acid molecule described in the second aspect, or the recombinant vector, expression cassette or recombinant bacteria described in the third aspect in regulating plant salt tolerance.

[0017] In a fifth aspect, the present invention provides a method for transporting Na + Application in.

[0018] In a sixth aspect, the present invention provides a method for treating a protein in a first aspect as Na + Application in transporter proteins.

[0019] In a seventh aspect, the present invention provides a method for preparing Na + Application in transporter proteins.

[0020] In an eighth aspect, the present invention provides the use of a substance that reduces the activity or content of the protein described in the first aspect in reducing plant salt tolerance or cultivating salt-sensitive plants.

[0021] In an embodiment of the present invention, the substance that reduces the activity or content of the protein described in the first aspect is specifically a PCR fragment containing an Anti-sense antisense silencing sequence in the embodiment.

[0022] In a ninth aspect, a method for cultivating salt-sensitive plants comprises the following steps: reducing the activity or content of the protein in the first aspect in a target plant to obtain a transgenic plant; the transgenic plant has lower salt tolerance than the target plant.

[0023] The beneficial effects of the present invention are as follows:

[0024] (1) The present invention provides a new blueberry salt-tolerance gene, and its nucleotide sequence and its corresponding protein amino acid sequence, and in the salt-tolerance gene, a nucleotide fragment located in the promoter inserted or deleted and linked to the salt-tolerance of blueberries is identified, and the insertion or deletion of the fragment can be used as a blueberry salt-tolerance molecular marker. The present invention also provides a primer pair and a kit for detecting the blueberry salt-tolerance molecular marker of the present invention, and a method for detecting whether blueberries are salt-tolerance.

[0025] (2) Since blueberry salt tolerance is a quantitative trait, phenotypic analysis is time-consuming and laborious. The above-mentioned blueberry salt tolerance genes and their proteins, molecular markers, primer pairs and kits can be used to screen and cultivate blueberry salt-tolerant varieties. They can be identified during the blueberry seedling stage, which is time-saving and accurate, and can accelerate the breeding process of blueberry salt-tolerant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1The comparison results of 'Duke' and 'Sweetheart' grown under control and salt stress conditions for 5 days; (A) shows the growth status of 'Duke' and 'Sweetheart' plants grown under control and salt stress conditions for 5 days; (B) is an enlarged view of the 7th leaf of each plant in Figure A; the scale is 10 cm.

[0027] Figure 2 Identification and genetic verification of the salt-tolerant gene VcHKT1;1; (A) The transcription level of VcHKT1;1 in the root transcriptome sequencing of 'Duke' and 'Sweetheart' under control and salt treatment conditions; (B) A schematic diagram of the pROK2-VcHKT1;1 vector structure; (C) The transcription level of VcHKT1;1 in transgenic materials after silencing VcHKT1;1 using Agrobacterium rhizogenes technology; (D) The growth of wild-type and VcHKT1;1-silenced transgenic plants (antiVcHKT1;1#1, antiVcHKT1;1#2, antiVcHKT1;1#3, antiVcHKT1;1#4, antiVcHKT1;1#5, antiVcHKT1;1#6) grown for 4 days under control or salt treatment conditions; The scale bar is 5 cm.

[0028] Figure 3 Na in leaves of wild-type and transgenic plants with silenced VcHKT1;1 (denoted as antiVcHKT1;1#1-6 in the figure) under control or salt treatment conditions + Content (A) and Na + / K + Ratio (B) determination.

[0029] Figure 4 Genetic verification of the salt-tolerance gene VcHKT1;1 after complementation in the Arabidopsis athkt1 mutant; (A) Growth of the wild type, athkt1 mutant (marked as athkt1 in the figure), and VcHKT1;1 complemented plants (marked as Com#1, Com#2 in the figure) under control and salt treatment conditions after 6 days of growth; the scale is 5 cm; (BC) Na in the leaves of the wild type, athkt1 mutant, and VcHKT1;1 complemented plants under control or salt treatment conditions + Content (B) and Na + / K + Ratio (B) determination.

[0030] Figure 5 Schematic diagram of the structure of VcHKT1;1 gene.

[0031] Figure 6The figure is the electrophoresis diagram of PCR amplification of the full-length coding sequence of VcHKT1;1 gene; wherein 1 is the PCR product (expected product size 1563bp) obtained by amplifying with cDNA from 'Duke' seedlings as template and VcHKT1;1-specific primers (VcHKT1;1-gene-F and VcHKT1;1-gene-R), and M is the DNA Marker (DL2000Plus) of Tiangen Company.

[0032] Figure 7 This is the vector map after the VcHKT1;1 gene coding sequence is connected to the T vector.

[0033] Figure 8 The protein encoded by VcHKT1;1 is localized in the cell membrane and has Na + Transport activity; (A) is a schematic diagram of the pCAMBIA1300-VcHKT1;1-GFP vector structure; (B) is a schematic diagram of the pGEMHE-VcHKT1;1 vector structure; (C) is the analysis of VcHKT1;1-sGFP subcellular localization in tobacco epidermal cells; (D) is the analysis of Na+ of the VcHKT1;1-encoded protein in Xenopus oocytes + Transport activity. DETAILED DESCRIPTION

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0035] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0036] ‘Duke’ and ‘Sweetheart’ were purchased from Weihai Beiguo Blueberry Technology Co., Ltd.

[0037] Example 1: Cloning and functional analysis of blueberry salt tolerance genes

[0038] 1. Discovery of salt-tolerance genes in blueberries

[0039] Plants of two blueberry cultivars, 'Duke' and 'Sweetheart', grown for 5 days under salt treatment (150 mM NaCl) and normal growth conditions (control).

[0040] The results are as follows Figure 1 As shown, it can be seen that there are significant differences in the salt tolerance of plants under salt treatment conditions, and the salt tolerance of 'Duke' is higher than that of 'Sweetheart'.

[0041] Using 'Duke' and 'Sweetheart' under control and salt treatment conditions as materials, a candidate gene for salt tolerance in blueberry was identified by transcriptome sequencing analysis, named VcHKT1;1. Salt treatment (150mM NaCl) induced a significant upregulation of VcHKT1;1 expression level in 'Duke' (15-fold), while the expression level of VcHKT1;1 in 'Sweetheart' was almost uninduced by salt ( Figure 2 A).

[0042] The nucleotide sequence of the VcHKT1;1 gene is SEQ ID NO:1, the protein encoded by the gene is named VcHKT1;1, and the amino acid sequence of the protein is SEQ ID NO:2.

[0043] II. Obtaining transgenic blueberry with silencing VcHKT1;1

[0044] 1. Acquisition of Silencing Vectors

[0045] In order to obtain the mutant of VcHKT1;1, the inventors designed an Anti-sense silencing sequence and obtained a PCR fragment containing the Anti-sense silencing sequence by PCR amplification, which was used to silence the 870bp-1090bp position of sequence 1.

[0046] The nucleotide sequence of the PCR fragment containing the Anti-sense antisense silencing sequence is SEQ ID NO: 3, which is as follows:

[0047] 5'GCCTCGAACTGACAACTTGAAACAGAGATCCCACAAGTTTCTGGTAAGAATGCAGACCATTCAAAGCCTCTGAATTCCACTCCAAGGAGCAAAACAGTATCAACTGGACCAAAATGAACCCAAAAACAGTGGCTGCCAAACACAAACAATGCATACTTGACAACAAATGACTATACCCCAACTCCCCAAAGTTCTTCAAAAGATAACCAAACTCTTCTCTT 3'.

[0048] The PCR fragment containing the Anti-sense silencing sequence and the pROK2 vector (the vector is recorded in the following literature: Development of an efficient root transgenic system for pigeonpea and its application to other economically important plants; Plant Biotechnology Journal (2019) 17, pp. 1804–1813;) were digested and ligated with XbaI and KpnI to obtain a recombinant vector.

[0049] The above recombinant vector was transformed into Escherichia coli, and colony PCR amplification was performed using universal primers pROK2-F (ATCCTTCGCAAGACCCTTCCTC) / pROK2-R (CGGCAACAGGATTCAATCTTA). The colonies with a target size band of about 300 bp were detected by electrophoresis as positive clones, and the corresponding bacterial liquid was sent to Beijing Ruiboxing Biotechnology Co., Ltd. for sequencing to obtain the correct pROK2-VcHKT1;1 vector ( Figure 2 B).

[0050] 2. Obtain transgenic strains by transfection

[0051] pROK2-VcHKT1;1 was transformed into Agrobacterium MSU440; and then T0 generation transgenic plants were obtained by infecting the root system of 'Duke' variety (hereinafter referred to as wild-type blueberry) seedlings (reference methods are as follows: Yu JQ, Gu KD, Sun CH, Zhang QY, Wang JH, Ma FF, You CX, Hu DG, Hao YJ (2021) The apple bHLH transcription factor MdbHLH3 functions in determining the fruit carbohydrates and malate. Plant Biotechnol J 19: 285-299. Meng D, Yang Q, Dong BY, Song ZH, Niu LL, Wang LT, Cao HY, Li HH, Fu YJ (2019) Development of an efficient root transgenic system for pigeon pea and its application to other important economically plants. Plant Biotechnol J 17: 1804-1813.).

[0052] RNA was extracted from the root tissue of the T0 transgenic plants, and cDNA was obtained by reverse transcription. The expression level of VcHKT1;1 was detected by qRT-PCR technology to determine the transgenic positive plants. 'Duke' was used as the wild-type control.

[0053] The primers for the above qRT-PCR are VcHKT1; 1-RT-F: CATCATTCTTATTTGCATCACCGAGA, VcHKT1; 1-RT-R: TTAAGATAGTTTCCAGGCTCTACCAC; the internal reference gene is VcUBC28, and the internal reference primers are VcUBC28-F: CCATCCACTTCCCTCCAGATTATCCAT, VcUBC28-R: ACAGATTGAGAGCAGCACCTTGGA.

[0054] The results are as follows Figure 2 As shown in C, WT#1 is the wild-type blueberry, and antiVcHKT1;1#1-6 are T0 generation transgenic plants. It can be seen that compared with the wild-type blueberry, the expression level of VcHKT1;1 in antiVcHKT1;1#1-6 is decreased, and the VcHKT1;1 gene is silenced.

[0055] 3. Salt tolerance test

[0056] Salt treatment group: antiVcHKT1;1#1-6 and wild-type 'Duke' (denoted as WT#1 or #2 in the figure) plants identified in 2 above were cultured in nutrient soil for 20 days, 150 mM NaCl was added to the nutrient soil for salt stress treatment for 5 days, and the phenotype was observed.

[0057] Control group: The only difference from the salt-treated group was that 150 mM NaCl was not added.

[0058] The results are as follows Figure 2 As shown in D, it can be seen that under salt treatment conditions, compared with the wild type 'Duke' (denoted as WT#2 in the figure), antiVcHKT1;1#4-6 showed the same salt-sensitive phenotype as 'Sweetheart' under salt stress, and the VcHKT1;1 gene silenced plants were more sensitive to salt stress, showing yellowing leaves. This shows that this gene is indeed involved in the blueberry response to salt stress.

[0059] Leaf Na under salt stress + Content and Na + / K + The ratio was used as a physiological index to further evaluate the salt tolerance of different blueberry materials under the above salt treatment group and the control group. + Content or Na + / K + The higher the ratio, the lower the salt tolerance.

[0060] The determination method refers to the following literature: Zhang, M., Cao, Y., Wang, Z., Wang, ZQ, Shi, J., Liang, X., Song, W., Chen, Q., Lai, J., and Jiang, C. (2018). A retrotransposon in an HKT1family sodium transporter causes variation of leaf Na + exclusion and salt tolerance in maize. New Phytol 217:14882.

[0061] The results are as follows Figure 3 As shown, A is the Na of the blade + Content, B is Na + / K + Compared with the control group, under salt stress, antiVcHKT1;1#4-5 leaf Na + Content and Na + / K + The ratio was significantly higher than that of the wild type, further indicating that VcHKT1;1 is involved in regulating the salt tolerance of blueberry.

[0062] The above results indicate that silencing or inhibiting the expression of the VcHKT1;1 gene can reduce the salt tolerance of plants.

[0063] 4. Backfill Experiment

[0064] The Arabidopsis thaliana athkt1 mutant (Wang Wenying, Functional study of HKT transporter in the succulent xerophyte Zygophyllum, Lanzhou University, 2019, PhD thesis;) is salt-sensitive. The blueberry salt-tolerance gene VcHKT1;1 (SEQ ID NO:1) was introduced into the Arabidopsis thaliana athkt1 mutant by Agrobacterium infection, and the complemented plants com#1 and com#2 were obtained.

[0065] Phenotypic observation and leaf Na+ expression of complemented plants com#1 and com#2, Arabidopsis thaliana athkt1 mutant and wild-type Arabidopsis col-0 under salt stress were performed. + Content and Na + / K + Than detection.

[0066] The results are as follows: The promoter pAtHKT1 of the blueberry salt-tolerance gene VcHKT1;1, which is the homologous gene AtHKT1 in Arabidopsis, drives its expression in the athkt1 mutant, which can restore the athkt1 mutant to the salt-tolerance phenotype of wild-type Arabidopsis ( Figure 4 A) Leaf Na under salt stress + Content and Na + / K + The data further prove the above conclusions. Figure 4 BC).

[0067] 3. VcHKT1;1 as an inward Na + Application in transporter proteins

[0068] 1. Acquisition of VcHKT1;1 exon

[0069] Based on the prediction of the VcHKT1;1 gene structure on the GDV website, the full length of the gene (from the start codon to the stop codon) is 6272 bp, including three exons and two introns, of which the coding region sequence is 1563 bp in length. Figure 5 shown.

[0070] In order to clone the full-length coding sequence of VcHKT1;1, the salt-tolerant blueberry variety 'Duke' grown under salt stress conditions for 5 days was used as the material, and the total RNA was extracted using the plant total RNA extraction kit (Cat.# DP441) of Tiangen Biochemical Technology (Beijing) Co., Ltd., and the cDNA was obtained by reverse transcription using M-MLV reverse transcriptase of Promega (Beijing) Biotechnology Co., Ltd., and PCR amplification was performed with VcHKT1;1-specific primers (forward primer VcHKT1;1-gene-F: ATGGCGAATCTTGTTCGCTTAGCTCA; reverse primer VcHKT1;1-gene-R: TTAAGATAGTTTCCAGGCTCTACCAC) to obtain the PCR amplification product, which is the VcHKT1;1 coding sequence fragment.

[0071] The PCR amplification system is 50 μl, including: 2×Super Multiplex PCR Mix 25 μl; 10 μM Primer VcHKT1; 1-gene-F 2 μl; 10 μM Primer VcHKT1; 1-gene-R 2 μl; DNA 1 μl, ddH2O 20 μl). The PCR amplification conditions are: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, 34 cycles from denaturation to extension, and final extension at 72°C for 5 min.

[0072] The results are as follows Figure 6 As shown, a product consistent with the expected size (1563 bp) was obtained.

[0073] The PCR product was recovered and purified using the Omega gel recovery kit (Cat.#D2500-02), and the purified product was ligated to the T vector using the pEASY-Blunt Cloning Kit from Beijing Quanshijin Biotechnology Co., Ltd. (see vector map for details). Figure 7 ), and we get T Easy+VcHKT1;1.

[0074] The above-mentioned vector T Easy+VcHKT1;1 was transformed into Escherichia coli competent cells, a single clone was picked, and colony PCR amplification was performed using universal primers M13-F / M13-R (M13-F: TGT AAA ACG ACG GCC AGT; M13-R: CAG GAA ACA GCT ATG ACC). The colonies with the target band size detected by electrophoresis were positive recombinants, and the corresponding bacterial liquid was sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing, and a 1563bp VcHKT1;1 exon sequence was obtained. The nucleotide sequence is shown in SEQ ID NO:1, and the corresponding protein sequence is shown in SEQ ID NO:2.

[0075] 2. Acquisition of VcHKT1;1 vector

[0076] Bioinformatics predicts that VcHKT1;1 encodes a Na + Transport protein, by using homologous recombinase (VazymeClonExpress IIOne Step Cloning Kit C112-01) to homologously recombine the VcHKT1;1 fragment obtained in 1 above and the pCAMBIA1300-GFP vector (Song Xiehai. (2021). Research on the mechanism of anthocyanin biosynthesis in autumn leaves of Pistacia chinensis (PhD dissertation, Beijing Forestry University)) at the restriction sites SmaI and XbaI, the recombinant product was transferred into Escherichia coli, and the positive clones with the target band were screened by colony PCR amplification (primers F: CCAACCACGTCTTCAAAGCA; R: CGGTGGTGCAGATGAACTTC; 1500bp is the positive clone). The corresponding bacterial solution was sent to Beijing Ruibo Xingke Biotechnology Co., Ltd., and finally the correct pCAMBIA1300-VcHKT1;1-GFP (map as shown) was obtained. Figure 8 A).

[0077] The recombinant vector pCAMBIA1300-VcHKT1;1-GFP is obtained by replacing the fragment between the SmaI and XbaI restriction sites in the pCAMBIA1300-GFP vector with VcHKT1;1 shown in SEQ ID NO:1.

[0078] 3. VcHKT1;1 positioning detection

[0079] pCAMBIA1300-VcHKT1;1-GFP (denoted as VcHKT1;1-GFP in the figure) was transformed into Agrobacterium GV3101, and a single clone was inoculated into 3 ml YEB liquid medium (containing antibiotics) and cultured overnight at 200 rpm and 28°C in a shaking incubator; the overnight culture was centrifuged at room temperature and 4500 rpm for 5 min to collect the bacteria; the precipitated Agrobacterium cells were resuspended in infiltration medium (10 mmol MgCl2, 10 mmol MES and 100 uM acetosyringone) and the concentration was adjusted to OD 600 to 0.5-1.0; then use a 1mL syringe without a needle to draw the infiltration culture solution containing Agrobacterium and inject it into the back of the tobacco leaf (Nicotiana benthamiana); the injected tobacco continues to grow for 2-3 days; then use a laser confocal microscope to observe the fluorescence expression on the back of the leaf. pCAMBIA1300-GFP is used as a control (represented as 35S-GFP in the figure).

[0080] The results are as follows Figure 8 As shown in C, VcHKT1;1-GFP is localized on the plasma membrane.

[0081] 4. VcHKT1;1 gene encodes inward Na + Transporter

[0082] At the same time, the experimental system in Xenopus oocytes confirmed that VcHKT1;1 has the function of inward transport of Na + The specific experimental process is as follows:

[0083] The VcHKT1 fragment containing SmaI and XbaI restriction sites obtained in 1 and the pGEMHE vector (kindly donated by Professor Jiang Caifu's laboratory at China Agricultural University) were cleaved with SmaI and XbaI. + exclusion and salt tolerance in maize; New Phytol. 2018; 217(3): 1161-1176.) were double-digested, the digested fragments were connected by T4 ligase, the obtained recombinant vector was transferred into Escherichia coli, and the positive clones with the target band were screened by colony PCR amplification; the corresponding bacterial liquid was sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing, and finally the correct pGEMHE-VcHKT1; 1 (map as shown in Figure 8 B);

[0084] pGEMHE-VcHKT1;1 was reverse transcribed by Promega's kit to obtain VcHKT1;1 cRNA; 25nl (0.5μgμl -1 ) VcHKT1; 1 cRNA and an equal volume of H2O were injected into Xenopus oocytes. After 36 hours of culture, voltage clamp was used to record the different Na + The current in Xenopus oocytes under different concentration conditions (method reference Zhang, M., Cao, Y., Wang, Z., Wang, ZQ, Shi, J., Liang, X., Song, W., Chen, Q., Lai, J., and Jiang, C. (2018). Retrotransposon in an HKT1 family sodium transporter causes variation of leafNa + exclusion and salt tolerance in maize. New Phytol 217:14882.).

[0085] The results are as follows Figure 8 As shown in D, obvious currents can be recorded from Xenopus oocytes injected with VcHKT1;1 cRNA. + The recorded reversal potential changes significantly with the change of concentration. The recording voltage used in the experiment is from -140mV to +40mV. + transporter, which may regulate Na + Regulation of salt tolerance in blueberry by long-distance transport from roots to the aboveground parts.

Claims

1. A protein, which is (a1) or (a2) or (a3) ​​or (a4): (a1) the protein shown in SEQ ID NO: 2 in the sequence listing; (a2) the protein shown in SEQ ID NO: 2 in the sequence list is subjected to substitution and / or deletion and / or addition of one or more amino acid residues and a protein derived therefrom having the same function; (a3) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a4) A protein derived from blueberry and having 98% or more identity with (a1) and having the same function.

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is a DNA molecule of (b1) or (b2) or (b3) or (b4): (b1) a DNA molecule whose coding region is shown in SEQ ID NO: 1; (b3) a DNA molecule that hybridizes with the DNA molecule defined in (b1) or (b2) under stringent conditions and encodes the protein of claim 1; (b4) A DNA molecule derived from blueberry and having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule defined in (b1) or (b2) and encoding the protein of claim 1.

4. A recombinant vector, expression cassette or recombinant bacterium containing the nucleic acid molecule according to claim 2 or 3.

5. Use of the protein according to claim 1, the nucleic acid molecule according to claim 2 or 3, or the recombinant vector, expression cassette or recombinant bacterium according to claim 4 in regulating plant salt tolerance.

6. The protein according to claim 1, the nucleic acid molecule according to claim 2 or 3, or the recombinant vector, expression cassette or recombinant bacterium according to claim 4 in transporting Na + Application in.

7. The protein according to claim 1 is used as Na + Application in transporter proteins.

8. The nucleic acid molecule according to claim 2 or 3 or the recombinant vector, expression cassette or recombinant bacteria according to claim 4 is used to prepare Na + Application in transporter proteins.

9. Use of a substance that reduces the activity or content of the protein according to claim 1 in reducing plant salt tolerance or cultivating salt-sensitive plants.

10. A method for cultivating salt-sensitive plants, comprising the following steps: reducing the activity or content of the protein according to claim 1 in a target plant to obtain a transgenic plant; the salt tolerance of the transgenic plant is lower than that of the target plant.

Images