Vector skeleton, test plasmid as well as construction method and application of test plasmid

Abstract

The invention discloses a vector skeleton and a construction method thereof. The invention also discloses a test plasmid and a construction method thereof. According to the invention, the autonomous replication and stable existence characteristics of the additional body and the efficient integration capability of the Piggybac transposition subsystem complement each other. The additional body provides more exogenous gene copies, the transposon system ensures that the copies can be accurately and efficiently integrated into a host genome, and the additional body and the transposon system have a synergistic effect, so that the success rate and the efficiency of exogenous gene integration are greatly improved, some limitations existing in a traditional gene integration method are overcome, and the method is suitable for large-scale popularization and application. The integration efficiency is low; the gene expression is unstable, and the like. The mutation efficiency is high and can reach 65% at most, and the mutation frequency is stable.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a vector skeleton, a test plasmid, and a construction method and application thereof. Background Art

[0002] The transposon system, also known as jumping genes, is a type of DNA sequence that can insert and excise within the genome and change its position. According to the different transposition methods, transposons can be divided into two categories: DNA transposons and retrotransposons. DNA transposons follow the "excision-paste" mechanism, while retrotransposons use the "copy-paste" mechanism for transposition. The diversity and function of transposons make them an important tool for genome research, molecular genetics and bioengineering.

[0003] The PiggyBac (PB) transposon system is a mobile genetic element belonging to the DNA transposon family, which was first used in Trichoplusia ni ( Hyloicus pinastri ), and the "Piggy" in its name comes from this moth. As an efficient transposition system, PB transposons transpose between vectors and chromosomes through a "cut and paste" mechanism. In this process, the PB transposase can recognize specific inverted terminal repeats (ITRs) located at both ends of the transposon vector, and effectively move the content between these sequences from the original site, and then accurately integrate into the TTAA site of the host genome. This powerful transposition activity allows the target gene between the two ITRs in the PB vector to be easily transferred to the target genome, providing a powerful tool for gene therapy and functional research. Most studies on PB transposons separate the PB transposon module from the transposase, insert the target gene to be transposed between the repeat sequences at both ends of the transposon, and express the transposase on another vector, which can efficiently induce the transposase to regulate the transposon for transposition.

[0004] Currently, the randomness of the integration sites of the Piggybac transposon system may lead to uncertainty in gene expression and differences in integration efficiency in different cell types. In some highly differentiated cell types, due to the influence of chromatin structure and epigenetic modifications, its integration efficiency is low, which limits its wide application in genetic engineering. Summary of the invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a vector skeleton and a method for constructing the same. The vector skeleton of the present invention comprises an episome and a PB transposon, wherein the episome is a genetic element that can replicate autonomously in a cell independently of a chromosome. Combining the episome with the PB transposon system is expected to overcome the shortcomings of the PB transposon system when used alone, improve the integration efficiency and expression stability of exogenous genes, and provide a more effective tool for genome research, molecular genetics and bioengineering.

[0006] The technical problem that the present invention needs to solve is to provide a test plasmid and a construction method thereof.

[0007] The technical problem that the present invention needs to solve is to provide the application of the carrier skeleton and the test plasmid in the preparation of diagnostic standard products.

[0008] Technical solution: In order to solve the above problems, the present invention provides a vector backbone, which includes a 5'-end inverted terminal repeat sequence, a screening marker 1 for screening and identification, a promoter sequence, a sequence for transcription termination, a screening marker 2 for subsequent selection or visualization of transformed cells, a 3'-end inverted terminal repeat sequence, an episome sequence, a resistance gene sequence and a gene sequence of the piggyBac transposon of the pUC replication origin, wherein the episome is the OriP and EBNA1 genes.

[0009] Among them, the screening marker 1 includes a visual detection gene, the promoter includes a CAG promoter, the sequence for transcription termination includes a rabbit β-globin polyadenylation signal sequence, and the screening marker 2 includes one or more of the drug screening markers puromycin, geneticin or hygromycin.

[0010] Wherein, the resistance gene includes an ampicillin resistance gene.

[0011] The present invention also includes a test plasmid, which includes the vector backbone.

[0012] Wherein, the test plasmid also includes a mutant sequence.

[0013] The present invention also includes a method for episome binding to piggyBac transposon, comprising the following steps: 1) PCR amplification to obtain the target sequence; 2) Construct the vector skeleton.

[0014] The present invention also includes a method for constructing a test plasmid, which comprises introducing a mutant sequence into the vector backbone.

[0015] Wherein, the mutant sequence is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following advantages: the autonomous replication and stable existence characteristics of the episome of the present invention complement the efficient integration ability of the Piggybac transposon system. The episome provides more copies of exogenous genes, while the transposon system ensures that these copies can be accurately and efficiently integrated into the host genome. The synergistic effect of the two greatly improves the success rate and efficiency of exogenous gene integration, and overcomes some limitations of traditional gene integration methods, such as low integration efficiency and unstable gene expression. This combination of the present invention can also expand the scope of application of gene integration technology. For example, in different types of cells or organisms, the performance of the episome and the Piggybac transposon system may be different, but after combination, efficient exogenous gene integration can be achieved in a wider range of cell types and species, providing a more universal and effective technical means for gene therapy, the establishment of transgenic animal models and other genetic engineering applications, and further reflecting its value in improving integration efficiency. The mutation efficiency of the present invention is high, up to 65%, and the mutation frequency of the present invention is stable. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The electrophoresis diagram of the cloned target sequence product obtained by PCR in Example 1; Figure 2 This is a graph showing the mutation frequency results of the episome plus the PB transposon in Example 1; Figure 3 This is a result diagram of mutation frequency containing only PB transposon in Example 1; Figure 4 This is a result diagram of mutation frequency containing only episomes in Example 1; Figure 5 To construct a vector backbone map containing pure PB transposon plus mutant sequence 1; Figure 6 To construct a vector backbone map containing pure episome plus mutant sequence 1; Figure 7 The backbone map for constructing a vector containing episome, PB transposon and mutant sequence 1. DETAILED DESCRIPTION

[0018] Introduction to each element of the carrier map in the embodiment of the present invention: 5' ITR: 5' inverted terminal repeat. When a DNA sequence is surrounded by two ITRs, the PiggyBac transposon is able to recognize them and insert the surrounded region (including the two ITRs) into the host genome.

[0019] Screening Marker 1: A visually detectable gene (such as EGFP) whose fluorescence can be used to screen and identify successfully transfected or transformed cells.

[0020] CAG promoter: The CAG promoter is an artificially constructed combined promoter composed of the cytomegalovirus early enhancer and the chicken β-actin promoter, which is used to drive the widespread expression of downstream marker genes.

[0021] rBG pA: rabbit β-globin polyadenylation signal, which facilitates transcription termination of the upstream ORF.

[0022] Selection marker 2: Drug selection markers (such as Puromycin (Puro), Geneticin (Neo), Hygromycin (Hygro)), which allow cells transduced with the vector to be selected or visualized.

[0023] 3' ITR: 3' inverted terminal repeat.

[0024] OriP: OriP is a specific region in the Epstein-Barr virus (EBV) genome. As the replication origin, it plays a core role in the latent replication and genome maintenance of EBV. It is composed of family repeat (FR) elements and disymmetric (DS) elements, which together coordinate the replication process of viral DNA.

[0025] EBNA1: EBNA1 is a key nuclear protein encoded by EBV. It plays a vital role in the latent and lytic replication stages of the virus. It maintains and replicates the EBV genome by directly binding to the OriP region. During lytic replication, EBNA1 is redistributed to specific nuclear replication areas and participates in the replication process of newly synthesized viral DNA together with viral replication proteins.

[0026] AmpiciIIin: ampicillin resistance gene.

[0027] pUC ori: pUC origin of replication. Plasmids carrying this origin exist in high copy numbers in E. coli. Example 1

[0028] 1. Vector backbone construction and test plasmid preparation Construction of transposon vector: Construction of the vector backbone of the PiggyBac transposon containing EBNA1 and orip (episome).

[0029] 1) PCR to obtain the cloned target sequence The reaction system VB163 plasmid (Suzhou Haixing Biotechnology Co., Ltd., as shown in SEQ ID NO.3), including the upstream primer G54663-1F and downstream primer G54663-1R shown in Table 3, Q5® ultra-fidelity DNA polymerase (NEB product number M0491V, 2,000 U / mL), 5*Q5 buffer, 10mM dNTP and ddH2O, the reaction system is as shown in Table 1, and then amplification is performed according to the set reaction conditions, the reaction conditions include 95°C pre-denaturation, 95°C denaturation, 60°C annealing and 72°C extension steps, and the specific conditions are shown in Table 2.

[0030] Table 1 Reaction system

[0031] Table 2 PCR reaction conditions

[0032] Table 3 Specific primer sequences

[0033] Perform electrophoresis analysis on the PCR products, verify the product bands, and then perform gel tapping and recovery to verify the product bands. If the conditions of "unique and clear bands" are met, the requirements are met. Perform gel tapping and recovery on the PCR products that meet the requirements (refer to the Axygen product manual), and use the recovered PCR products for the next connection experiment. The results are shown in Figure 1 .

[0034] The circular empty plasmid VB158 (Suzhou Haixing Biotechnology Co., Ltd., shown in SEQ ID NO.4) was mixed with restriction endonucleases and digested at 37°C for 60 minutes to obtain a linearized plasmid; the digestion system is shown in Table 4.

[0035] Table 4 Enzyme digestion system

[0036] The PCR product recovered from gel excision was mixed with the linearized plasmid, and the recombinase ClonExpress II (Nanjing Novozymes Biotech Co., Ltd., Catalog No. C112-01) was added for ligation reaction. The reaction was incubated at 52°C in a water bath for 40 min. The transformation was allowed to stand for 5 min to lower the temperature. The ligation system is shown in Table 5.

[0037] Table 5 Connection system

[0038] The ligation product was transferred into competent cells, placed on ice for 10 minutes, heat-shocked at 42°C for 90 seconds, and immediately placed on ice for 3 minutes. 800 µL of antibody-free LB medium was added for culturing for 1 hour. The cultured samples were centrifuged to remove part of the supernatant, and the remaining mixture was spread on a culture dish and inverted for overnight culturing to screen positive clones. Finally, a single colony was picked and 2×Phanta Max MasterMix (Nanjing Novozyme Biotech Co., Ltd., Catalog No. P515-01) was added for colony PCR. The reaction system of colony PCR is shown in Table 6, and the reaction conditions are shown in Table 7.

[0039] Table 6 Colony PCR reaction system

[0040] Table 7 Reaction conditions

[0041] After positive clones were identified by electrophoresis, plasmids were extracted and sequenced for verification, and then sent to Cellfy Biotechnology Co., Ltd. for Sanger sequencing. The resulting plasmid restriction bands were correct, and the sequencing results showed that the sequence (shown in SEQ ID NO.5) was 100% correct, and the PB vector backbone containing the episome was obtained.

[0042] The mutation sites on the reference sequence were determined, and mutant sequences 1 and 2 were synthesized. Mutation sequences 1 and 2 were cloned into the PB vector backbone containing the episome, the PB vector backbone (VB163 plasmid, shown in SEQ ID NO.3), and the episome vector backbone (VB158 plasmid, shown in SEQ ID NO.4), respectively, to form test plasmids and control plasmids (this process was sent to Saisuofei Biotechnology Co., Ltd. for completion). Specifically, mutation sequences 1 and 2 were cloned into the restriction sites of the PB vector backbone between BamHI and SmaⅠ to obtain control plasmids 1 and 2; mutation sequences 1 and 2 were cloned into the restriction sites of the episome vector backbone between BamHI and EcoRI to obtain control plasmids 3 and 4; mutation sequences 1 and 2 were cloned into the restriction sites of the PB vector backbone containing the episome at BamHI to obtain test plasmids 1 and 2. The obtained plasmids were subjected to large-scale extraction of transfection-grade low-endotoxin nucleic acids.

[0043] Mutation sequence 1 (shown in SEQ ID NO.1): AAGGTGAGTTTGTATTAAAAGGTACTGGTGGAGTATTTGATAGTGTATTAACCTTATGTGTGACATGTTCTAATATAGTCACATTTTCATTATTTTTATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGC TGtcGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGTGCAGGACCATTCTTTGATACAGATAAAGGTTTCTCTGA Mutation sequence 2 (shown in SEQ ID NO.2): AAGGTGAGTTTGTATTAAAAGGTACTGGTGGAGTATTTGATAGTGTATTAACCTTATGTGTGACATGTTCTAATATAGTCACATTTTCATTATTTTTATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGC TGaaGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGTGCAGGACCATTCTTTGATACAGATAAAGGTTTCTCTGA 2. Cell treatment and electroporation HEK293T cells growing in logarithmic phase were digested and centrifuged to remove supernatant. The cells were resuspended in PBS and counted. 1×10 6cells to EP tubes and centrifuge to obtain cell pellets. Resuspend the cells in electroporation buffer (Opti-MEM™ I, Thermo Fisher Scientific, Catalog No. 31985-070) and add plasmids (test plasmid 1 or test plasmid 2: PBase plasmid (Suzhou Haixing Biotechnology Co., Ltd. PUF07) at 2:1) and mix thoroughly. Enter the optimal electroporation parameter 480 V for electroporation, and electroporate the EGFP plasmid (Suzhou Haixing Biotechnology Co., Ltd., Catalog No. PUC01) as a control group under the same parameters. Transfer the electroporated cells to high-glucose DMEM (DMEM-H) medium containing 10% fetal bovine serum (FBS) for culture. Observe the cell state after 24 hours, and judge the electroporation efficiency based on the EGFP control group. After 48 hours, use a drug screening concentration of Puro (puromycin) 4.0 ug / mL, and the drug screening cycle is 3 days. After the drug screening is completed, remove the drug-containing medium and replace it with fresh medium. Culture for 24-48 hours to restore the cell state.

[0044] 3. Mutation detection and integration efficiency assessment First, the cells were passaged for 1, 3, 5, 9, 12, 15, and 18 generations, and DNA was extracted for subsequent experiments. Animal tissue DNA kit (Hangzhou Xinjing Biological Reagent Development Co., Ltd., Cat. No. 3101050) was used to process animal tissue samples. Sample processing was carried out according to the instructions of the SIMGEN Animal Tissue DNA Kit. After DNA extraction, the sample concentration was detected and recorded using Nano-400A, and the sample was diluted to 50 ng / μl.

[0045] Next, primers were designed and synthesized upstream and downstream of the mutation site on the NCBI website. After design and synthesis, an order was placed with Anshengda Biotechnology Co., Ltd. The primer sequences are shown in Table 8: Table 8 Primer sequences

[0046] The enzyme used for PCR identification comes from the PCR enzyme 2 × TaqMaster Mix (Cat. No.: P112-01) from Novozyme Biotech Co., Ltd. According to the instructions of the PCR enzyme, the PCR reaction system is configured as shown in the following table. The total system is calculated based on the total amount of samples for configuration and subpackaging. This step must be performed on a 96-well metal ice box.

[0047] Place the required upstream and downstream primers, ddH2O, and P112 enzyme in an ice box, take out a 96-well PCR plate, mark the sample information, operation date, etc. on the bottom of the plate, and mark the added template in the upper right corner of the well of the pre-prepared system. Load the sample according to the mark, and after completion, use a 96-well plate low-speed centrifuge to centrifuge and mix. After centrifugation, place the PCR plate in the preheated PCR instrument, cover the hot cover, set the reaction program, and click Start. The 25 μL reaction system and reaction program are shown in Tables 9 and 10.

[0048] Table 9 Reaction system

[0049] Table 10 Reaction procedure

[0050] Take out the agarose gel from the mold, soak it in TBE solution and wait for the bubbles in the channel to overflow, then take out the gel and place it on the operating table. Pipette 5 μL of PCR product and spot it into the channel in the specified order. The Marker uses Kangrun Bio's StarMarker D5000. After the spotting is completed, place the gel in the electrophoresis tank, set the electrophoresis voltage to 300 V, and the electrophoresis time to 15 minutes. After 15 minutes, take out the agarose gel for ultraviolet photography. According to the electrophoresis diagram, compare whether the electrophoresis bands meet the theoretical size and whether the bands are clear and bright. If the electrophoresis bands are qualified, it proves that the PCR product is qualified. Pipette the PCR product and the upstream and downstream primers used for amplification and send them to Cesofei Biotechnology Co., Ltd. for Sanger sequencing. The PCR amplification products of the identification samples and wild-type samples (control group) are subjected to Sanger sequencing, and the obtained sequencing results are compared on the ICE website (https: / / ice.synthego.com / # / ), which can obtain the target site mutation frequency data with high credibility. Integration efficiency evaluation: By comparing the mutation frequencies of different test plasmids, the integration efficiency of the system is evaluated and compared. A high mutation frequency indicates a high integration efficiency.

[0051]

[0052] The mutation frequencies in this example are shown in Tables 11 and Figure 2 shown.

[0053] Table 11 Mutation frequency of episome plus PB transposon

[0054] Comparative Example 1 The control plasmid 1 and control plasmid 2 constructed in Example 1 were tested for mutation frequency, and the results are shown in Tables 12 and Figure 3 shown.

[0055] Table 12 Mutation frequency of individual PB transposons containing mutant sequences

[0056] Comparative Example 2 The control plasmid 3 and control plasmid 4 constructed in Example 1 were tested for mutation frequency, and the results are shown in Tables 13 and Figure 4 shown.

[0057] Table 13 Mutation frequency of individual episomal vector backbones containing mutant sequences

[0058] The present invention respectively shows a single PB transposon containing a mutant sequence (control plasmid 1 and control plasmid 2), a single episome (control plasmid 3 and control plasmid 4), and a combination of an episome and a PB transposon (test plasmid 1 and test plasmid 2). Whether it is a single PB transposon or a single episome, their mutation frequencies show a downward trend and eventually stabilize, which is significantly lower than the case where the episome is combined with the PB transposon. In the present invention, in the recombinant plasmid containing the mutant sequence 1, the PB transposon and the episome at the same time, the mutation frequency begins to gradually increase from the Pn+3 generation, and the growth rate of the mutation frequency is significantly accelerated by the Pn+9 generation. By the Pn+12 generation, the mutation frequency has exceeded 50%, and continues to rise, exceeding 60% by the Pn+18 generation. Similarly, in the recombinant plasmid containing mutant sequence 2, PB transposon and episome at the same time, the mutation frequency began to increase from the Pn+3 generation, and the upward trend became significant in the Pn+5 generation. By the Pn+9 generation, the mutation frequency had exceeded 50%, and remained above 50% in the Pn+18 generation, reaching 65%.

Claims

1. A carrier skeleton, characterized in that: The vector backbone includes a 5' end inverted terminal repeat sequence, a screening marker 1 for screening and identification, a promoter sequence, a sequence for transcription termination, a screening marker 2 for subsequent selection or visualization of transformed cells, a 3' end inverted terminal repeat sequence, an episome sequence, a resistance gene sequence and a gene sequence of the piggyBac transposon of the pUC replication origin, wherein the episome is the OriP and EBNA1 genes.

2. The carrier skeleton according to claim 1, characterized in that: The screening marker 1 includes a visual detection gene, the promoter includes a CAG promoter, the sequence for transcription termination includes a rabbit β-globin polyadenylation signal sequence, and the screening marker 2 includes one or more of the drug screening markers puromycin, geneticin or hygromycin.

3. The carrier skeleton according to claim 1, characterized in that: The resistance gene includes an ampicillin resistance gene.

4. The method for constructing a carrier skeleton according to any one of claims 1 to 3, characterized in that: The following steps are involved: 1) PCR amplification to obtain the target sequence; 2) constructing the vector backbone according to any one of claims 1 to 3.

5. A test plasmid, characterized in that The test plasmid comprises the vector backbone according to any one of claims 1 to 3.

6. The test plasmid according to claim 5, characterized in that The test plasmid also includes the mutant sequence.

7. A method for constructing a test plasmid, characterized in that: The construction method comprises introducing a mutant sequence into the vector backbone according to any one of claims 1 to 3, wherein the mutant sequence is shown as SEQ ID NO.1 or SEQ ID NO.

2.

8. Use of the vector backbone according to any one of claims 1 to 3, or the test plasmid according to claim 5 or 6 in the preparation of diagnostic standard products.

Images