Acid-resistant PET plastic degrading enzyme PETase mutant and application thereof

Abstract

The invention discloses an acid-resistant PET plastic degrading enzyme PETase mutant and application thereof, and belongs to the technical field of biological enzyme engineering. According to the invention, amino acid sequence truncation, single point mutation and pairwise compound mutation are carried out on the basis of wild type FAST-PETase, and the obtained mutant R84D reduces the optimal reaction pH of the FAST-PETase and improves the stability of the FAST-PETase under different pH values. Compared with the enzyme activity of starting FAST-PETase, the enzyme activity of the mutant constructed by the invention is improved by 2.2 times. When the pH value is 6.5-8.5, the stability of R84D is relatively high, and the enzyme activity residue is gt; 60%.

Description

Technical Field

[0001] The invention relates to an acid-resistant PET plastic degrading enzyme PETase mutant and application thereof, belonging to the technical field of bioenzyme engineering. Background Art

[0002] Polyethylene terephthalate (PET) is a man-made polymer that makes up a wide variety of consumer plastics. Its outstanding mechanical and chemical stability hinders its degradation. Plastic pollution has been recognized as a major threat to organisms and eventually accumulates through the food chain, thus negatively affecting human health.

[0003] At present, the commonly used methods for degrading PET plastics include physical, chemical and biological methods. Physical recycling causes the breakage of PET molecular chains, the reduction of molecular weight, and the presence of impurities that are difficult to remove, which significantly reduces the performance and economic feasibility of PET. Chemical processing is energy intensive, costly, and may produce toxic secondary pollutants. Compared with physical and chemical methods for treating PET, biodegradation is environmentally friendly and has low energy consumption. Therefore, biodegradation is considered to be the most effective method for PET degradation. Biodegradation methods include microbial degradation and bioenzyme degradation. Because PET contains aromatic components in its structure, it cannot directly enter microbial cells for biodegradation. Therefore, first, the extracellular enzymes secreted by microorganisms are required to degrade PET macromolecules into water-soluble small molecules, which are then absorbed and further digested by microbial cells and finally hydrolyzed into CO 2 and H 2 O. The effectiveness of PET biodegradation mainly depends on the performance of these extracellular enzymes. Therefore, the most promising option is PET enzymatic biodegradation. In recent years, a series of in vitro PET degrading enzymes have been reported to mainly target PET ester bonds, breaking down PET into smaller molecules such as TPA, EG, mono(2-hydroxyethyl) terephthalate (MHET) and bis(2-hydroxyethyl) terephthalate (BHET). Enzymatic biodegradation of PET under natural environmental conditions is a promising and economically viable approach to reduce the global burden of plastic waste, thereby limiting its global impact on the environment and human health.

[0004] After several years of improvement, IsPETase and its variants showed decreased activity in the long reaction time required to achieve 100% substrate conversion, and therefore have not yet met the requirements for large-scale industrial applications. Hongyuan et al. used machine learning to obtain a heat-resistant and highly active IsPETase mutant, namely FAST-PETase, which maintained high activity at 50°C and pH = 8.0. Since FAST-PETase can gradually degrade PET into bis(hydroxyethyl) terephthalate (BHET), mono(2-hydroxyethyl) terephthalate (MHET) and terephthalic acid (TPA), the pH value of the reaction solution will decrease to a certain extent after being directly added to the plastic sheet, and the enzyme activity will be reduced or even inactivated under acidic conditions. In view of this, site-directed mutagenesis was used to modify FAST-PETase to be acid-resistant. Summary of the invention

[0005] To solve the above problems, the present invention provides an enzyme mutant for improving the acid resistance of FAST-PETase, including single mutants R84D, R84E, R117D, R117E, K227D, and K227E, and double mutants R84D / R117D, R84D / R117E, R84D / K227D, R84D / K227E, R84E / R117D, R84E / R117E, R84E / K227D, R84E / K227E, R117D / K227D, R117D / K227E, R117E / K227D, and R117E / K227E.

[0006] The present invention provides a FAST-PETase enzyme mutant with improved acid resistance, which is obtained by performing at least one of the following mutations on the basis of the parent:

[0007] (1) mutating the arginine at position 84 to aspartic acid or glutamic acid;

[0008] (2) mutating the arginine at position 117 to aspartic acid or glutamic acid;

[0009] (3) mutating lysine 227 to aspartic acid or glutamic acid;

[0010] (4) Truncation of the 1st to 21st amino acids at the N-terminus.

[0011] In one embodiment, the mutant is based on SEQ ID NO.1, wherein the arginine at position 84 is mutated to aspartic acid, and the arginine at position 117 is mutated to aspartic acid. The obtained mutant is named R84D / R117D.

[0012] In one embodiment, the mutant is based on SEQ ID NO.1, with the arginine at position 84 mutated to aspartic acid, and the arginine at position 117 mutated to glutamic acid. The obtained mutant is named R84D / R117E.

[0013] In one embodiment, the mutant is based on SEQ ID NO.1, with the arginine at position 84 mutated to aspartic acid, and the lysine at position 227 mutated to aspartic acid. The obtained mutant is named R84D / K227D.

[0014] In one embodiment, the mutant is based on SEQ ID NO.1, with the 84th arginine mutated to aspartic acid and the 227th lysine mutated to glutamic acid. The obtained mutant is named R84D / K227E.

[0015] In one embodiment, the mutant is based on SEQ ID NO.1, with the arginine at position 84 mutated to glutamic acid, and the arginine at position 117 mutated to aspartic acid. The obtained mutant is named R84E / R117D.

[0016] In one embodiment, the mutant is based on SEQ ID NO.1, with the arginine at position 84 mutated to aspartic acid and the arginine at position 117 mutated to glutamic acid. The obtained mutant is named R84E / R117E.

[0017] In one embodiment, the mutant is based on SEQ ID NO.1, with the arginine at position 84 mutated to aspartic acid, and the lysine at position 227 mutated to aspartic acid. The obtained mutant is named R84E / K227D.

[0018] In one embodiment, the mutant is based on SEQ ID NO.1, with the 84th arginine mutated to aspartic acid, and the 227th lysine mutated to glutamic acid. The obtained mutant is named R84E / K227E.

[0019] In one embodiment, the mutant is obtained by mutating the arginine at position 117 to aspartic acid and the lysine at position 227 to aspartic acid based on SEQ ID NO.1. The obtained mutant is named R117D / K227D.

[0020] In one embodiment, the mutant is obtained by mutating the arginine at position 117 to aspartic acid and the lysine at position 227 to glutamic acid based on SEQ ID NO.1. The obtained mutant is named R117D / K227E.

[0021] In one embodiment, the mutant is based on SEQ ID NO.1, with the arginine at position 117 mutated to glutamic acid, and the lysine at position 227 mutated to aspartic acid. The obtained mutant is named R117E / K227D.

[0022] In one embodiment, the mutant is obtained by mutating the arginine at position 117 to glutamic acid and the lysine at position 227 to glutamic acid based on SEQ ID NO.1. The obtained mutant is named R117E / K227E.

[0023] The present invention also provides a gene encoding the mutant.

[0024] The invention also provides a recombinant plasmid carrying the gene.

[0025] The present invention also provides a recombinant microorganism expressing the mutant.

[0026] The present invention also provides a recombinant Escherichia coli, which uses pET28a(+) as a vector and Escherichia coli BL21(DE3) as a host to express the mutant.

[0027] The present invention also provides a method for preparing the FAST-PETase mutant, which comprises culturing the recombinant Escherichia coli in a culture medium for a period of time and inducing expression with IPTG to prepare the FAST-PETase mutant.

[0028] In one embodiment, the method is to culture the recombinant E. coli to an OD of 600 =0.6-0.8, add IPTG with a final concentration of 0.4mM, and induce expression at 16℃ for 24h.

[0029] The present invention also provides a method for improving the acid resistance of a PETase mutant, which comprises mutating one or more amino acids at positions 84, 117, and 227 of the PETase enzyme.

[0030] In one embodiment, the mutation includes but is not limited to any of the following: R84D, R84E, R117D, R117E, K227D, K227E.

[0031] In one embodiment, the amino acid sequence of the PETase enzyme is shown as SEQ ID NO.1.

[0032] The invention also provides application of the mutant in catalyzing p-nitrophenyl acetate.

[0033] In one embodiment, the use is to react the mutant in an environment containing p-nitrophenyl acetate under an acidic environment.

[0034] In one embodiment, the application is to react the mutant at a pH of 6 to 7 using p-nitrophenyl acetate (p-NPA) as a substrate.

[0035] Beneficial effects:

[0036] The present invention uses FAST-PETase as the starting strain, and further performs 3D structural homology modeling on FAST-PETase. After visualization software analysis, the surrounding of the active site is selected. The amino acid residues in the range of 1:1 were identified, and three key amino acid residue sites were subjected to site-directed mutagenesis. The enzyme activity of the mutant R84D constructed by the present invention was at least 2.2 times higher than that of the wild type, from 14U / mL to 31U / mL. At pH = 6.5-8.5, R84D had a high stability, and the residual enzyme activity was > 60%. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 is the enzyme activity of the mutant obtained by site-directed mutation.

[0038] Figure 2 is the enzyme activity of the mutants with site-directed compound mutations.

[0039] Figure 3 Comparison of the optimal reaction pH of mutant R84D and wild-type FAST-PETase.

[0040] Figure 4 Comparison of pH stability between mutant R84D and wild-type FAST-PETase. DETAILED DESCRIPTION

[0041] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0042] Enzyme activity determination method:

[0043] Use DPBS buffer (pH 7.0) and 20mM p-nitrophenyl acetate (p-NPA), take 800μL DPBS buffer, 100μL p-NPA and 100μL crude enzyme solution, react at 30℃ for 5min, add 1000μL anhydrous ethanol to terminate the reaction. After the reaction, centrifuge at 12,000rpm for 1min, take 200μL to a 96-well plate, and measure the absorbance at 415nm.

[0044] The unit of FAST-PETase enzyme activity is defined as: under the above reaction conditions, the amount of enzyme required to catalyze the substrate p-nitrophenyl acetate to produce 1 μmol p-nitrophenol per minute is one enzyme activity unit (U).

[0045] Example 1 Construction of mutants

[0046] 1. Site-directed mutagenesis - single point mutation

[0047] The active sites of FAST-PETase (amino acid sequence as shown in SEQ ID NO.1) are located at Ser154, Asp200, and His231. Around these three active sites, There are three basic amino acids in the range: 84R, 117R, and 227K. These three amino acids were mutated to D or E by site-directed mutagenesis, and six mutants were constructed: R84D, R84E, R117D, R117E, K227D, and K227E.

[0048] Since the amino acids 1 to 21 of the FAST-PETase enzyme have no significant effect on the catalytic function of the enzyme, the nucleotide sequence after truncating 21 amino acids as shown in SEQ ID NO.2 was synthesized by Tianlin Biotechnology Co., Ltd., and NcoI and XhoI restriction endonuclease sites were added at both ends of the coding region. The target gene fragment was double-digested with restriction endonucleases NcoI and XhoI, connected with the pET28a(+) vector treated with the same enzyme digestion method, and transferred into Escherichia coli BL21(DE3) competent cells, and the positive recombinant plasmid pET28a(+)-FAST-PETase containing the Fast-PETase gene was screened, thereby constructing an in vitro heterologous expression system of FAST-PETase.

[0049] Using the recombinant plasmid pET28a(+)-FAST-PETase as a template, the three sites were subjected to site-directed mutagenesis. The PCR amplification conditions were set according to the instructions of Prime STAR HSDNA polymerase: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 15 s; annealing at 55°C for 30 s; extension at 72°C (the enzyme extension rate was 1 kb min -1 , the specific time is set according to the length of the amplified fragment); set the cycle to 30 times; and then extend at 72°C for 10 min to complete the PCR amplification process. The PCR amplification system is shown in Table 1.

[0050] Table 1 PCR amplification system

[0051]

[0052] in:

[0053] Position 84 mutated to aspartic acid:

[0054] Forward primer: CCATTTAATACTGCTCTGATCGGCGGTATAACCC;

[0055] Reverse primer: GGGTTATACCGCCGATCAGAGCAGTATTAAATGG;

[0056] Position 84 mutated to glutamic acid:

[0057] Forward primer: CCATTTAATACTGCTCTGTTCGGCGGTATAACCC;

[0058] Reverse primer: GGGTTATACCGCCGAACAGAGCAGTATTAAATGG;

[0059] Aspartic acid mutation at position 117:

[0060] Forward primer: CATCTGCTGACTACTATCACTTTCCGGCTGA;

[0061] Reverse primer: TCAGCCGGAAAGTGATAGTAGTCAGCAGATG;

[0062] Mutation of glutamate at position 117:

[0063] Forward primer: CATCTGCTGACTACTTTCACTTTCCGGCTGA;

[0064] Reverse primer: TCAGCCGGAAAGTGAAAGTAGTCAGCAGATG;

[0065] Aspartic acid mutation at position 227:

[0066] Forward primer: GCTGCCGCCATCAATTTCCAGAAACTGTTTG;

[0067] Reverse primer: CAAACAGTTTCTGGAAATTGATGGCGGCAGC;

[0068] Mutation of glutamate at position 227:

[0069] Forward primer: GCTGCGCCTTCAATTCCAGAAACTGTTTG;

[0070] Reverse primer: AAACAGTTTCTGGAAATTGAAGGCGGCAGCC;

[0071] The plasmid obtained by the above mutation was transformed into E. coli BL21 (DE3) competent cells and spread on a plate containing 50 μg·L -1 The cells were plated on LB solid medium containing kanamycin and cultured overnight at 37°C. Correct transformants were selected by sequencing to obtain FAST-PETase mutants R84D, R84E, R117D, R117E, K227D, and K227E.

[0072] 2. Site-directed mutagenesis - compound mutagenesis

[0073] The above-mentioned sites were subjected to compound mutation (same method as above) to construct 12 compound mutants R84D / R117D, R84D / R117E, R84D / K227D, R84D / K227E, R84E / R117D, R84E / R117E, R84E / K227D, R84E / K227E, R117D / K227D, R117D / K227E, R117E / K227D, R117E / K227E.

[0074] Example 2 Expression of FAST-PETase and its mutants

[0075] The recombinant plasmid containing the recombinant gene was inoculated into a medium containing 50 μg mL -1 The culture was carried out in LB liquid medium containing kanamycin at 37°C and 200 rpm for 8 h. The inoculum was transferred to LB liquid medium containing 50 μg mL -1 The culture was carried out in TB liquid medium containing kanamycin at 37°C and 200 rpm until the OD 600 =0.6-0.8, add IPTG with a final concentration of 0.4mM, and induce expression at 16℃ for 24h.

[0076] After fermentation, the cells were collected by centrifugation at 7,000 rpm for 10 min, washed twice with saline, concentrated 5 times, and suspended in 10 mM KH 2 PO 4 -NaOH buffer (pH=7.0). After washing and suspension treatment, the collected bacteria were ultrasonically disrupted by an ultrasonic disruptor (UCD-650B) for 30 min (horn 6, power ratio 20%, working 2s, stopping 4s), centrifuged at 12,000 rpm for 30 min, and the supernatant (i.e. crude enzyme solution) was collected.

[0077] The mutant proteins of the single mutation and compound mutation were placed at 30°C for 5 min, and the absorbance was measured at 415 nm using an ELISA reader and recorded. Figures 1-2The enzyme activity of the single mutant R84D is 2.2 times higher than that of the wild type (shown in SEQ ID NO.3).

[0078] Example 3 Determination of the optimal pH and pH stability of FAST-PETase and mutant R84D

[0079] The activity of pure enzyme solution was measured in reaction buffers with different pH values ​​(6.0-9.0) to determine the optimal pH value for the enzyme reaction. 2 HPO 4 -KH 2 PO 4 Buffer (pH = 6.0-8.0), Tris-HCl buffer (pH = 8.0-9.0). When determining the pH stability range of the enzyme, the enzyme was placed in different pH buffers (6.0-9.0), left to stand at 4°C for 24 hours, and the residual enzyme activity was determined at a 10mM substrate p-NPA concentration. The highest enzyme activity was taken as 100%, and the relative enzyme activity was calculated. The results are shown in Figures 3-4 As shown, the relative enzyme activity of R84D at pH = 6 and pH = 6.5 increased by 10% and 18% respectively compared with the wild type. At pH = 6.5-8.5, R84D has high stability, and the residual enzyme activity is > 60%.

[0080] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A FAST-PETase enzyme mutant with improved acid resistance, characterized in that: At least one of the following improvements is made on the basis of the parent: (1) mutating the arginine at position 84 to aspartic acid or glutamic acid; (2) mutating the arginine at position 117 to aspartic acid or glutamic acid; (3) mutating lysine 227 to aspartic acid or glutamic acid; (4) Truncation of the 1st to 21st amino acids at the N-terminus.

2. The mutant according to claim 1, characterized in that The amino acid sequence of the parent is shown in SEQ ID NO.

1.

3. A gene encoding the mutant according to claim 1 or 2.

4. A recombinant plasmid carrying the gene according to claim 3.

5. A recombinant microorganism expressing the mutant according to claim 1 or 2.

6. A recombinant Escherichia coli, characterized in that The mutant according to claim 1 or 2 is expressed using pET28a(+) as a vector and Escherichia coli BL21(DE3) as a host.

7. A method for preparing the FAST-PETase mutant according to claim 1 or 2, characterized in that: The recombinant Escherichia coli according to claim 6 is cultured in a culture medium for a period of time, and IPTG is used to induce the expression of the FAST-PETase mutant.

8. A method for improving the acid resistance of PETase, characterized in that: One or more amino acids at positions 84, 117 and 227 of the PETase enzyme are mutated; the amino acid sequence of the PETase enzyme is shown in SEQ ID NO.

1.

9. Use of the mutant according to claim 1 or 2 in catalyzing p-nitrophenyl acetate.

10. The use according to claim 9, characterized in that: The mutant was reacted in an environment containing p-nitrophenyl acetate under an acidic environment.

Images