Application of non-coding RNA LAL in regulation and control of salt tolerance of alfalfa

Abstract

The invention relates to application of non-coding RNA LAL in regulation and control of salt tolerance of alfalfa. The invention provides a novel non-coding RNA LAL in an alfalfa genome, the sequence of the novel non-coding RNA LAL is shown as SEQ ID NO: 1, the invention also verifies the application of the non-coding RNA LAL in regulating and controlling the salt tolerance of alfalfa: in a salt-treated alfalfa plant, the expression quantity of the non-coding RNA LAL is gradually reduced, namely the low expression of the non-coding RNA LAL is beneficial to improving the salt tolerance of the alfalfa. The research result provides an important reference basis for defining the salt-tolerant mechanism of alfalfa and culturing salt-tolerant varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to application of alfalfa truncatula non-coding RNA LAL in regulating the salt tolerance of alfalfa. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Alfalfa (Medicago truncatula) is a perennial herbaceous plant of the genus Alfalfa in the Leguminosae family. It is named alfalfa because of its purple flowers. Most alfalfa species are wild, and purple alfalfa and yellow alfalfa are commonly cultivated as perennials. Purple alfalfa has the highest protein content, so it has the largest planting area. At the same time, alfalfa has a well-developed root system, is cold-resistant and drought-resistant, can waterproof and fix soil, and fix nitrogen to fertilize the field, so it is called the "king of forage grass."

[0004] Alfalfa itself has strong salt tolerance, and some varieties are more salt tolerant and have the potential to be promoted in salty land. Although alfalfa has a certain tolerance to salt stress, the increasing salinization of the land has seriously affected the yield and quality of alfalfa. The breeding cycle of highly salt-tolerant varieties through variety improvement is relatively long. Therefore, it is of great significance to conduct research on the salt tolerance mechanism of alfalfa varieties and to achieve rapid breeding of highly salt-tolerant alfalfa varieties through genetic engineering.

[0005] Advances in high-throughput sequencing technologies have shown that more than 90% of the genome contains a large number of non-coding RNAs. These ncRNAs can be further divided into small RNAs and long non-coding RNAs (lncRNAs) according to their length. Non-coding RNAs (ncRNAs) account for a considerable proportion of the transcriptomes of animals and plants, and despite the lack of protein coding ability, they play an important role in the regulation of gene expression. Long non-coding RNAs (lncRNAs), ranging in length from 200nt to tens of kb, are an important class of non-coding RNAs that have been shown to have multiple functions in eukaryotes. Most lncRNAs can be transcribed by RNA polymerase II and are usually expressed in a tissue-specific manner. According to their position relative to protein-coding genes in the genome, lncRNAs can be further divided into cis, trans, bidirectional, intragenic, and intergenic lncRNAs. Compared with protein-coding genes and even small non-coding RNAs, most lncRNAs lack strong sequence conservation between species. The expression level of lncRNAs is usually low and often shows tissue-specific patterns, which increases the possibility that lncRNAs regulate tissue development. In animals, lncRNAs have been shown to be involved in chromatin modification, transcriptional regulation, and post-transcriptional regulation. With the rapid development of sequencing technology and transcriptome analysis, thousands of lncRNAs have been discovered in several plants. Summary of the invention

[0006] Based on sequencing and transcriptome analysis technology, the present invention discovered an unreported non-coding RNA in the genome of Medicago truncatula, the sequence of which is shown in SEQ ID NO: 1, and named lncRNA LAL, which is referred to as LAL in the following documents.

[0007] It has been verified that the above-mentioned LAL is a long non-coding RNA that responds to salt stress in Medicago truncatula, and inhibiting the expression of the non-coding RNA can improve the salt tolerance of Medicago truncatula plants; further, the present invention also studies the mechanism of the non-coding RNA regulating salt stress, and the results show that MtLHCB1 improves the salt tolerance of Medicago truncatula by inhibiting the expression of lncRNA LAL. Based on the inspiration of the above research results, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides a non-coding RNA LAL, the sequence of which is as follows:

[0009] ACUGUGUAUGACCUCGAGUUCACGGUUCUUGGCAAAUGUCUCGGUCGGCAGAAAUCACUUCUCAUUGGUAUGGUGUAGUUUUGGCUCACUUUCCAGGGGCAAAGUUUGUGGCAUAGGCCCAUGCAUUGUUGUUAACUGGGUCAGCAAGGUGGUCAGCGAGGUUCUCAAUAGGUCCCUUUCCGGUGACAAUGGCCUGAACGAAGAAUCCAAACAUAGAGAACAU AGCUAACCUACCAUUUUUUAGUUCUUUCACCUUCAACUCUGCAAAAGCCUCGGGAUCUUCGGCAAGGCCCAAGGGGUCAAAGCUGCCACCUGGGUAGAGGAUCGACUACCUCGCCUAGAGGUCCACCAGCAAUACGGUAACCCUCAACAGCACCCAUUAAGAUAACUUGGACAGCCCAUAUAGCAAGGAUGCUUUGUGCAUGGACUAGACUUGGGUUAC (SEQ ID NO:1 shown).

[0010] The second aspect is the application of non-coding RNA LAL in regulating the salt tolerance of alfalfa.

[0011] The specific forms of the above applications include but are not limited to any of the following:

[0012] 1) Improve the salt tolerance of alfalfa plants by inhibiting the expression of non-coding RNA LAL;

[0013] 2) applying the inhibitor of non-coding RNA LAL to prepare a product that improves salt tolerance of alfalfa;

[0014] 3) Screening salt-tolerant plants by detecting the content of non-coding RNA LAL;

[0015] 4) The detection primers of non-coding RNA LAL were used to prepare a screening kit for salt-tolerant alfalfa.

[0016] In the above aspect 1), the "inhibition" method includes knocking out, silencing or mutating the corresponding sequences and sites in alfalfa, thereby achieving the purpose of inhibiting the expression of the lncRNA.

[0017] In the above 2), the "inhibitor" includes a recombinant vector or engineered bacteria for inhibiting, knocking out or silencing the expression of non-coding RNA LAL, and also includes an agent for inhibiting the expression of non-coding RNA LAL shown in the first aspect. One embodiment of the recombinant vector is a gene editing recombinant vector based on the CRISPR system; the agent is a chemical agent that can inhibit the expression and synthesis of non-coding RNA LAL in plant tissues, including small molecule compound entities or nucleic acid substances, such as aptamers, etc.

[0018] The screening described in aspect 3) above may be performed by a PCR method, and a specific example is a real-time fluorescence quantitative PCR detection method.

[0019] In the above aspect 4), the detection primers for the non-coding RNA LAL have sequences as shown in SEQ ID NO: 2-3.

[0020] In addition, the alfalfa referred to in the above application includes but is not limited to any one of brown spotted alfalfa, sky blue alfalfa, small alfalfa, southern alfalfa, early flowering alfalfa, flower alfalfa, terrestris alfalfa, purple alfalfa, yellow alfalfa, and wild alfalfa; more preferably, purple alfalfa.

[0021] The beneficial effects of one or more of the above technical solutions are:

[0022] The present invention first provides a novel lncRNA LAL in the alfalfa genome, and clarifies the application of the non-coding RNA in regulating the salt tolerance of alfalfa. According to the research results of the present invention, LAL exists in alfalfa and is responsible for regulating the alfalfa's response to salt stress, and its mutation enhances the plant's salt tolerance, and the alfalfa gene MtLHCB1 can be regulated by LAL to present different expression levels, which provides a corresponding reference for the study of alfalfa salt tolerance and also provides a feasible research idea for the development of alfalfa salt-tolerant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0024] Figure 1 The qRT-PCR detection of the expression changes of LAL in the wild type R108 of Medicago truncatula in response to salt stress in Example 1;

[0025] The bar graph at 0 h in the figure shows the expression level of LAL in the leaves of one-month-old wild-type Medicago truncatula R108 before treatment with 100 mM NaCl;

[0026] The bar graph at 3h in the figure shows the expression level of LAL in the leaves of one-month-old wild-type Medicago truncatula R108 3h after treatment with 100mMNaCl;

[0027] The bar graph at 6 h in the figure shows the expression level of LAL in the leaves of one-month-old wild-type Medicago truncatula R108 6 h after treatment with 100 mM NaCl;

[0028] The bar graph at 9 h in the figure shows the expression level of LAL in the leaves of one-month-old wild-type Medicago truncatula R108 9 h after treatment with 100 mM NaCl;

[0029] The bar graph at 12 h in the figure shows the expression level of LAL in the leaves of one-month-old wild-type Medicago truncatula R108 12 h after treatment with 100 mM NaCl;

[0030] The 24 h bar graph in the figure shows the expression level of LAL in the leaves of one-month-old wild-type Medicago truncatula R108 24 h after 100 mM NaCl treatment; three biological replicates; * indicates P < 0.05, 25 seedlings in each batch of plants;

[0031] Figure 2 The growth results of the salt-treated control WT wild type R108 and the Medicago truncatula mutant lal described in Example 1;

[0032] in, Figure 2 A shows the growth of the control WT wild type R108 and the Medicago truncatula mutant lal without salt treatment;

[0033] Figure 2 B shows the growth of the control WT wild type R108 and the Medicago truncatula mutant lal after 1 week of salt treatment;

[0034] Figure 2 C shows the growth of the control WT wild type R108 and the Medicago truncatula mutant lal after 3 weeks of salt treatment;

[0035] Figure 2 D is the growth of the control WT wild type R108 and the Medicago truncatula mutant lal after 4 weeks of salt treatment;

[0036] Figure 2 E is the survival rate of wild type WT and mutant lal after four weeks of salt treatment.

[0037] Figure 3 The expression results of MtLHCB1 in the wild type and Medicago truncatula mutant lal leaves detected by qRT-PCR in Example 1;

[0038] in, Figure 3A is the expression level of MtLHCB1.1 in leaves of wild type and lal mutant of Medicago truncatula;

[0039] Figure 3 B is the expression level of MtLHCB1.2 in leaves of wild type and lal mutant of Medicago truncatula;

[0040] Figure 3 C is the expression level of MtLHCB1.3 in leaves of wild type and lal mutant of Medicago truncatula;

[0041] Figure 3 D is the expression level of MtLHCB1.4 in leaves of wild type and lal mutant of Medicago truncatula;

[0042] Three biological replicates; * indicates P < 0.05, 25 seedlings per batch. DETAILED DESCRIPTION

[0043] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0044] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0045] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0046] Example 1

[0047] After more than a decade of research by scientists from many countries, Medicago truncatula has become a model plant for research on legume biology and genomics. Medicago truncatula is a diploid (2n=16) plant with self-pollination, a small genome, a short life cycle, and high genetic transformation efficiency, which is convenient for research. This example also uses Medicago truncatula as a research object to explore the salt tolerance-related mechanisms in alfalfa plants.

[0048] 1. Expression analysis of lncRNA LAL

[0049] (1) Cultivation of materials

[0050] The hard outer skin of Medicago truncatula R108 seeds was moderately polished with sandpaper to break the dormancy of the seeds. The seeds were cultured on moist filter paper at 4°C for about a week, and then the germinated seeds were moved to seedling trays and placed in an incubator for growth. The incubator environmental conditions were: long daylight (16h / 8h), temperature 23°C, 65% humidity, and light intensity 150mmol m -2 s -1 After growing in the seedling tray for about two weeks (when the first compound leaf is grown and unfolded), the plant is moved into a large pot and placed in a greenhouse for growth. The normal growth conditions in the greenhouse are: long daylight (16h / 8h), temperature 22℃~25℃, 60%-70% humidity, light intensity 150mmol m -2 s -1 When the seedlings were one month old, they were treated with 100 mM NaCl. After different treatment times, RNA was extracted from the seedling leaves using the Trizol method.

[0051] (2) RNA extraction

[0052] Preparation: RNase-free gun tip, RNase-free EP tube (2.0 mL, with steel ball; 1.5 mL), liquid nitrogen, 75% ethanol; the desktop and centrifuge and other instruments to be used are disinfected with 70% alcohol;

[0053] Preparation of DEPC water: Prepare 1000mL of DEPC-treated water, add 1mL of DEPC, dilute to 1000mL with ultrapure water, stir overnight with a magnetic stirrer. Then sterilize with high-pressure steam at 123℃ for 40min (DEPC is toxic, but decomposes into carbon dioxide and alcohol after sterilization), try to avoid contamination, and store at 4℃ or at room temperature for later use.

[0054] The main steps of extracting total RNA from leaves by TrizoLRT are as follows:

[0055] 1) Take a sample (≤100 mg) and put it into a 2 mL EP tube with steel balls, immediately put it into liquid nitrogen, and crush it with a grinder. The grinder parameters are: 25-30 Hz for 60 seconds;

[0056] 2) Add 1 mL TrizoLRT and vortex in a constant temperature mixer at 2000 rpm for 3 min;

[0057] 3) Add 400 μL DEPC water, vortex and shake in a constant temperature mixer at 2000 rpm for 3 min; let stand for 5 min, and centrifuge at 12000 rpm at room temperature for 15 min;

[0058] 4) Transfer the supernatant into a 1.5 mL EP tube (in duplicate, 600 uL / tube), add an equal volume of isopropanol, mix gently, let stand at room temperature for 15 min, centrifuge at 12000 rpm for 10 min at room temperature, and discard the supernatant;

[0059] 5) Add 800 μL 75% ethanol to wash the precipitate, gently flick the precipitate, and centrifuge at 4000 rpm for 3 min at room temperature; repeat the washing of the precipitate with 75% ethanol, pour off the supernatant, centrifuge instantly, and absorb as much alcohol as possible with the tip of a gun, then place it on a clean bench for 1 to 2 minutes until the edge is translucent and take it out.

[0060] 6) Add 50 μL DEPC water, flick gently, and place in a metal bath at 60°C for 10 min;

[0061] 7) Leave at room temperature for 2 minutes, then place on ice to measure the concentration.

[0062] (3) Reverse transcription to obtain cDNA and clone LAL

[0063] Reverse transcription kit: 5×All-In-One RT MasterMix (with AccuRT Genomic DNA Removal Kit)

[0064] 1) Place the extracted RNA and the frozen reagent in the reverse transcription kit on ice, centrifuge them immediately after they are dissolved, and collect the samples at the bottom of the tube. All the following steps are performed on ice;

[0065] 2) Place a 200 μL PCR tube without RNase on a 96-well ice plate. Generally, three biological replicates are performed, and the total volume of one reaction is 20 μL.

[0066] 3) First add reaction system 1 into the tube:

[0067]

[0068] 4) Place the above reaction system 1 into a PCR instrument and incubate at 42°C for 2 min. After the reaction is complete, place the tube on ice to cool;

[0069] 5) Add reaction system 2 into the tube:

[0070]

[0071] Denature the template and primer mixture to stop the reaction;

[0072] 6) Finally, add reaction system 3 into the tube:

[0073]

[0074] 7) Carefully mix the above system, centrifuge it at the bottom of the tube, and place it in a PCR instrument. The reaction procedure is as follows:

[0075]

[0076] After the reaction was completed, the product was stored in a -20°C refrigerator.

[0077] In this example, based on omics analysis, the sequence shown in SEQ ID NO: 2-3 was used as a primer and the total RNA extracted with TRIzol was used as a template for reverse transcription. The reverse transcription product was recovered by electrophoresis and then sequenced and analyzed to obtain the non-coding RNA LAL.

[0078] (4) Real-time fluorescence quantitative PCR

[0079] BIO-RAD real-time fluorescence quantitative PCR instrument; SYBR green Mix;

[0080] The primer sequences are as follows:

[0081] LAL-qF:GGTGTAGTTTTGGCTCAC (SEQ ID NO: 2);

[0082] LAL-qR:TCTTCGTTCAGGCCATTGTCA (SEQ ID NO:3);

[0083] MtUBQ-qF:CTGACAGCCCACTGAATTGTGA(SEQ ID NO:4);

[0084] MtUBQ-qR:TTTTGGCATTGCTGCAAGC (SEQ ID NO: 5).

[0085] cDNA was diluted to 15 ng / μL and used as a template; forward primer and reverse primer were mixed in advance, 2.5 μM ReaL-time PCR system (10 μL):

[0086] SYBR 5 μL

[0087] Primers 2μL

[0088] cDNA template 3 μL

[0089] Real-time PCR procedure:

[0090]

[0091] The relative expression was calculated according to Methods. Statistical analysis was performed using t-test; three biological replicates; * indicates P < 0.05, see Figure 1 .

[0092] Figure 1 Shown: qRT-PCR detection of the expression changes of LAL in Medicago truncatula WT in response to salt stress. Figure 1The experimental subjects were 30-day-old wild-type Medicago truncatula R108. The roots were treated with 100 mM NaCl solution for a period of time, and the content of lncRNA LAL in the leaves was measured. Figure 1 As a result, the content of lncRNA LAL in Medicago truncatula R108 first decreased and then increased with the increase of salt stress time, which means that lncRNA LAL is involved in the fine response of alfalfa plants to salt tolerance.

[0093] 2. Analysis of salt tolerance of Medicago truncatula mutant lal

[0094] In order to verify the above speculation, in this embodiment, the LAL mutant Medicago truncatula (hereinafter referred to as Medicago truncatula mutant lal) was used as the experimental object:

[0095] 25 seedlings of wild plant R108 and lal mutant of Medicago truncatula with consistent growth were selected, cultured for one month, and salt treatment was started. 50mM saline was applied in the first week, 100mM saline was applied in the second week, 150mM saline was applied in the third week, and 200mM saline was applied in the fourth week. The growth conditions of 0, 1, 2, 3, and 4 weeks after salt treatment were recorded. The survival rate was counted after the fourth week. The biological replicates were repeated three times, and the survival rate was counted. Three biological replicates; * indicates P < 0.05, and each batch of plants had 25 seedlings.

[0096] Figure 2 The results showed that during the four-week salt treatment, the leaves of the plants in both experimental groups turned yellow, and the wild type was more serious. In the fourth week, almost the entire plant was close to death, while the mutant lal of Medicago truncatula still had more than 70% green leaves and was in good growth condition. The above results show that the mutant lal of Medicago truncatula has improved salt tolerance compared with the wild type control.

[0097] 3. Analysis of MtLHCB1 expression in the Medicago truncatula mutant lal

[0098] The same method as in step 1 was used to detect the expression level of MtLHCB1 in the Medicago truncatula mutant lal. The primer sequences used in the real-time fluorescence quantitative PCR were as follows:

[0099] MtLHCB1.1-qF: CCTCTCGGTGAGGTGGTTGA (SEQ ID NO: 6);

[0100] MtLHCB1.1-qR:CCTTTCCAGTCACAATGGCT (SEQ ID NO:7);

[0101] MtLHCB1.2-qF:AGTTATCTTAATGGGCGCCGT (SEQ ID NO:8);

[0102] MtLHCB1.2-qR:GCGAGGTTCTCAATAGGTCCC (SEQ ID NO:9);

[0103] MtLHCB1.3-qF:AGCTATTGTAACCGGAAAAGGAC (SEQ ID NO: 10);

[0104] MtLHCB1.3-qR: TGGTGTAGTTTTGGCTCACTTT (SEQ ID NO: 11);

[0105] MtLHCB1.4-qF:CATTGGGCCTCGCTGACGAC (SEQ ID NO: 12);

[0106] MtLHCB1.4-qR: CGGGGTCAGCGATATGGTCG (SEQ ID NO: 13);

[0107] MtUBQ-qF:CTGACAGCCCACTGAATTGTGA (SEQ ID NO:14);

[0108] MtUBQ-qR:TTTTGGCATTGCTGCAAGC (SEQ ID NO: 15).

[0109] Test results such as Figure 3 As shown in the figure, the expression levels of MtLHCB1.1, MtLHCB1.2, and MtLHCB1.3 in the Medicago truncatula mutant lal were significantly higher than those in the wild type. This result may indicate that MtLHCB1 is involved in the salt tolerance of Medicago truncatula regulated by lncRNA LAL.

[0110] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A non-coding RNA LAL, characterized in that Its sequence is shown in SEQ ID NO:

1.

2. Application of non-coding RNA LAL in regulating salt tolerance of alfalfa.

3. The use according to claim 2, characterized in that: The specific form of the application is as follows: 1) Improve the salt tolerance of alfalfa plants by inhibiting the expression of non-coding RNA LAL; 2) Applying inhibitors of non-coding RNA LAL to prepare products that improve salt tolerance of alfalfa; 3) Screening salt-tolerant plants by detecting the content of non-coding RNA LAL; 4) The detection primers of non-coding RNA LAL were used to prepare a screening kit for salt-tolerant alfalfa.

4. The use according to claim 3, characterized in that: In aspect 1), the inhibition is performed by knocking out, silencing or mutating the corresponding sequences or sites in alfalfa.

5. The use according to claim 3, characterized in that: 2) In aspect, the inhibitor includes a recombinant vector or engineered bacteria for inhibiting, knocking out or silencing the expression of non-coding RNA LAL, and also includes an agent for inhibiting the expression of non-coding RNA LAL.

6. The use according to claim 5, characterized in that The recombinant vector is a gene editing recombinant vector based on the CRISPR system; the reagent is a chemical reagent that can inhibit the expression and synthesis of non-coding RNA LAL in plant tissues, including small molecule compound entities or nucleic acid substances.

7. The use according to claim 3, characterized in that: 3) The screening method described in aspect is a real-time fluorescence quantitative PCR detection method.

8. The use according to claim 3, characterized in that: 4) In aspect, the detection primer of the non-coding RNA LAL has a sequence as shown in SEQ ID NO: 2-3.

9. The use according to claim 3, characterized in that: The alfalfa is selected from any one of brown spotted alfalfa, sky blue alfalfa, small alfalfa, southern alfalfa, early flowering alfalfa, flower alfalfa, terrestris alfalfa, purple alfalfa, yellow alfalfa and wild alfalfa.

10. The use according to claim 3, characterized in that: Alfalfa.

Images