Crude pomelo fruit polysaccharide as well as preparation method and application thereof

Abstract

The invention discloses a pomelo fruit crude polysaccharide, and belongs to the technical field of natural product preparation, the pomelo fruit crude polysaccharide is prepared by taking immature pomelo fruit as a raw material through a water extraction alcohol method, and the pomelo fruit crude polysaccharide is composed of pomelo fruit crude polysaccharide 1 (IPFP-1) with the molecular weight of 9187Da and pomelo fruit crude polysaccharide 2 (IPFP-2) with the molecular weight of more than 100kDa. According to the present invention, the IPFP can alleviate mouse disease symptoms caused by DSS, improve colon histopathologic damage, reduce expression of proinflammatory factors TNF-alpha, IL-1beta and IL-6, and increase expression of anti-inflammatory gene IL-10, and the IPFP can inhibit Erk1 / 2 phosphorylation and regulate the composition of intestinal microorganisms, such that the IPFP can significantly improve the anti-inflammatory activity of the mouse, and can significantly improve the anti-inflammatory activity of the mouse. The IPFP provided by the invention can be used as a potential anti-inflammatory component to be applied to ulcerative colitis drugs, and ulcerative colitis can be improved or treated.

Description

Technical Field

[0001] The invention belongs to the technical field of natural product preparation, and particularly relates to a pomelo fruit crude polysaccharide, a preparation method and application thereof. Background Art

[0002] Pomelo is the fruit of the plant pomelo of the genus Citrus in the Rutaceae family. During its growth, due to plant physiological factors and artificial fruit thinning measures taken to ensure fruit yield and quality, a large number of immature pomelo fruits are produced. According to statistics, immature pomelo fruits account for 40-50% of the total output. In China, these fruits are used as traditional Chinese medicine, with the effects of promoting qi, removing phlegm and relieving pain, and play an important role in maintaining human health, but unfortunately, the utilization rate of pomelo is very low. In recent years, in order to improve the utilization rate of pomelo and increase its economic value, scientific researchers have carried out a series of basic research on its chemical composition and pharmacological effects. Studies have shown that pomelo contains a variety of active ingredients, among which naringin is the main one, which has been proven to have strong antioxidant and anti-inflammatory activities. Hou Tao, et al. used a new continuous phase change technology to extract volatile oil, naringin and pectin components from pomelo fruit in turn. Subsequent studies have confirmed that the new pectin prepared by them has a high immunomodulatory effect. However, there is little research on polysaccharide components other than pectin in pomelo fruit.

[0003] Ulcerative colitis (UC) is a chronic immune-mediated disease characterized by persistent and varying degrees of mucosal inflammation extending from the rectum to the proximal colon. It mainly affects the mucosal layer, resulting in superficial damage to the intestinal wall. Patients often have or do not have mucus-bloody diarrhea, acute rectal symptoms, tenesmus, and varying degrees of abdominal pain, all of which significantly affect the quality of life of patients. Current drug interventions for UC mainly include anti-inflammatory drugs, immunosuppressive drugs, antibiotics, and biologics, but are all associated with certain adverse reactions. Traditional Chinese medicines with medicinal and therapeutic properties are often safer, so they are favored by drug researchers and have become a valuable natural resource library for exploring new treatments for various diseases.

[0004] The pathogenesis of ulcerative colitis is complex and is related to multiple factors, such as genetic factors, diet, excessive immune response, intestinal flora, etc. Regulating the balance of intestinal flora is an effective means of treating UC. At present, there are many polysaccharide components extracted from traditional Chinese medicine or natural plants, which have been proven to reduce inflammation and improve the symptoms of the disease by regulating the abundance of intestinal flora. However, it is not yet public whether grapefruit polysaccharides can be used in ulcerative colitis and improve ulcerative colitis. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an immature pomelo fruit polysaccharide, a preparation method and an application thereof.

[0006] The present invention is based on the close relationship between intestinal flora and polysaccharides, and the key role of microorganisms in maintaining intestinal health. A crude pomelo fruit polysaccharide (IPFP) is prepared from immature pomelo fruit by adopting a water-alcohol extraction method. Then, the pharmacological effect of IPFP on ulcerative colitis is studied by inducing a mouse model with DSS, and its therapeutic mechanism related to intestinal flora is explored, thereby filling the research gap of immature pomelo fruit polysaccharide.

[0007] The first object of the present invention is to provide a pomelo fruit crude polysaccharide, which consists of a pomelo fruit crude polysaccharide-1 with a molecular weight of 9187Da and a pomelo fruit crude polysaccharide-2 with a molecular weight greater than 100kDa, and the monosaccharide composition of the pomelo fruit crude polysaccharide contains galactose, glucose and xylose.

[0008] The second object of the present invention is to provide a method for preparing the above-mentioned pomelo fruit crude polysaccharide, comprising the following steps:

[0009] S1. Slicing unripe pomelo fruit and drying them in the sun to obtain pomelo fruit slices;

[0010] S2, adding water to the pomelo fruit slices obtained in step S1, heating and refluxing for extraction 3 times, combining the extracts, and then concentrating the extracts under reduced pressure to obtain a concentrated solution;

[0011] S3, adding anhydrous ethanol to the concentrated solution obtained in step S2, adjusting the anhydrous ethanol content in the concentrated solution to 40%, 60% and 80% in sequence, and subjecting the polysaccharides in the concentrated solution to graded precipitation. After the graded precipitation is completed, collecting 80% of the alcohol precipitation components, and deproteinizing by the classic sevage method. The filtrate after deproteinization is dialyzed and freeze-dried to obtain pomelo crude polysaccharide.

[0012] Preferably, in step S2, the solid-liquid ratio of each heating reflux extraction is 1:20, the heating temperature is 100° C., and the extraction time is 2 h.

[0013] Preferably, in step S2, the mass ratio of the volume of the concentrated solution to the pomelo fruit slices obtained in step S1 is 2.5 mL:1 g.

[0014] Preferably, in step S2, the temperature of the reduced pressure concentration is 55° C. and the pressure is -0.095 MPa.

[0015] The third object of the present invention is to provide a use of the above-mentioned pomelo fruit crude polysaccharide in the preparation of a medicine for treating ulcerative colitis.

[0016] Preferably, the medicine achieves improvement or treatment of ulcerative colitis through crude citrus fruit polysaccharide.

[0017] Preferably, the pomelo fruit crude polysaccharide improves or treats ulcerative colitis by inhibiting the expression of pro-inflammatory factors TNF-α, IL-1β and IL-6, and promoting the expression of anti-inflammatory gene IL-10.

[0018] Preferably, the pomelo fruit crude polysaccharide improves or treats ulcerative colitis by inhibiting the Erk1 / 2 pathway.

[0019] Preferably, the pomelo fruit crude polysaccharide improves or treats ulcerative colitis by inhibiting the abundance of pathogenic bacteria in the intestine and promoting the abundance of probiotics in the intestine, thereby regulating intestinal microorganisms.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention uses immature pomelo fruit as a raw material and prepares pomelo fruit crude polysaccharide (IPFP) through a water-alcohol extraction method. The polysaccharide consists of pomelo fruit crude polysaccharide-1 (IPFP-1) with a molecular weight of 9187Da and pomelo fruit crude polysaccharide-2 (IPFP-2) with a molecular weight greater than 100kDa, and its monosaccharide composition consists of galactose, glucose and xylose. The IPFP prepared by the present invention can alleviate the disease symptoms of mice caused by DSS, improve colon tissue pathological damage, reduce the expression of pro-inflammatory factors TNF-α, IL-1β and IL-6, and increase the expression of anti-inflammatory gene IL-10. Moreover, IPFP can inhibit Erk1 / 2 phosphorylation and regulate the composition of intestinal microorganisms. Therefore, the IPFP provided by the present invention can be used as a potential anti-inflammatory component in ulcerative colitis drugs to achieve improvement or treatment of ulcerative colitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a molecular weight detection chromatogram of the crude pomelo polysaccharide prepared in an embodiment of the present invention;

[0023] Figure 2 This is a chromatogram showing the monosaccharide composition of the crude pomelo polysaccharide prepared in an embodiment of the present invention;

[0024] Figure 3 This is a graph showing the effect of the crude pomelo polysaccharide prepared in the present invention on reducing DSS-induced ulcerative colitis in mice;

[0025] in, Figure 3 A is the animal experiment design; Figure 3 B is weight change; Figure 3 C is a representative colon picture and the statistical analysis result of colon length of each group of mice; Figure 3 D is a picture of spleen and statistical analysis result of spleen index;

[0026] Figure 4This is a picture of H&E staining of colon;

[0027] Among them, scale bar: 200 μm;

[0028] Figure 5 This is a graph showing that the crude pomelo polysaccharide prepared in an embodiment of the present invention regulates the expression of TNF-α, IL-1β, IL-6 and IL-10 genes;

[0029] Figure 6 This is an expression diagram of the relevant proteins in the ERK pathway regulated by the crude pomelo polysaccharide prepared in the embodiment of the present invention;

[0030] Figure 7 The Venn diagram, OTUs, Chao1 and Shannon index diagram of the crude pomelo polysaccharide prepared in the embodiment of the present invention regulating the intestinal microbiota of DSS-induced colitis mice;

[0031] in, Figure 7 A is a Venn diagram; Figure 7 B is the OTUs index graph; Figure 7 C is the Chao1 index graph; Figure 7 D is the shannon index graph;

[0032] Figure 8 This is a relative abundance diagram of the intestinal microbiota of each group of mice at different classification levels in which the crude pomelo polysaccharide prepared in the embodiment of the present invention regulates the intestinal microbiota of DSS-induced colitis mice;

[0033] Fig. 9 This is a heat map of the bacterial flora at the genus level in which the crude pomelo polysaccharide prepared in an example of the present invention regulates the intestinal microbiota of DSS-induced colitis mice;

[0034] Fig.10 This is a LEfSe analysis chart of the regulation of the intestinal microbiota of DSS-induced colitis mice by the crude pomelo polysaccharide prepared in an example of the present invention. DETAILED DESCRIPTION

[0035] The following is a description of the embodiments of the present invention. Figures 1 to 10 , the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] The reagents used in the embodiments of the present invention are shown in Table 1 below:

[0037] Table 1 Summary of main reagents

[0038]

[0039] Example 1

[0040] The embodiment of the present invention provides a pomelo fruit crude polysaccharide, which is composed of pomelo fruit crude polysaccharide-1 (IPFP-1) with a molecular weight of 9187Da and pomelo fruit crude polysaccharide-2 (IPFP-2) with a molecular weight greater than 100kDa, and the monosaccharide composition of the pomelo fruit crude polysaccharide contains galactose, glucose and xylose.

[0041] The present invention also provides a method for preparing the above-mentioned pomelo fruit crude polysaccharide, which specifically comprises the following steps:

[0042] S1, slicing unripe pomelo fruit and drying them in the sun, specifically, drying them in the sun until they are in a state of being easily broken by hand, thereby obtaining pomelo fruit slices;

[0043] S2, adding water to the pomelo fruit slices obtained in step S1, heating and refluxing for extraction 3 times, combining the extracts, and then concentrating the extracts under reduced pressure to obtain a concentrated solution;

[0044] The solid-liquid ratio of each heating reflux extraction is 1:20, the heating temperature is 100° C., the extraction time is 2 h, and the mass ratio of the volume of the concentrated liquid to the pomelo slices obtained in step S1 is 2.5 mL: 1 g; the temperature of the reduced pressure concentration is 55° C. and the pressure is -0.095 MPa.

[0045] S3, adding anhydrous ethanol to the concentrated solution obtained in step S2, adjusting the anhydrous ethanol content in the concentrated solution to 40%, 60% and 80% in sequence, and subjecting the polysaccharides in the concentrated solution to graded precipitation. After the graded precipitation is completed, 80% of the alcohol precipitation components are collected, and the protein is removed by the classic sevage method. The filtrate after the protein is removed is dialyzed through a 3500Da dialysis bag, and then subjected to conventional freeze-drying to obtain pomelo crude polysaccharide. The following is a structural characterization and pharmacological activity evaluation of the pomelo crude polysaccharide (IPFP) provided in the embodiment of the present invention

[0046] 1. Experimental Materials and Methods

[0047] 1. Polysaccharide and protein content detection

[0048] The polysaccharide content of IPFP was determined by the phenol-sulfuric acid method; Thermo Scientific The protein content was detected by BCA protein quantitative analysis kit. The specific steps were carried out according to the instructions of the kit.

[0049] 2. Molecular weight detection

[0050] Prepare 1 mg / mL IPFP sample and standard solution respectively, and detect by HPLC instrument connected with RID detector. The specific chromatographic conditions are as follows: Ultrahydrogel TM 1000 (7.8 mm × 300 mm, 5 μm) gel chromatography column, column temperature 30 °C, RID detection cell temperature 40 °C, ultrapure water elution, flow rate 0.5 mL min -1 , injection volume 20μL, detection time 30min.

[0051] 3. Monosaccharide composition analysis

[0052] The PMP pre-column derivatization method combined with HPLC instrument was used to detect the products after sample hydrolysis. The sample processing steps refer to relevant literature and make minor adjustments. Specifically, 7 mg IPFP and 5 mL 2M TFA solution were placed in the reaction bottle in turn and reacted in an oil bath at 120 ° C for 3 hours. After the reaction, the solution was spin-dried, and an appropriate amount of methanol was added several times, and the spin-dried operation was continued to fully remove TFA. Then 1 mL 0.5 M PMP methanol solution and 1 mL sodium hydroxide solution were added, and the reaction was carried out in a 70 ° C water bath for 2 hours. Finally, hydrochloric acid was neutralized, chloroform was extracted to remove impurities, and the upper aqueous phase was filtered through a 0.22 μm filter membrane before being detected and analyzed on the machine. The instrument chromatographic parameters were set as follows: EclipsePlus C18 (4.6 mm × 250 mm, 5 μm), the mobile phase was 0.1 M phosphate buffer-acetonitrile (80:20, v / v), and the flow rate was 1 mL min -1 , column temperature 30°C, detection wavelength 245nm, injection volume 10-20μL, elution time 40min.

[0053] 4. Animal Experiment Design

[0054] (1) Experimental design

[0055] 50 SPF BALB / c mice were provided by Guangzhou Zitangjin Biotechnology Co., Ltd. and were kept in a standard animal room (12h light / dark cycle). According to body weight, the mice were randomly divided into 5 groups, namely normal group (NG), model group (MG), low-dose group of pomelo polysaccharide (LDG), medium-dose group of pomelo polysaccharide (MDG) and high-dose group of pomelo polysaccharide (HDG). The mice in the model group drank 2.5% DSS solution for 7 days. In addition to providing 2.5% DSS drinking water, the treatment groups (low-dose group of pomelo polysaccharide, medium-dose group of pomelo polysaccharide and high-dose group of pomelo polysaccharide) were gavaged with different doses of pomelo polysaccharide solution (200 mg / kg, 400 mg / kg and 800 mg / kg) prepared by the embodiment of the present invention at a fixed time every day for 7 days. The normal group did not undergo any drug intervention. After the feeding cycle, the mice were anesthetized and killed, and fecal samples and colon tissues were collected. After the mouse feces were taken out, they were immediately placed in liquid nitrogen for a period of time and then transferred to a -80°C refrigerator for storage. After the cecum contents were rinsed with pre-cooled saline, the colon length was measured. The spleen weight was weighed and the spleen index of each mouse was calculated. From the distal colon, one 0.5 cm and two 1 cm lengths of colon tissue were cut off for histopathological section examination and detection of tissue protein and gene expression, respectively.

[0056] (2) H&E staining

[0057] Colon tissue was fixed with 4% paraformaldehyde for 24 hours, dehydrated with different concentrations of ethanol, embedded in paraffin, and cross-sectioned to obtain 5 μm thick tissue sections. The tissue sections were processed according to the H&E standard operating procedures, photographed under an optical microscope, and subjected to histopathological analysis.

[0058] (3) Fluorescence quantitative PCR

[0059] RNA was extracted from colon tissue using Trizol reagent, and then purified with lithium chloride to remove DSS remaining in the tissue. The presence of DSS has been shown to interfere with experimental results. The concentration and purity of RNA were measured using a NanoDrop ultra-micro spectrophotometer. RNA was synthesized into cDNA using a reverse transcription kit and purified according to qRT-PCR experiments were performed according to the instructions of the Visual GreenqPCR SuperMix kit. RNA primers TNF-α, IL-1β, and GAPDH were designed, synthesized, and purified by Sangon Biotech (Shanghai) Co., Ltd. TNF-α primer sequences: F (TGACTCCAAAGTAGACCTGC) and R (CTACTCCCAGGTTCTCTTCA); IL-1β primer sequences: F (TGCCACCTTTTGACAGTGATC) and R (AAGGTCCACGGGAAAGACAC). TNF-α and IL-1β mRNA expressions were normalized with the internal reference GAPDH for statistical analysis.

[0060] (4) Tissue protein detection

[0061] The tissue samples were homogenized using an automatic homogenizer and the resulting supernatant was collected. After determining the protein concentration, an appropriate loading buffer was added and boiled for denaturation. An equal amount of protein (30 μg) was loaded and separated by 10% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE), and then transferred to a 0.45 μm PVDF membrane. After blocking with 5% skim milk powder for 1 hour, the specific primary antibodies p-Erk1 / 2 and Erk1 / 2 were incubated overnight at 4°C. Subsequently, the cells were incubated with an anti-rabbit secondary antibody conjugated to horseradish peroxidase (HRP) for 1 hour at room temperature. After the protein was developed using an enhanced chemiluminescence (ECL) kit, it was visualized using an automatic imaging system. The grayscale value of the band was quantified by Image J software, and the target protein level was expressed as the relative grayscale value normalized to GAPDH, and then statistically analyzed.

[0062] (5) Analysis of fecal microbial composition

[0063] The genomic DNA of fecal samples was extracted by CTAB method, and its purity and concentration were tested by 1% agarose gel electrophoresis. The samples were uniformly diluted to a concentration of 1 ng / μl, and then the V3+V4 variable region was amplified by a standard PCR amplification procedure. The primer information was 341F (5'-CCTAYGGGRBGCASCAG-3') and 806R (5'-GGACTACNNGGGTATCTAAT-3'). To ensure the amplification efficiency, a specific enzyme ( After amplification, the concentration of the amplified product was determined, and based on this, the samples were mixed in equal amounts and then purified. The library was constructed using the Agilent 5400 Bioanalyzer. After the size and quantity of the amplicon library were evaluated, sequencing was performed using the NovaSeq 6000 instrument. The Wekemo Bioincloud platform read the data and used the built-in plug-in of the platform for bioinformatics analysis.

[0064] (6) Data analysis

[0065] IBM SPSS 20.0 software was used for statistical analysis of the data. Bonferroni and Dunnett's 3T3 were used for multiple comparisons under one-way analysis of variance according to whether the variance was homogeneous. All tests were considered to be significantly different with P < 0.05.

[0066] 2. Results and Analysis

[0067] 1. Sugar and protein content in IPFP

[0068] The results of the phenol-sulfuric acid method showed that the regression curve of glucose was y=0.0019x+0.2685, R2=0.9414, and the sugar content of IPFP was 81.10%. The BCA protein quantitative kit analysis showed that the regression curve of bovine serum albumin (BSA) was y=1.55474x+0.1966, R 2 =0.9956, the protein content of IPFP is 0.05%, which is almost negligible.

[0069] 2. Molecular weight of IPFP

[0070] HPGPC-RID analysis showed that IPFP can be simply regarded as consisting of two chromatographic peaks, IPFP-1 and IPFP-2. According to the regression curve of dextran y = -0.1627x + 7.2779, R 2 =0.9676, the molecular weight of IPFP-1 was determined to be 9187, and IPFP-2 was a complex chromatographic peak composed of at least 3 polysaccharides with molecular weights greater than 100,000.

[0071] 3. Monosaccharide composition of IPFP

[0072] The acetylated derivatives of standard monosaccharides were analyzed by pre-column derivatization and liquid chromatography. The monosaccharide composition of IPFP was determined to be galactose (Gal), glucose (Glc) and xylose (Xyl) based on the relative retention time.

[0073] 4. The crude pomelo polysaccharide prepared in the present invention can alleviate ulcerative colitis caused by DSS

[0074] The present invention evaluates the efficacy of pomelo polysaccharide in improving ulcerative colitis in mice from three aspects: weight change, colon length and spleen index. Figure 3 As shown in A. Figure 3 In B, the present invention conducted a statistical analysis on the weight change rate of each group of mice on the 7th day (expressed as a percentage of the initial body weight). Figure 3 The results of B show that the weight loss of mice treated with DSS was significant (**P<0.01vs.NG), but high-dose IPFP can partially restore the weight loss caused by DSS ( # P<0.05vs.MG), and the body weight of mice in the LDG and MDG groups also slightly increased, although this difference was not statistically significant. Figure 3 C It can be seen that the DSS-induced colon shortening was significantly improved after treatment with medium and high doses of IPFP ( ## P<0.01vs.MG), after DSS treatment, the spleen of mice will show pathological hypertrophy and the weight will increase appropriately (*P<0.05vs.NG), while oral administration of IPFP can slightly inhibit this pathological feature ( # P<0.05 vs. MG). The above results suggest that the crude pomelo polysaccharide prepared in the embodiment of the present invention has the effect of protecting the intestinal tract of mice from DSS damage, and the effect of high dose is better.

[0075] 5. The crude pomelo polysaccharide prepared in the present invention can reduce pathological damage to colon tissue

[0076] The present invention conducted HE staining experiments on mouse colon tissue to further observe the therapeutic effect of pomelo fruit crude polysaccharide. The results are as follows Figure 4 As shown, through Figure 4 It can be seen that the colon epithelial cells of healthy mice without any intervention are intact and orderly arranged; the crypt morphology is normal with little damage; and the mucosal layer has no inflammatory lesions. In the MG group, the crypt structure is largely missing and the inflammatory cells are diffused over a large area. At the same time, in the treatment group given with pomelo crude polysaccharide, a small amount of inflammatory infiltration can be seen, the crypt structure is partially intact, the degree of inflammation is alleviated, and as the concentration of pomelo polysaccharide administration increases, this improvement effect is more obvious. In summary, it is shown that the pomelo crude polysaccharide prepared in the embodiment of the present invention can alleviate the colon pathological damage caused by DSS to a certain extent.

[0077] 6. The crude pomelo polysaccharide prepared in the present invention inhibits the expression of inflammation-related genes

[0078] The present invention evaluates the expression of inflammation-related genes through PCR analysis, aiming to further verify the therapeutic effect of IPFP. Figure 5It can be seen that DSS induced a significant increase in the expression of TNF-α, IL-1β and IL-6 in the colon tissue of mice (**P<0.001 or ***P<0.001vs.NG). IPFP intervention treatment had a significant inhibitory effect on the upregulation of inflammatory genes ( # P<0.05 or ### P<0.001vs.MG). The expression level of anti-inflammatory gene IL-10 was lower in the MG group (***P<0.001), but its expression level was significantly increased in the low-dose and high-dose IPFP groups ( # P<0.05). The above results suggest that IPFP may alleviate DSS-induced colonic inflammatory damage by inhibiting the expression of pro-inflammatory genes and promoting the expression of anti-inflammatory genes.

[0079] 7. The crude pomelo polysaccharide prepared in the present invention inhibits DSS-induced inflammatory response via the ERK pathway

[0080] The present invention explores the mechanism of the anti-inflammatory effect of pomelo polysaccharide by detecting the expression of phosphorylated erk protein in colon tissue. Figure 6 As shown, through Figure 6 It can be seen that when mice were induced by DSS, the expression of p-Erk1 / 2 in their colon tissues was significantly increased (***P<0.0001vs.NG), suggesting that DSS can induce the activation of the ERK signaling pathway, but under the intervention treatment of the citrus fruit crude polysaccharide prepared in the embodiment of the present invention, this expression increase trend was appropriately reversed, especially in the MDG and HDG group mice. This experiment shows the mechanism of action of citrus fruit crude polysaccharide in inhibiting the ERK pathway to improve tissue inflammation in mice.

[0081] 8. Beneficial effects of the crude pomelo polysaccharide prepared in the present invention on regulating intestinal flora

[0082] The present invention explores whether the therapeutic effect of citronella polysaccharide administration is related to intestinal flora. The changes in intestinal microorganisms in the cecum contents of each group of mice were detected by 16SrRNA sequencing technology. The results are as follows Figure 7 As shown. Figure 7 The Venn diagram of A showed that a total of 2831 OTUs were identified in the five groups of fecal samples, of which 125 were intersection OTUs and 87 were unique OTUs in the MG group. The number of OTUs in the LDG and MDG groups was significantly larger than that in the model group and was close to that in the normal group. Figure 7From the results of B, it can be seen that compared with the control group, the Chao1 index and Shannon index of the DSS group were reduced, but after drug intervention, their values ​​increased, indicating that pomelo crude polysaccharides can increase the richness and diversity of intestinal microbiota. The above two indexes of the LDG group and the MDG group were slightly higher than those of the HDG group, which was consistent with the changes in the OTUs values. In view of the better therapeutic effect of high-dose pomelo crude polysaccharides, the present invention speculates that there are certain differences in the communities involved in the dominant OTUs in different dose treatment groups. To this end, the present invention further clarified the relative abundance of the intestinal microbiota of each group of mice at different classification levels, and the results are shown in Figure 8 As shown. Figure 8 The classification results at the phylum level showed that compared with the control group, DSS treatment led to a decrease in Bectercidetes and Firmicutes, but a significant increase in Protoobacteria, with the relative abundance decrease or increase ratios of 35.94%, 58.57%, and 2000%, respectively. Administration of pomelo crude polysaccharides significantly increased the abundance of Bectercidetes and Firmicutes and reduced the abundance of Protoobacteria. Compared with the LDG and MDG groups, the HDG group had the strongest ability to increase Bectercidetes, reaching 137.51%, which was even higher than the abundance level of Bectercidetes in the normal group. The top 20 microbial communities at the genus level are as follows: Fig. 9 As shown, through Fig. 9 It can be seen that compared with the normal group, the abundance of Clostridium, Enterococcus, Proteus and Parabacteroides in the intestine of the MG group mice increased significantly, and the number of Rikenella and Oscillospira decreased significantly, but the change trend of these genera was restored to a certain extent after supplementing with pomelo crude polysaccharide. Finally, the linear discriminant analysis effect size (LEfSe) analysis method was used to evaluate the bacterial groups that were mainly changed by pomelo crude polysaccharide in ulcerative colitis mice. The results are shown in Figure 2. Fig.10 As shown. Fig.10 It can be seen that based on the LDA>3.5 standard, at the genus level, the dominant genera in the normal group were Oscillospira, Bilophila and Ruminococcus, while Parabacteroides was an important contributing genus in the intestine of mice with DSS-induced ulcerative colitis. It is worth noting that the abundance of Bectercidetes changed significantly in the HDG group, which is consistent with the above heat map results, indicating that Bectercidetes may be related to the effect of citronella polysaccharide in treating UC.

[0083] In summary, the IPFP prepared in the embodiment of the present invention is a complex polysaccharide with a molecular weight of more than 9000Da, composed of glucose, galactose and xylose. The relief of IPFP on DSS-induced ulcerative colitis can be attributed to its ability to inhibit inflammatory response, reduce the abundance of pathogenic bacteria (Enterococcus and Clostridium), and increase the abundance of probiotics (Rieselguhr). Therefore, IPFP has great potential as an auxiliary drug for the prevention and treatment of UC.

[0084] Although the embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the claims and their equivalents.

Claims

1. A crude pomelo polysaccharide, characterized in that: The pomelo fruit crude polysaccharide consists of pomelo fruit crude polysaccharide-1 with a molecular weight of 9187 Da and pomelo fruit crude polysaccharide-2 with a molecular weight greater than 100 kDa, and the monosaccharide composition of the pomelo fruit crude polysaccharide comprises galactose, glucose and xylose.

2. A method for preparing crude pomelo polysaccharide according to claim 1, characterized in that: The following steps are involved: S1. Slicing unripe pomelo fruit and drying them in the sun to obtain pomelo fruit slices; S2, adding water to the pomelo fruit slices obtained in step S1, heating and refluxing for extraction 3 times, combining the extracts, and then concentrating the extracts under reduced pressure to obtain a concentrated solution; S3, adding anhydrous ethanol to the concentrated solution obtained in step S2, adjusting the anhydrous ethanol content in the concentrated solution to 40%, 60% and 80% in sequence, and subjecting the polysaccharides in the concentrated solution to graded precipitation. After the graded precipitation is completed, collecting 80% of the alcohol precipitation components, and deproteinizing by the classic sevage method. The filtrate after deproteinization is dialyzed and freeze-dried to obtain pomelo crude polysaccharide.

3. The method for preparing crude pomelo polysaccharide according to claim 2, characterized in that: In step S2, the solid-liquid ratio of each heating reflux extraction is 1:20, the heating temperature is 100° C., and the extraction time is 2 h.

4. The method for preparing crude pomelo polysaccharide according to claim 2, characterized in that: In step S2, the mass ratio of the volume of the concentrated solution to the pomelo fruit slices obtained in step S1 is 2.5 mL:1 g.

5. The method for preparing pomelo fruit crude polysaccharide according to claim 2, characterized in that: In step S2, the temperature of the reduced pressure concentration is 55° C. and the pressure is -0.095 MPa.

6. Use of the crude pomelo polysaccharide according to claim 1 in the preparation of a medicine for treating ulcerative colitis.

7. The use according to claim 6, characterized in that: The medicine achieves improvement or treatment of ulcerative colitis through crude citrus fruit polysaccharide.

8. The use according to claim 7, characterized in that: The pomelo fruit crude polysaccharide improves or treats ulcerative colitis by inhibiting the expression of pro-inflammatory factors TNF-α, IL-1β and IL-6 and promoting the expression of anti-inflammatory gene IL-10.

9. The use according to claim 7, characterized in that: The pomelo fruit crude polysaccharide improves or treats ulcerative colitis by inhibiting the Erk1 / 2 pathway.

10. The use according to claim 7, characterized in that: The pomelo fruit crude polysaccharide suppresses the abundance of pathogenic bacteria in the intestine, promotes the abundance of probiotics in the intestine, and regulates intestinal microorganisms to achieve improvement or treatment of ulcerative colitis.

Images