The promoter proMbU5 of banana and its application
By cloning the banana promoter proMbU5 and constructing a recombinant vector, the transformation problem in banana breeding was solved, efficient gene expression in rice was achieved, a new option for transgenic research in monocotyledonous plants was provided, and the gene silencing problem caused by the repeated use of promoters in existing technologies was overcome.
Patent Information
- Application Number
- CN202411147983.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-21
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-08-21
AI Technical Summary
In the existing technology, it is difficult to create high-yield, high-quality and highly stress-resistant banana varieties on a large scale through hybrid breeding. In addition, research on genetic transformation of bananas has been slow, especially due to the difficulties in tissue culture and genetic transformation, low transformation efficiency, prominent gene silencing problems caused by repeated use of the same promoter, and a lack of efficient promoter selection.
The banana promoter proMbU5 was cloned, and the recombinant vector pNC-121-pro-MbU5-GUS was constructed and transformed into rice by Agrobacterium tumefaciens. It was verified that it could efficiently promote GUS gene expression in monocotyledonous plants, providing a new choice of efficient promoters.
It achieved efficient gene expression in rice, solved the transformation problem in banana breeding, provided more promoter options, and improved the efficiency of transgenic research in monocotyledonous plants.
Smart Images

Figure CN119530221B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biology, and in particular to a banana promoter proMbU5 and applications thereof. Background Art
[0002] The principle of genetic modification is to introduce artificially isolated and modified high-quality genes into the genome of an organism, thereby achieving the desired transformation. The expression of the introduced genes causes heritable changes in the organism's traits. Transgenic plants contain foreign genes in their genomes, potentially altering certain genetic characteristics and enabling the development of new crop varieties characterized by high yield, high quality, and resistance to viruses, insects, cold, drought, flooding, salt, and herbicides. Since the first industrial application of genetically modified crops in 1996, global research and industrial application of transgenic technology have rapidly developed.
[0003] Banana cultivation in China has a long history, dating back over 2,000 years. With the continuous development of the banana industry, China has become the world's second-largest banana producer. Bananas are primarily grown in subtropical and tropical regions of my country, including Guangxi, Guangdong, Fujian, Yunnan, and Hainan. Bananas are an important tropical fruit, holding a crucial position in global trade.
[0004] Most cultivated bananas evolved from two wild species, M. acuminata and M. balbisiana, and their interspecific hybridization. Cultivated bananas can be classified into genotypes based on various traits, including AA, AAA, AB, AAB, ABB, AAAA, AAAB, AABB, BB, and BBB. Cavendish bananas are a subgroup of the AAA genotype, while Pisang awak bananas are a subgroup of the ABB genotype. Both are hybrid bananas of the genus Musa and have a distinctly different flavor and texture compared to the Brazilian banana (Musa acuminate L. AAA group cv. Cavendish, BX). They are nutritious, sweet, and sour, and ripen faster than the Brazilian banana. They are widely popular in both domestic and international markets and have broad application prospects. Because cultivated bananas are triploid and have low fertility, large-scale germplasm creation through hybrid breeding is difficult. Breeding high-yield, high-quality banana varieties with strong stress resistance and adaptability is key to breaking through the bottleneck of my country's banana industry development and presents a challenge and difficulty for Chinese banana breeders. The development of modern genetic engineering technology has provided a rapid and efficient means for breeding new banana varieties. Compared with other important food crops such as rice, corn, and wheat, research on genetic transformation of bananas has been slow. Banana is one of the most challenging tropical crops to tissue culture and genetically transform, making it difficult to obtain new varieties with strong adaptability and practical application. Agrobacterium-mediated genetic transformation is also significantly restricted by genotype, resulting in few successfully transformed banana varieties and low transformation efficiency.
[0005] In transgenic plant research, the promoter is a key factor influencing transgene expression efficiency. Therefore, selecting a highly efficient promoter is crucial for efficient exogenous gene expression. A promoter is a DNA sequence located upstream of the 5' end of a structural gene. It activates RNA polymerase, enabling accurate binding to the template DNA and providing specific transcription initiation. This sequence controls the timing and extent of gene expression, making it a crucial element in gene regulation. Promoters can be divided into three categories based on their transcriptional patterns: constitutive, inducible, and tissue-specific. Constitutive promoters are unaffected by external conditions, exhibiting no significant differences in gene expression across different tissues, organs, and developmental stages. The expression of the genes they activate is continuous, exhibiting no temporal or spatial specificity.
[0006] Currently, widely used constitutive promoters in plants include the tobacco mosaic virus (CaMV) 35S promoter, the ubiquitin promoter, and the actin promoter. The CaMV 35S promoter is commonly used in dicots, while the ubiquitin and actin promoters are commonly used in monocots. The ubiquitin promoter is one of the most studied promoters due to its high promoter efficiency, relatively low methylation level, and stable genetic traits. Ubiquitin promoters from several plants, such as maize, rice, and millet, have been cloned. The maize ubiquitin Ubi-1 promoter has been widely used in monocots such as maize, foxtail grass, wheat, and rice. The rice ubiquitin RUBQ2 promoter has also been widely used in rice and sugarcane.
[0007] In transgenic plants, the need to co-express multiple transgenes regulating the same trait often necessitates the reuse of a single promoter to drive expression of multiple transgenes. However, the reuse of multiple promoters containing sequences sharing a high level of sequence identity can lead to homology-based gene silencing. Therefore, each gene generally requires a separate promoter for gene expression, necessitating the use of multiple promoters in transgenic plants.
[0008] Therefore, cloning more promoters that can be efficiently expressed in plants is very necessary to provide more promoter options for the development of transgenic plant biotechnology breeding. In addition, in transgenic plant biotechnology, using promoters from the plant itself or from closely related species may have a higher efficiency in initiating the expression of foreign genes. Summary of the Invention
[0009] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a banana promoter proMbU5 and its application.
[0010] To achieve the above purpose, the technical solution designed by the present invention is as follows:
[0011] The present invention provides a banana promoter proMbU5, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0012] The method for preparing the above-mentioned promoter proMbU5 is as follows: the nucleotide sequence of the promoter proMbU5 is respectively designed with a PCR amplification primer pair proMbU5F / R; banana genomic DNA is used as a template and the designed PCR primer pair is used for amplification to obtain the promoter proMbU5.
[0013] Furthermore, the primer pair proMbU5F / R is as follows:
[0014] Forward primer proMbU5F: GAGGAACTTAGATTTTAGTAAG,
[0015] Reverse primer proMbU5R: CTTCGCCTTTTCCCTTCCTTGCC.
[0016] The present invention also provides a recombinant vector, which is a vector containing the above-mentioned promoter proMbU5.
[0017] Furthermore, the vector is a plant expression vector pNC-121-pro.
[0018] The present invention also provides a host cell containing the above-mentioned recombinant expression vector, characterized in that: the host cell is Agrobacterium AGL1.
[0019] The present invention also provides an application of the above-mentioned promoter proMbU5 in regulating the efficient expression of plant genes.
[0020] The present invention also provides a method for regulating the efficient expression of plant genes, which comprises transforming the above-mentioned promoter into plant callus tissue.
[0021] Use of any one of the following in breeding new varieties of monocotyledonous plants, wherein it includes:
[0022] (1) the aforementioned promoter proMbU5;
[0023] (2) the above-mentioned recombinant vector;
[0024] (3) The above-mentioned host cells.
[0025] Furthermore, the monocotyledonous plant is rice or banana (preferably banana).
[0026] Beneficial effects of the present invention:
[0027] The present invention searches for a Ubiquitin gene from a banana plant in a database, designs primers based on the nucleotide sequence within 2000 base pairs upstream, and uses PCR to amplify the Ubiquitin gene's promoter, named proMbU5. A plant expression vector containing the GUS reporter gene is then constructed. The promoter is then transformed into rice plants using the Agrobacterium method. GUS staining experiments on transformed seedlings demonstrate that the proMbU5 promoter has strong promoter efficiency and can effectively promote GUS gene expression in rice. Rice is a model plant for C3 crops among monocots. The proMbU5 promoter can provide a new and efficient promoter option for transgenic research in monocots, and has applications in a wider range of monocot transgenic technologies. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 is the electropherogram of the PCR clone of the promoter proMbU5;
[0029] In the figure, lane 1 is the PCR amplification product of promoter proMbU5;
[0030] Lane 2 is DL2000 Marker, with molecular weights from top to bottom being 2000 bp, 1000 bp, 750 bp, 250 bp, and 100 bp;
[0031] Figure 2 is a schematic diagram of the plant expression vector pNC121proMbU5-GUS;
[0032] Figure 3 Schematic diagram of GUS staining identification of transgenic rice plants containing the proMbU5-GUS exogenous gene;
[0033] In the figure, proMbU5OE1-OE6 are the GUS staining results of six different transgenic rice lines, and WT is the GUS staining control of Zhonghua 11 wild-type rice.
[0034] Figure 4 The PCR identification results of 1-6 transgenic rice lines are shown in the figure.
[0035] In the figure, 1-18 are the amplification results of leaf DNA from 1 to 6 different transgenic rice lines, respectively. Each line was repeated three times. K- is the wild-type control, K1 is the DNA extraction blank control, and K2 is the ddH2O control.
[0036] A is the PCR amplification map of promoter proMbU5;
[0037] B is the PCR amplification map of NPTⅡ gene;
[0038] C is the PCR amplification map of NOS terminator;
[0039] D is the PCR amplification map of NOS promoter;
[0040] E is the PCR amplification map of GUS gene. DETAILED DESCRIPTION
[0041] The present invention is further described in detail below with reference to specific embodiments so that those skilled in the art can understand.
[0042] In the following examples, the relevant culture medium formula used is as follows:
[0043] 1.LB: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L;
[0044] 2. Callus induction medium: MS dry powder 4.4 g / L, sucrose 30.0 g / L, casamino acid 0.3 g / L, L-proline 2.8 g / L, 2,4-D 0.002 g / L, plant gel 3.0 g / L, pH 5.8;
[0045] 3. Rice infection solution AAM: MgSO4·7H2O 0.25g / L, CaCl2·2H2O0.15g / L, NaH2PO4·2H2O0.15g / L, KCl 3.0g / L, MnSO4·4H2O 0.01g / L, ZnSO4·7H2O 0.002g / L, CuSO4·5H2O0.000025g / L, CoCl2·6H2O0.000025g / L, KI 0.00075g / L, H3B3O 0.003g / L, Na2MoO4·2H2O0.00025g / L, Na2EDTA0.0373g / L, FeSO4·7H2O 0.0278g / L, L-Casaminoacid 0.5g / L, Glycine 0.0075g / L, L-Arginine 0.1767g / L, L-Glutamine 0.9g / L, L-Asparticacid 0.3g / L, myo-Inositol 0.1g / L, Nicotinicacid 0.001g / L, PyridoxineHCl 0.001g / L, ThiamineHCl0.01g / L, Sucrose 68.5g / L, Glucose 36.0g / L, Acetosyringone 0.04g / L, 0.1% Synperonic, pH5.2;
[0046] 4. Rice co-cultivation solution: N6 dry powder 4.0 g / L, Sucrose 30.0 g / L, Glucose 10.0 g / L, Casaminoacid 0.3 g / L, 2,4-D 0.002 g / L, Acetosyringone 0.04 g / L, pH 5.2.
[0047] 5. Rice screening medium: MS dry powder 4.4 g / L, Sucrose 30.0 g / L, Casaminoacid 0.3 g / L, L-Proline 2.8 g / L, 2,4-D 0.002 g / L, Timentin 0.3 g / L, Hygromycin 0.05 g / L, Gelzan 3.0 g / L, pH 5.8.
[0048] 6. Rice predifferentiation medium: MS dry powder 4.4 g / L, Sucrose 30.0 g / L, Casaminoacid 0.5 g / L, L-Proline 0.5 g / L, NAA 0.001 g / L, 6-BA 0.002 g / L, ABA 0.005 g / L, Timentin 0.3 g / L, Hygromycin 0.05 g / L, Gelzan 4.0 g / L, pH 5.8.
[0049] 7. Rice differentiation medium: MS dry powder 4.4 g / L, Sucrose 30.0 g / L, Casaminoacid 0.5 g / L, NAA 0.0006 g / L, 6-BA 0.0036 g / L, Timentin 0.3 g / L, Hygromycin 0.03 g / L, Gelzan 4.0 g / L, pH 5.8.
[0050] 8. Rice rooting medium: MS dry powder 2.2 g / L, Sucrose 20.0 g / L, Timentin 0.3 g / L, Hygromycin 0.03 g / L, Gelzan 4.0 g / L, pH 5.8.
[0051] 9. GUS staining solution:
[0052] 1) X-Gluc stock solution: X-Gluc was prepared into a 20 mM stock solution using N-dimethylformamide;
[0053] 2) X-Gluc base solution (pH7.0): NaH2PO4 50mM; Na2HPO4 50mM; Na2EDTA10mM, Triton-1000.1%, K3[Fe4(CN)6]0.5mM, K4[Fe(CN)6]0.5mM;
[0054] 3) Mix the X-Gluc mother solution and X-Gluc base solution in a ratio of 1:9 to obtain the GUS staining solution.
[0055] Example 1 Cloning of promoter proMbU5
[0056] The nucleotide sequence within 2000 bp upstream of the start codon ATG was found from the banana genome database. Promoter prediction analysis was performed using TSSP in the online prediction software Softberry. Bchr05 2808875-28108754 was selected for promoter cloning. The promoters were named proMbU5, and primers proMbU5F / R were designed. The sequences of primers proMbU5F / R are as follows:
[0057] Forward primer proMbU5F: GAGGAACTTAGATTTTAGTAAG,
[0058] Reverse primer proMbU5R: CTTCGCCTTTTCCCTTCCTTGCC.
[0059] Genomic DNA from Hiro-1 leaves was extracted using a plant genomic DNA extraction kit and used as a template for PCR amplification using high-fidelity Primestar enzyme.
[0060] The PCR system is as follows: 9.5 μL of sterile water, 1 μL of each primer (10 μM),
[0061] Primestar Mix 12.5 μL, DNA template 1 μL.
[0062] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 10 s, annealing at 56°C for 15 s, and extension at 72°C for 15 s for 33 cycles; and final extension at 72°C for 7 min.
[0063] The PCR amplification products were separated by 2% agarose gel electrophoresis to obtain a band of approximately 2000 bp ( Figure 1 ), and purified and recovered using an agarose gel recovery kit. The recovered product was sent to a sequencing company for full sequence sequencing; thus, the promoter proMbU5 was obtained, whose nucleotide sequence is shown in SEQ ID NO: 1.
[0064] Example 2 Construction of vector and Agrobacterium
[0065] 1. Construction of recombinant plant expression vector
[0066] a. Select the plant expression vector pNC-121-pro ( Figure 2 ) as the backbone vector for vector transformation. The bacterial selection resistance gene in this vector is the kanamycin resistance gene (kanR), and the plant resistance selection gene is the neomycin phosphotransferase gene (NPTⅡ). Both pNC-121-pro vectors contain the NC cloning cassette for cloning reactions and the ccdB lethal gene, requiring the use of E. coli DB3.1 strain.
[0067] b. Insert the target promoter into the NC cloning frame using Nimble cloning (after the Nimble cloning reaction, the target gene replaces the NC cloning frame, and the recombinant plasmid can grow in common bacterial strains (DH5α and Top10 are recommended)). Verify the activity of the proMbU5 promoter by initiating the GUS reporter gene. Add the proMbU5 PCR product and the empty pNC-121-pro vector according to the Nimble Cloning kit instructions. Add Nimble Cloning Mix and translate at 50°C for one hour. Transform the ligated product into E. coli DH5α and culture overnight at 37°C in LB medium containing kanamycin. Pick a single colony and culture it at 37°C with shaking overnight.
[0068] c. Perform PCR on the bacterial culture using the primer pair proMbU5-NC-F / R to screen for positive clones. The primer pair proMbU5-NC-F / R is as follows:
[0069] Forward primer proMbU5-NC-F:
[0070] agtggtctctgtccagtcctGAGGAACTTAGATTTTAGTAAG,
[0071] Reverse primer proMbU5-NC-R:
[0072] ggtctcagcagaccacaagtCTTCGCCTTTTCCCCTTCCTTGCC;
[0073] The enzyme used in PCR detection is ordinary TaqMix, and the reaction system is:
[0074] 9.5 μL of sterile water, 1 μL of each primer (10 μM), 12.5 μL of TaqMix, and 1 μL of bacterial liquid template.
[0075] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 10 s, annealing at 56°C for 15 s, and extension at 72°C for 15 s for 33 cycles; and final extension at 72°C for 7 min.
[0076] The PCR amplification products were separated by 2% agarose gel electrophoresis, yielding a band approximately 2000 bp in size. Based on the results of the bacterial PCR assay, several positive clones were selected and sent to a sequencing company for sequence analysis. Sequencing results revealed that the proMbU5 promoter is 2021 bp in size, consistent with the sequence shown in SEQ ID NO. 1 in the sequence listing, confirming successful construction of the recombinant plasmid. The constructed recombinant plant expression vectors were named pNC-121-pro-MbU5-GUS.
[0077] 2. Transformation of Agrobacterium with the recombinant expression vector pNC-121-pro-MbU5-GUS
[0078] Positive pNC-121-pro-MbU5-GUS bacterial cultures were cultured with shaking at 37°C overnight. 2 mL of the culture was collected and the plasmid pNC-121-pro-MbU5-GUS was extracted using a plasmid extraction kit. The plasmid pNC-121-pro-MbU5-GUS was transformed into Agrobacterium tumefaciens AGL1 using the liquid nitrogen freeze-thaw method to obtain AGL1 strains containing the plasmid (i.e., pNC-121-pro-MbU5-GUS / AGL1). The culture was stored in glycerol at -80°C until use.
[0079] Example 3 Functional verification of promoter proMbU5 in rice
[0080] Using mature seeds of rice variety Zhonghua 11 as explants, callus was induced, Agrobacterium was transformed, and GUS staining of the regenerated plants was used to verify the function and efficiency of the proMbU5 promoter in initiating gene expression. The specific steps include:
[0081] 1) Induction of rice callus
[0082] Mature seeds of Zhonghua 11 were shelled, soaked in 75% ethanol for 30 seconds, washed three times with sterile water, disinfected with 2% sodium hypochlorite solution for 20 minutes, shaken at 100 rpm on a shaker, and washed more than five times with sterile water. The seeds were dried on filter paper and placed on rice callus induction medium. After incubation at 29°C in the dark for 30-45 days, naturally dispersed, bright yellow callus tissue was picked and inoculated on new rice callus induction medium and pre-incubated at 29°C for 3-5 days.
[0083] 2) Preparation of Agrobacterium tumefaciens culture solution
[0084] Streak the pNC-121-pro-MbU5-GUS / AGL1 culture stored at -80°C onto LB plates containing carbenicillin and kanamycin. Culture at 28°C for 2-4 days to isolate single colonies. Pick 3-5 colonies and incubate them in LB medium containing carbenicillin and kanamycin at 28°C with shaking until the OD600 reaches 0.5-1.0.
[0085] 3) Infection and co-culture
[0086] a. Centrifuge the cultured pNC-121-pro-MbU5-GUS / AGL1 bacterial suspension at 5000 rpm for 10 min, discard the culture medium, collect the bacteria, add infection solution containing 0.04 g / L acetosyringone (Acetosyringone, Ace) and 0.1% poloxamer (Synperonic, Syn), shake well, and adjust the OD600 to 0.5.
[0087] b. Activate the above infection solution at 20°C, 100 rpm for 2-3 hours. Collect the pre-cultured rice calli into a 50 mL sterile centrifuge tube, add the activated bacterial solution, and infect at 20°C, 100 rpm for 1 hour.
[0088] c. After infection, discard the bacterial solution and place the callus on a sterile Petri dish containing multiple layers of filter paper. Spread the callus to dry the bacterial solution. Simultaneously, place 6 layers of filter paper in a new sterile Petri dish and add 5-6 mL of co-culture solution containing 0.04 g / L of Lace. Transfer the dried callus to this dish and spread it flat on the filter paper. Seal the dish with parafilm and incubate in the dark at 20°C for 5-7 days.
[0089] 4) Washing and screening
[0090] After co-cultivation, callus particles were collected into a 50 mL sterile centrifuge tube and washed with sterile water for more than five times until the distilled water was clear. Finally, sterile water containing 0.3 g / L Timentin (Tim) was added and the tubes were soaked at room temperature at 100 rpm for 30 minutes. After soaking, the water was poured out and the callus was poured into a sterile culture dish containing multiple layers of filter paper. The callus was spread out to dry. The dried callus was inoculated onto MSD screening medium containing 0.3 g / L Temin and kanamycin, with approximately 20-30 calli per dish. The tubes were cultured in the dark at 29°C and subcultured every two weeks until fresh, tender yellow resistant callus grew.
[0091] 5) Differentiation and rooting
[0092] Transfer the resistant calli from the screening medium to the pre-differentiation medium and culture in the dark at 29°C for one week. Select the resistant calli without browning and death from the pre-differentiation medium and transfer them to the differentiation medium and culture them at 29°C with 14h light and 10h dark for 30-35 days. Usually, the calli begin to turn green after one week and young shoots begin to grow after three weeks. Pick out the seedlings from the differentiation medium and inoculate them into the rooting medium at 29°C with 14h light and 10h dark for 10-20 days (the growth time is determined by the size of the seedlings). After rooting is completed, open the lid of the culture bottle, add a small amount of tap water, and continue to culture at room temperature for 2-3 days. Then take out the regenerated plants, wash off the culture medium with water, trim the roots and leaves, and transplant them to the greenhouse.
[0093] 6) GUS staining of transgenic plants
[0094] Prepare the base and stock solutions of GUS staining solution as standard and mix them in the correct proportions immediately before use. Place pNC-121-pro-MbU5-GUS transgenic plants into a 50 mL centrifuge tube, add the GUS staining solution, and stain at 37°C in the dark for 24 hours. Use wild seedlings of Zhonghua 11 as a negative control. After staining, discard the GUS staining solution and decolorize the regenerated plants with 75% ethanol 3-5 times, then 95% ethanol 1-2 times. Observe the staining of the regenerated plants.
[0095] The staining results showed that the roots, stems and leaves of the pNC-121-pro-MbU5-GUS transgenic plants all showed a darker blue color, while the wild-type Zhonghua 11 seedlings showed no blue at all ( Figure 3 ); This indicates that the pro-MbU5 promoter has the function of initiating GUS gene expression in rice.
[0096] 7) PCR identification of transgenic plants
[0097] Leaves from pro-MbU5 transgenic plants were collected and genomic DNA was extracted using a plant genomic DNA extraction kit. Using this DNA as a template, PCR was performed to detect the pro-MbU5 promoter, NPTⅡ, NOS promoter, NOS terminator, and GUS gene in the pro-MbU5 transgenic plants. Wild-type Zhonghua 11 genomic DNA was used as a negative control, the pNC-121-pro-MbU5-GUS plasmid was used as a positive control, and sterile water was used as a blank control. The primers for the detection are shown in Table 1.
[0098] The enzyme used in PCR detection is ordinary TaqMix, and the reaction system is:
[0099] 9.5 μL of sterile water, 1 μL of each primer (10 μM), 12.5 μL of TaqMix, and 1 μL of DNA template.
[0100] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; and finally extension at 72°C for 7 min.
[0101] The PCR amplification products were separated and detected by 2% agarose gel electrophoresis. The results showed that the pro-MbU5 promoter, NPTⅡ, NOS promoter, NOS terminator and GUS gene could be amplified in the pro-MbU5 transgenic plants. Figure 4 ).
[0102] In summary, GUS staining experiments in transformed seedlings demonstrate that the proMbU5 promoter has strong promoter efficiency and can effectively drive GUS gene expression in rice. Rice is a model plant for C3 crops among monocots. The proMbU5 promoter may provide a new and efficient promoter option for transgenic research in monocots, potentially enabling its application in a wider range of monocot transgenic technologies.
[0103] Table 1 Primers for detection of pro-MbU5 transgenic plants
[0104]
[0105] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without inventiveness, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A banana promoter proMbU5 , characterized in that: The promoter proMbU5 The nucleotide sequence is shown in SEQ ID NO:
1.
2. A method for preparing the promoter according to claim 1 proMbU5 The method is characterized in that This method is the promoter proMbU5 The nucleotide sequence of the promoter was used to design the PCR amplification primer pair proMbU5F / R; the genomic DNA of banana was used as a template and the designed PCR primer pair was used to amplify the promoter. proMbU5 .
3. A recombinant vector, characterized in that: The recombinant vector contains the promoter according to claim 1 proMbU5 carrier.
4. The recombinant vector according to claim 3, characterized in that: The vector is a plant expression vector pNC-121-pro.
5. A host cell containing the recombinant vector according to claim 3, characterized in that: The host cell is Agrobacterium AGL1.
6. Use of any one of the following in breeding new varieties of monocotyledonous plants, characterized in that: It includes: (1) The promoter according to claim 1 proMbU5 ; (2) The recombinant vector according to claim 3; (3) The host cell according to claim 5; Wherein, the monocotyledonous plant is rice or banana.
Citation Information
Patent Citations
A promoter for ubiquitous gene expression in monocotyledones and use thereof
KR1020150043969A
Banana promoters
TW201142029A