Preparation method and application of wide-spectrum psychrophilic flavobacterium bacteriophage bacteriolysin
Ely-174, a bacteriophilic phage lysocin, was obtained through heterologous expression, which solved the problem of bacterial cold water diseases caused by F. melanophilic ysophilic in aquaculture industry, achieved efficient and stable preparation of lysocin, had wide spectrum cleavage ability and wide pH tolerance range, and was suitable for disinfection and preservation of aquaculture and aquatic products.
Patent Information
- Application Number
- CN202411675763.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-22
- Publication Date
- 2025-02-28
AI Technical Summary
The prior art is difficult to effectively solve the bacterial cold water diseases caused by Floxobacteria chilli, especially in the aquaculture industry. The use of traditional antibiotics brings risks of drug-resistant strains and environmental pollution problems, and commercially available enzyme preparations have poor activity under complex water conditions.
Ely-174, a phage lysocin of flavobacterium chillyphila, was obtained by heterologous expression, and was transferred to E. coli by synthetic gene fragments, PCR amplification, restriction endonuclease cleavage and expression vector ligation, and heat shock conversion method, and induced expression and purification were obtained to obtain lysocins with high yield, strong bactericidal vitality, wide pH tolerance range and wide cleavage spectrum.
The efficient expression and purification of the phage lysotin Ely-174 in E. coli has been achieved, and it has broad spectrum cleavage ability, can maintain activity under complex water conditions. It is suitable for disease prevention and control in the aquaculture industry and disinfection and preservation of aquatic products.
Smart Images
Figure CN119530260A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of bacteriophage lysin, and in particular relates to a preparation method and application of a broad-spectrum psychrophilic Flavobacterium phage lysin. Background Art
[0002] Flavobacterium psychrophilum is a susceptible pathogen of salmonids. The bacterial coldwater disease caused by it usually causes tail erosion, dorsal fin damage, spleen enlargement, enteritis, ascites and death. Recent studies have shown that non-salmonid fish such as carp, crucian carp and sweetfish are also affected by this pathogen. Under certain conditions, the mortality rate of Flavobacterium psychrophilum is as high as 90%. The horizontal and vertical transmission ability of Flavobacterium psychrophilum has aggravated the prevalence of bacterial coldwater disease, and the economic losses caused to the aquaculture industry cannot be ignored.
[0003] Intensive aquaculture produces more than half of the world's fish consumption, but its sustainable development also faces multiple challenges. Due to problems such as excessive stocking density and unscientific management methods, the frequency of fish diseases is increasing. In addition to using disinfectants to disinfect water bodies, antibiotics are also used in large quantities to prevent and control the outbreak of bacterial diseases in aquaculture. Environmental pollution and food safety issues caused by drug residues have always attracted great attention from all walks of life. For bacterial coldwater disease, antibiotic intervention therapy not only increases the cost of breeding, but also has the risk of producing psychrophilic Flavobacterium resistant strains. Compared with the rapid emergence of multidrug-resistant bacteria, the development of new antibiotics is very slow. Therefore, the development of alternative antimicrobial drugs is an important task in the post-antibiotic era. Phage-encoded lysins have the function of lysing host bacterial cells to release newly assembled phages. The peptidoglycan layer, as a highly conserved component of the bacterial cell membrane, is the main target of phage lysins. Given the unique targeting mechanism and ability to destroy bacterial cell membranes, lysins are expected to become a new and effective alternative to traditional antibiotics to deal with the current multidrug-resistant bacterial crisis.
[0004] Several lysins targeting Gram-positive bacteria have entered the clinical trial stage as new antibacterial drugs. However, due to the different bacterial cell wall structures, the presence of the outer membrane of Gram-negative bacteria hinders the exogenously applied lysins from entering the peptidoglycan layer to exert a lytic effect. In addition to finding lysins that naturally have the ability to penetrate the outer membrane, fusion expression with membrane-penetrating peptides and combination with outer membrane permeabilizers such as EDTA and Triton are also common methods to improve the permeability of lysins. Only by overcoming the outer membrane barrier and expanding the application of phage lysins in Gram-negative bacteria can the potential of lysins in combating multidrug-resistant bacteria be fully explored.
[0005] Although nitrofurans and sulfonamides can control psychrophilic Flavobacterium, which has a wide geographical distribution and a large number of aquatic hosts, these drugs are prohibited for use in edible fish. There are no reports on the use of bacteriophage lysins as new antimicrobial agents in the prevention and control of bacterial diseases in aquaculture. At present, most commercially available enzyme preparations are prohibited from repeated freezing and thawing, have a limited pH tolerance range, and have problems such as poor enzyme activity under low temperature conditions and easy inactivation under high temperature. Therefore, the development of lysins with a wide pH tolerance range and active in complex water conditions after repeated freezing and thawing is of great significance to the sustainable development of aquaculture.
[0006] The present invention successfully realizes the heterologous expression of phage lysozyme Ely-174 of psychrophilic Flavobacterium in Escherichia coli, and the obtained lysozyme Ely-174 not only has high yield, strong bactericidal activity, wide pH tolerance range, wide lysis spectrum, but also can tolerate a certain concentration of sodium chloride, and has the potential for use in saline-alkali waters. In addition to being applicable to disease prevention in aquaculture, lysozyme Ely-174 also has potential application value and economic value in aspects such as disinfection and preservation of aquatic products. However, there is no relevant report in this regard at present. Summary of the invention
[0007] The technical problem solved by the invention is to provide a preparation method and application of a wide-spectrum psychrophilic flavobacterium phage lysin with wide-spectrum lysis ability.
[0008] The present invention adopts the following technical scheme to solve the above technical problems. A method for preparing a broad-spectrum psychrophilic Flavobacterium phage lysin comprises constructing an engineered strain expressing a broad-spectrum psychrophilic Flavobacterium phage lysin with in vitro lysis ability and preparing and purifying the psychrophilic Flavobacterium phage lysin Ely-174. The specific steps are as follows:
[0009] Step S1: synthesizing the gene fragment encoding the phage lysin Ely-174 of psychrophilic Flavobacterium obtained from the virus pathogen database;
[0010] Step S2: Using the synthesized lysin Ely-174 encoding gene fragment as a template, the Ely-174 gene fragment was amplified using primers FvP Ely-174 F and FvP Ely-174 R. The primers used are as follows:
[0011] FvP Ely-174 F: GGCCGAGCTCATGACCAGAGCAAATAAAGTAAAGTAC;
[0012] FvP Ely-174 R: GCGCAAGCTTCTAATGGTGATGGTGATGATGTCTATT;
[0013] Step S3: The amplified lysozyme Ely-174 gene fragment was double-digested with restriction endonucleases Sac I and Hind III and then connected to the expression vector pET-29b to obtain a recombinant plasmid named pET-29b-Ely-174. The recombinant plasmid was transformed into Escherichia coli DH5α competent cells by heat shock transformation. After screening and sequencing, a recombinant strain was obtained, named Ely-174-DH5α;
[0014] Step S4: The correctly sequenced pET-29b-Ely-174 recombinant plasmid was transformed into Escherichia coli BL21 competent cells by heat shock transformation to obtain the final expression strain, named Ely-174-BL21;
[0015] Step S5: After activating the expression strain Ely-174-BL21 twice, transfer it to LB medium and culture it in a shaking incubator at 37°C and 120 rpm until the OD 600 =0.6-0.8, add isopropyl-β-D-thiogalactopyranoside (IPTG), and continue to culture at 16°C and 90 rpm for 20 h to obtain a bacterial solution expressing lysin Ely-174;
[0016] Step S6: The obtained bacterial solution was centrifuged at 6000 rpm and 4°C to collect bacterial precipitates, and then the bacterial precipitates were resuspended in 50 mM PBS buffer with pH = 7.4 and then ultrasonically disrupted, with a working period of 4 seconds and a rest period of 8 seconds for a total of 99 cycles. The disrupted bacterial solution was centrifuged for 15 minutes, and the collected supernatant was the crude enzyme solution of lysin Ely-174;
[0017] Step S7: The crushed crude enzyme solution is purified and separated by a nickel affinity chromatography column to finally obtain the purified target protein, namely, phage lysin of psychrophilic Flavobacterium phage, named Ely-174.
[0018] Preferably, the amino acid sequence of the psychrophilic Flavobacterium phage lysin Ely-174 is YP_008320451.1, which is derived from the NCBI database.
[0019] The invention discloses an application of the psychrophilic Flavobacterium phage lysin Ely-174 in the preparation of a biological enzyme preparation with a wide cleavage spectrum.
[0020] The phage lysin Ely-174 of psychrophilic Flavobacterium phage of the present invention is used for lysing psychrophilic Flavobacterium phage and other bacteria of the phylum Bacteroidetes in vitro.
[0021] The phage lysin Ely-174 of the psychrophilic Flavobacterium described in the present invention is used to lyse pathogens under complex conditions, wherein the complex conditions refer to a reaction system containing a buffer solution of 50 mM NaCl and a reaction system containing 10 wt% bovine serum, or to complex conditions simulating different water environments during aquaculture and when ulcers and wounds occur in aquatic animals.
[0022] The unique advantages and significant effects of the present invention are as follows:
[0023] 1. The application scope of the lysin Ely-174 prepared by the present invention is not limited to the pathogenic bacterium psychrophilic bacterium, but can also be used for the prevention of other pathogenic bacteria of the phylum Bacteroidetes in aquaculture, and has application potential in the disinfection and preservation of aquatic products.
[0024] 2. The lysin Ely-174 prepared by the present invention still has lysis ability after repeated freezing and thawing 6 times under the storage condition of -20°C, indicating that it has strong stability and is convenient for long-distance transportation and storage.
[0025] 3. The lysin Ely-174 prepared by the present invention has a wide pH tolerance range and can be applied to the prevention and treatment of diseases in aquaculture under various water quality conditions, and can also be used for pollution prevention and control of aquatic products. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 Schematic diagram of electrophoresis of PCR product of lysin Ely-174.
[0027] Among them: M is a marker, and lane 2 is the Ely-174 gene product.
[0028] Figure 2 Schematic diagram of SDS-PAGE of lysin Ely-174 before and after induction
[0029] Wherein: M represents protein Maker, lane 1 is the uninduced supernatant, lane 2 is the induced supernatant, lane 3 is the uninduced bacterial precipitate, and lane 4 is the induced bacterial precipitate.
[0030] Figure 3 Schematic diagram of SDS-PAGE of lysin Ely-174 obtained by elution with different concentrations of imidazole.
[0031] Wherein, M is protein Maker, lane 1 is the supernatant after induction (crude enzyme solution of lysin Ely-174), lanes 2 and 3 are lysin Ely-174 eluted with 300 mM imidazole, and lanes 4-8 are lysin Ely-174 eluted with 400 mM imidazole.
[0032] Figure 4Flavobacterium psychrophilum after pretreatment with lysate Ely-174.
[0033] Figure 5 To determine the optimal reaction temperature of lysin Ely-174.
[0034] Figure 6 To determine the optimal pH conditions for lysin Ely-174.
[0035] Figure 7 This is a test for the thermal stability of lysin Ely-174.
[0036] Fig. 8A The lysis capacity of lysin Ely-174 stored at 4°C. Figure 8B It is the lysis ability of lysin Ely-174 under room temperature storage.
[0037] Fig. 9 The lysis capacity of Ely-174 after repeated freezing and thawing at -20℃ storage condition.
[0038] Fig.10 The cleavage ability of lysin Ely-174 in 50 mM NaCl solution.
[0039] Fig.11 The lysis ability of bacteriolysin Ely-174 under 10wt% bovine serum conditions. DETAILED DESCRIPTION
[0040] The above contents of the present invention are further described in detail below through examples, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples, and all technologies implemented based on the above contents of the present invention belong to the scope of the present invention.
[0041] Example 1
[0042] Acquisition of phage lysin gene of psychrophilic Flavobacterium and primer design:
[0043] 1. Synthesis of the gene of phage lysin Ely-174 from psychrophilic Flavobacterium
[0044] The gene fragment of Flavobacterium phage lysozyme Ely-174 (Flavobacterium phage 6H, NCBI: YP_008320451.1) was derived from the Bacterial and Viral Bioinformatics Resource Center|BV-BRC. The gene fragment of lysozyme Ely-174 was synthesized by BGI.
[0045] 2. Design of primers for amplification of the phage lysin Ely-174 gene of psychrophilic Flavobacterium
[0046] Primer software was used to design primers. The primer sequences are as follows:
[0047] FvP Ely-174 F: GGCCGAGCTCATGACCAGAGCAAATAAAGTAAAGTAC;
[0048] FvP Ely-174 R: GCGCAAGCTTCTAATGGTGATGGTGATGATGTCTATT.
[0049] Example 2
[0050] Cloning of the psychrophilic Flavobacterium lysin Ely-174 gene, construction of recombinant plasmids and screening of recombinant strains:
[0051] 1. Cloning of the lysin Ely-174 gene
[0052] The synthetic phage lysin Ely-174 gene fragment of psychrophilic Flavobacterium was used as a DNA template to amplify the gene by PCR (primers: FvP Ely-174 F and FvP Ely-174 R). 3 μL of PCR product was taken and electrophoresed in 1 wt% agarose gel for identification. Figure 1 As shown, the bands are bright and single, and the fragment size is in line with expectations. The PCR reaction system and procedure are as follows:
[0053] DNA polymerase 2×FastHiFi PCRMasterMix was used for PCR amplification. The PCR reaction system was as follows:
[0054]
[0055]
[0056] PCR Cycling Conditions:
[0057]
[0058] 2. Construction of recombinant plasmid pET-29b-Ely-174
[0059] (1) Recovery of lysin Ely-174 amplification products
[0060] After agarose gel identification of the amplified product of lysin Ely-174, the fragment size was in line with expectations, and the remaining PCR amplified product was recovered using the Omega PCR-cycle kit. The operation steps are as follows:
[0061] Transfer the PCR amplification product to a 1.5mL EP tube, add 4-6 times CPBuffer, and mix. Centrifuge briefly, transfer to the assembled HiBind DNAMini Column, centrifuge at 13000×g for 5min at room temperature, and discard the liquid in the collection tube. Add 700μL DNAWash Buffer to the combined column, centrifuge at 13000×g for 1min at room temperature, and discard the liquid in the collection tube. Repeat this operation, centrifuge the empty combined column at 13000×g for 2min to dry the column, place the filter column in a new 1.5mL EP tube, add 30-50μL ElutionBuffer, place it for 2min, and then centrifuge it at 13000×g for 1min. Add the liquid in the EP tube to the filter column again, place it at room temperature for 2min, and then centrifuge it at 13000×g for 1min to measure the concentration.
[0062] (2) Enzyme digestion and purification of Ely-174 gene fragment and vector pET-29b
[0063] The lysin Ely-174 gene fragment and the pET-29b vector were double-digested with enzymes, and the enzyme digestion system was as follows.
[0064]
[0065] The enzyme digestion was performed at 37°C for 2 h, and the digestion products were recovered using the Omega PCR-cycle kit in the same way as the PCR product fragment recovery operation.
[0066] (3) Ligation of the purified vector pET-29b and the lysin Ely-174 gene fragment after enzyme digestion
[0067] The lysozyme Ely-174 gene fragment recovered after enzyme digestion and the vector pET-29b were connected by Solution I at 16°C for 3h (Solution I 5μL, vector pET-29b and lysozyme Ely-174 gene fragment 5μL, a total of 10μL system), and the recombinant plasmid after connection was named pET-29b-Ely-174.
[0068] (4) Construction of recombinant E. coli DH5α strain containing plasmid pET-29b-Ely-174
[0069] Take the DH5α competent cells out of the -80℃ freezer and thaw on ice for 2 minutes. Add 10μL of the ligated recombinant plasmid pET-29b-Ely-174 to 90μL of E. coli DH5α competent cells, place in an ice bath for 30 minutes, heat shock in a 42℃ water bath for 1 minute, quickly place in an ice bath for 2 minutes, add 900μL of LB liquid culture medium in the clean bench, and culture at 37℃ with 180rpm shaking for 1 hour. Centrifuge the bacterial solution at 6000rpm for 5 minutes, pour off part of the supernatant in the clean bench, blow and aspirate the bacterial solution evenly and apply it to LB solid culture medium with kanamycin resistance, and culture at 37℃ for 10 hours.
[0070] (5) Colony PCR verification
[0071] Pick a single colony and mix it in 10μL ddH2O by pipetting and blowing. Aspirate 2μL of liquid as the DNA template for colony PCR. Take 3μL of the obtained colony PCR product for agarose gel electrophoresis. The band size is in line with expectations. The colony PCR system is as follows:
[0072]
[0073] PCR Cycling Conditions:
[0074]
[0075] Select the remaining 8 μL bacterial suspension corresponding to the positive transformant, add 3 mL LB liquid culture medium and 1 μL kanamycin, and culture at 37 °C and 120 rpm for 10 h. Take 1 mL of the cultured bacterial solution and send it to the company for sequencing. Add glycerol (final concentration of 30 wt%) to the remaining bacterial solution and store it in a -80 °C refrigerator for later use.
[0076] (6) Construction of BL21 expression strain containing plasmid pET-29b-Ely-174
[0077] After plasmid extraction from the correct bacterial solution, the plasmid pET-29b-Ely-174 was transformed into BL21 competent cells by heat shock transformation, applied to LB solid medium containing kanamycin resistance, and cultured at 37°C for 10 hours. A single colony was picked and cultured in LB liquid medium containing 30wt% kanamycin at 37°C and 120rpm for 10 hours to obtain the BL21 expression strain containing the target gene Ely-174, named Ely-174-BL21, and placed in a -80°C refrigerator to store glycerol strains for later use.
[0078] Example 3
[0079] Inducible expression and purification of lysin Ely-174:
[0080] 1. Inducible expression of lysin Ely-174
[0081] The Ely-174-BL21 strain preserved in Example 2 was streaked and revived on LB solid medium containing kanamycin, and then cultured at 37°C for 10 h. A single colony was picked and cultured at 120 rpm at 37°C for 12 h. The colony was then transferred to 100 mL LB liquid medium (30 μL kanamycin) and cultured at 120 rpm at 37°C for 4 h (until OD 600 =0.6-0.8), take 1mL of the uninduced bacterial solution sample, add IPTG (final concentration 0.5mM) and culture at 16℃, 90rpm for 20h. After the culture is completed, take 1mL of the induced bacterial solution sample. Collect the bacteria by centrifugation at 6000rpm for 10min at 4℃, resuspend the bacterial precipitate with 50mM PBS buffer (pH=7.4), and centrifuge again. After resuspending the bacterial precipitate with PBS buffer, add protease inhibitors for ultrasonic disruption (working 4s, resting 8s, 99 cycles). Centrifuge at 10000×g for 15min under low temperature conditions, collect the supernatant of the disrupted bacterial solution, and resuspend the disrupted liquid precipitate with an equal amount of PBS buffer. Take 50μL of the uninduced bacterial solution, the induced bacterial solution, the induced supernatant, and the induced precipitate, add 10μL 5×Loading Buffer, boil the samples in boiling water for 10min, and centrifuge at 6000rpm for 10min. The expression of Ely-174 protein was detected by SDS-PAGE electrophoresis. Figure 2 As shown, lysin Ely-174 is a soluble protein in the supernatant of the disrupted liquid.
[0082] 2. Expansion and purification of lysin Ely-174
[0083] The Ely-174-BL21 expression strain preserved in Example 2 was streaked and revived on LB solid medium containing kanamycin, and cultured at 37°C for 10 h. A single colony was picked and cultured in a LB liquid shake tube containing kanamycin at 37°C and 120 rpm for 12 h. 300 mL of LB liquid medium (90 μL of kanamycin) was added according to an inoculum of 1 wt%, and cultured at 37°C and 120 rpm with shaking until OD 600=0.6-0.8, add IPTG (final concentration 0.5mM), shake culture at 90rpm for 20h at 16℃. After the culture, centrifuge the bacterial solution at 6000rpm for 10min at low temperature to collect the bacteria, resuspend the bacteria with 50mM PBS (pH=7.4) buffer, and centrifuge at 6000rpm for 10min at low temperature. Resuspend the bacteria with 50mM PBS again and add protease inhibitors for ultrasonic disruption (working 4s, resting 8s, 99 cycles), centrifuge at 10000×g for 15min at low temperature, collect the supernatant of the disruption solution and store it in ice for later use.
[0084] Drain the 20% ethanol in the nickel affinity chromatography column stored at 4°C, wash away the ethanol with 10 column volumes of distilled water, and add 10 column volumes of 50mM PBS (pH=7.4) buffer to adjust the pH after draining out. Load the supernatant kept in ice and pass it through the column repeatedly. After the sample drains out, add 10 column volumes of 50mM PBS (pH=7.4) buffer to balance the column, add 75mM, 150mM, 300mM, and 400mM imidazole buffers for gradient elution, and collect 15mL, 3mL, 2mL, and 6mL of eluate, respectively. Take 50μL of the collected eluate, add 10μL 5×Loading Buffer, boil the sample in boiling water for 10min, and centrifuge at 6000rpm for 5min. The results are as follows. Figure 3 As shown, lysin Ely-174 obtained a single pure protein band under the elution condition of 400 mM imidazole buffer, which was selected as the elution condition in subsequent experiments.
[0085] The concentration of Ely-174 protein was determined by Bradford method, and the concentration was diluted and adjusted to 2.5 μg / mL for subsequent detection.
[0086] Example 4
[0087] Lysin Ely-174 cleavage spectrum determination:
[0088] 1. Bactericidal effect of lysin Ely-174 on psychrophilic Flavobacterium
[0089] The psychrophilic Flavobacterium DSM3660 stored at -80°C was inoculated on TYES solid medium and cultured in a 16°C incubator for 36 hours. A single colony was picked and incubated in liquid TYES medium at 16°C and shaken at 120 rpm for 15 hours to activate the strain. After activation, the psychrophilic Flavobacterium DSM3660 was transferred to 100 mL of liquid TYES medium at a 3wt% inoculation amount and cultured at 16°C and shaken at 120 rpm until the OD 600=0.6-0.8. Collect the cells by centrifugation at 6000 rpm for 10 min, resuspend the cells in 20 mM Hepes / NaOH buffer (pH=7.4) and shake for 10 min. Wash the cells with 20 mM Tris-HCl buffer (pH=7.4) after centrifugation at 6000 rpm for 10 min, repeat twice, and place the collected cell pellet in an ice box for later use.
[0090] According to the second part of Example 3, adjust the protein concentration, and use 20mM Tris-HCl buffer to adjust the bacterial concentration of psychrophilic Flavobacterium DSM3660 after treatment. When measuring the bacterial concentration, the total system is 200μL, the absorbance is 600nm, and a group of three is parallel. The concentration of the purified bacteriolyticus Ely-174 protein is adjusted to 2.5μg / mL. Add 1μL of bacteriolyticus Ely-174 and 199μL of psychrophilic Flavobacterium DSM3660 pretreated with 20mM Hepes / NaOH to a 96-well plate, set up three replicates, and 1μL of 20mM Tris-HCl buffer as a negative control. Immediately place the ELISA plate in an ELISA instrument and detect for 15 minutes at room temperature. Use the lysis time as the horizontal axis, and ΔOD 600 The experimental results are shown in Figure 2. Figure 4 As shown, the psychrophilic Flavobacterium DSM3660 quickly became clear after the addition of lysin Ely-174, and the OD of the bacterial suspension increased within 8 min. 600 The value dropped from 0.8 to 0.2, indicating that lysin Ely-174 had good lysis ability against psychrophilic Flavobacterium DSM3660.
[0091] 2. Determination of cleavage spectrum of lysin Ely-174
[0092] After activating different host bacteria from -80°C, the host bacteria seed solution was transferred to 100 mL of liquid TYES medium at a 3wt% inoculation amount, and cultured at 16°C with shaking at 120rpm until OD600 = 0.6-0.8. The bacteria were collected by centrifugation at 6000rpm for 10min, and shaken for 10min using 20mM Hepes / NaOH buffer (pH = 7.4). After centrifugation at 6000rpm for 10min, the bacteria were washed with 20mM Tris-HCl buffer (pH = 7.4), and the mixture was repeated twice. The collected bacterial precipitates were placed in an ice box for later use.
[0093] Cleavage spectrum of lysin Ely-174
[0094]
[0095] Note: +++: lysis is clear, OD600 decreases by about 0.3; ++: lysis is relatively clear, OD600 decreases by about 0.2; +: lysis is turbid and insufficient, OD600 decreases by about 0.1; -: no lysis.
[0096] The experimental results are shown in the table above. In addition to being able to lyse Flavobacterium psychrophilum (DSM3660), lysin Ely-174 can also lyse Flavobacterium bernardetii, Flavobacterium geliluteum, Flavobacterium flabelliforme, Paeniglutamicibacterantarcticus, Chryseobacterium piscicola, Chryseobacterium panacisoli, Chryseobacterium oncorhynchi, and Chryseobacterium formosus. Most phage lysins target a narrow bacterial lysis spectrum and a limited number of lysed bacterial species, which indicates that the lysin Ely-174 prepared by the present invention has a wide lysis spectrum and can lyse multiple strains of Bacteroidetes.
[0097] Example 5
[0098] Detection of some enzymatic properties (pH, storage) and thermal stability of lysozyme Ely-174:
[0099] 1. Optimal reaction temperature and pH test of lysin Ely-174
[0100] The protein concentration of lysin Ely-174 was adjusted and the tested bacteria (initial OD 600 =0.85) and then placed at 4°C, 10°C, 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C for 10 min, and then the OD of the bacterial suspension was measured again. 600 Value, 3 parallels per group, relative enzyme activity = (initial OD 600 -10min reaction after OD 600 ) / initial OD 600 × 100%. Figure 5As shown in the figure, the optimal reaction temperature of lysozyme Ely-174 is 15℃. In the temperature range of 4-25℃, lysozyme Ely-174 has a strong lysis ability against psychrophilic Flavobacterium DSM3660. As the reaction temperature increases, the lysis ability of lysozyme Ely-174 gradually decreases. Under the condition of reaction temperature of 45℃, the lysis ability of lysozyme Ely-174 is still about 50%, indicating that lysozyme Ely-174 is fully suitable for the change of water temperature in aquaculture.
[0101] The lysozyme Ely-174 with adjusted protein concentration was mixed with the tested bacteria in a buffer solution of pH 3-12 to determine the relative lysis ability of lysozyme Ely-174. The relative enzyme activity of each group of 3 parallels was calculated as follows: (initial OD 600 -10min reaction after OD 600 ) / initial OD 600 × 100%. Figure 6 As shown, the optimum pH value of lysin Ely-174 is 8. Lysin Ely-174 has the ability to lyse psychrophilic Flavobacterium DSM3660 under the condition of pH=3-12. The lysis ability of lysin Ely-174 to psychrophilic Flavobacterium DSM3660 is almost unaffected under the reaction conditions of pH=8-11. Under the reaction condition of pH=3, lysin Ely-174 still has the ability to lyse psychrophilic Flavobacterium DSM3660. The above experimental results show that lysin Ely-174 is acid and alkali resistant and can be used for the prevention and control of diseases in aquaculture under various water quality conditions.
[0102] 2. Thermal stability test of lysin Ely-174
[0103] The lysozyme Ely-174 with properly adjusted protein concentration was placed at 4℃, 15℃, 20℃, 25℃, 30℃, 35℃, 40℃, and 45℃ for 2h. The lysis ability of lysozyme Ely-174 was tested according to the method in Experiment 4, with 3 parallels in each group. The lysis ability of lysozyme Ely-174 after 2h treatment at 4℃ was taken as unit 1, and the relative lysis ability under other temperature conditions was calculated. Relative enzyme activity = (initial OD 600 -10min reaction time OD 600 ) / initial OD 600 × 100%. Figure 7 As shown, the lysin Ely-174 has the strongest lysis ability after being treated at 4°C for 2 hours, and still has more than 60% lysis ability after being treated at 35°C for 2 hours. This shows that the lysin Ely-174 prepared by the present invention has good thermal stability and strong lysis ability under low temperature conditions, and is suitable for the lysis requirements of pathogens in different seasons during aquaculture.
[0104] 3. Detection of lysis ability of lysin Ely-174 under different storage conditions
[0105] The lysin Ely-174 with adjusted protein concentration was stored at 4°C and room temperature (25±2°C) respectively, and mixed with the tested bacteria at regular intervals to test the lysis ability, with 3 parallels in each group. Fig. 8A As shown in the figure, the lysis rate of lysin Ely-174 decreased slightly after storage at 4°C for 45 days, but it could still reduce the OD of the bacterial solution of psychrophilic Flavobacterium DSM3660 within 10 min. 600 Decrease by 0.5. Figure 8B As shown, the lysis ability of lysozyme Ely-174 is almost not affected after being stored for one day at room temperature, which indicates that the enzyme activity of lysozyme Ely-174 prepared by the present invention has a strong ability to maintain at room temperature or low temperature water.
[0106] 4. Detection of lysis ability of Ely-174 after repeated freezing and thawing under low temperature conditions
[0107] The lysin Ely-174 with adjusted protein concentration was repeatedly frozen and thawed at -20℃ for 6 times. The lysis ability of psychrophilic Flavobacterium DSM3660 was measured after each thawing. After the measurement, it was frozen again and the relative lysis ability was calculated. Each group had 3 parallels. Fig. 9 As shown, the lysis ability of lysin Ely-174 to psychrophilic Flavobacterium DSM3660 within 10 minutes after 6 freeze-thaw cycles at -20°C still retained 92%. This shows that the lysin Ely-174 prepared by the present invention can be repeatedly frozen and thawed, which is better than most other commercially available enzyme preparations.
[0108] Example 6
[0109] Detection of the lysis ability of lysin Ely-174 in complex environments:
[0110] 1. Detection of the lysis ability of lysin Ely-174 in 50mM NaCl solution
[0111] The lysin Ely-174 with adjusted protein concentration was mixed with the test bacteria resuspended in the solution to measure the lysis ability of lysin Ely-174 on psychrophilic Flavobacterium DSM3660, with 3 parallels in each group. Fig.10 As shown, in the presence of NaCl, the lysis ability of lysozyme Ely-174 is affected, but with the extension of reaction time, psychrophilic Flavobacterium DSM3660 can also be completely lysed, which shows that the lysozyme Ely-174 prepared by the present invention has certain salt tolerance. Therefore, lysozyme Ely-174 has potential application value in aquatic product preservation.
[0112] 2. Detection of the lysis ability of lysin Ely-174 in 10wt% bovine serum buffer
[0113] The lysin Ely-174 with adjusted protein concentration was mixed with the test bacteria resuspended in a buffer containing 10 wt% bovine serum, and the lysis ability of lysin Ely-174 on psychrophilic Flavobacterium DSM3660 was measured, with 3 parallels in each group. Fig.11 As shown, in the presence of 10wt% bovine serum, lysin Ely-174 has a promoting effect on the lysis ability of psychrophilic Flavobacterium DSM3660, which indicates that the lysin Ely-174 prepared by the present invention can be used under complex conditions such as ulcers and wounds in aquatic animals.
[0114] The above embodiments describe the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for illustrating the principles of the present invention. Without departing from the scope of the principles of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of protection of the present invention.
[0115] SEQUENCE LISTING
[0116] <110> Henan Normal University
[0117] <120> Preparation method and application of a broad-spectrum psychrophilic flavobacterium phage lysin
[0118] <130> 2024
[0119] <160> 2
[0120] <170> patentinversion 3.3
[0121] <210> 1
[0122] <211> 37
[0123] <212> DNA
[0124] <213> Artificial sequence
[0125] <400> 1
[0126] gcgcgagctcatgaccagagcaaataaagtaaagtac 37
[0127] <210> 2
[0128] <211> 37
[0129] <212> DNA
[0130] <213> Artificial sequence
[0131] <400> 2
[0132] gcgcaagcttctaatggtgatggtgatgatgtctatt 37
Claims
1. A method for preparing a broad-spectrum psychrophilic flavobacterium phage lysin, characterized in that The invention comprises the construction of an engineering strain expressing a broad-spectrum phage lysin of psychrophilic Flavobacterium with in vitro lysis ability and the preparation and purification of phage lysin Ely-174 of psychrophilic Flavobacterium, and the specific steps are as follows: Step S1: synthesizing the gene fragment encoding the phage lysin Ely-174 of psychrophilic Flavobacterium obtained from the virus pathogen database; Step S2: Using the synthesized lysin Ely-174 encoding gene fragment as a template, the Ely-174 gene fragment was amplified using primers FvP Ely-174 F and FvPEly-174 R. The primers used are as follows: FvP Ely-174 F: GGCCGAGCTCATGACCAGAGCAAATAAAGTAAAGTAC; FvP Ely-174 R: GCGCAAGCTTCTAATGGTGATGGTGATGATGTCTATT; Step S3: The amplified lysozyme Ely-174 gene fragment was double-digested with restriction endonucleases Sac I and HindIII and then connected to the expression vector pET-29b to obtain a recombinant plasmid named pET-29b-Ely-174. The recombinant plasmid was transformed into Escherichia coli DH5α competent cells by heat shock transformation. After screening and sequencing, a recombinant strain was obtained, named Ely-174-DH5α; Step S4: The correctly sequenced pET-29b-Ely-174 recombinant plasmid was transformed into Escherichia coli BL21 competent cells by heat shock transformation to obtain the final expression strain, named Ely-174-BL21; Step S5: After activating the expression strain Ely-174-BL21 twice, transfer it to LB medium and culture it in a shaking incubator at 37°C and 120 rpm until the OD 600 = 0.6-0.8, add isopropyl-β-D-thiogalactopyranoside (IPTG) and continue to culture at 16°C and 90 rpm for 20 h to obtain a bacterial solution expressing lysin Ely-174; Step S6: centrifuge the obtained bacterial solution at 6000 rpm and 4°C, collect the bacterial precipitate, resuspend the bacterial precipitate in 50 mM PBS buffer with pH = 7.4, and then ultrasonically disrupt it, work for 4 seconds, rest for 8 seconds, and a total of 99 cycles, centrifuge the disrupted bacterial solution for 15 minutes, and collect the supernatant, which is the crude enzyme solution of lysin Ely-174; Step S7: The crushed crude enzyme solution is purified and separated by nickel affinity chromatography to finally obtain the purified target protein, namely, phage lysin of psychrophilic Flavobacterium phage, named Ely-174.
2. The method for preparing the broad-spectrum psychrophilic flavobacterium phage lysin according to claim 1, characterized in that: The amino acid sequence of the psychrophilic Flavobacterium phage lysin Ely-174 is YP_008320451.1, which is derived from the NCBI database.
3. Use of the phage lysin Ely-174 of psychrophilic Flavobacterium prepared according to the method of claim 1 in the preparation of a biological enzyme preparation with a wide cleavage spectrum.
4. The use according to claim 3, characterized in that: The phage lysin Ely-174 of psychrophilic Flavobacterium is used for lysing psychrophilic Flavobacterium and other bacteria of the phylum Bacteroidetes in vitro.
5. The use according to claim 3, characterized in that: The phage lysin Ely-174 of psychrophilic Flavobacterium is used to lyse pathogens under complex conditions, wherein the complex conditions refer to a reaction system containing a buffer solution of 50 mM NaCl and 10 wt % bovine serum, or refer to complex conditions simulating different water environments during aquaculture and when ulcers and wounds occur in aquatic animals.