High-yield L-cysteine engineering bacterium accumulated by sulfur donor 3 '-phosphoadenosine-5'-phosphoryl sulfuric acid as well as construction method and application of high-yield L-cysteine engineering bacterium

Abstract

The invention provides a high-yield L-cysteine engineering bacterium accumulated by sulfur donor 3 '-phosphoadenosine-5'-phosphoryl sulfuric acid as well as a construction method and application of the high-yield L-cysteine engineering bacterium. According to the method, the copy number of key genes in a cysteine synthesis route in an escherichia coli organism is changed, heterologous genes are introduced, the expression level of the key genes in the cysteine synthesis route in the escherichia coli organism is enhanced, and sulfur flux is further made to flow to synthesis of L-cysteine. On the basis that the chassis bacteria enhance the carbon flux, in order to maintain the balance of carbon and sulfur in the strain and continuously enhance the synthesis of the sulfur flux flowing to the L-cysteine, the synthesis of the product is promoted by enhancing the synthesis capability of a sulfur donor PAPS in a sulfate pathway, and finally, the plasmid-free and antibiotic-free engineering strain for high yield of the L-cysteine is obtained. Finally, the shake flask titer of the L-cysteine reaches 6.06 g / L and is increased by 49.2% compared with that of an original strain.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering, and specifically relates to a high-yield L-cysteine ​​engineering bacterium that accumulates sulfur donor 3'-adenosine phosphate-5'-phosphosulfate, and a construction method and application thereof. Background Art

[0002] Cysteine ​​has two isomers, L-cysteine ​​and D-cysteine. Biologically active L-cysteine ​​is an important sulfur-containing amino acid that can form disulfide bonds to connect protein chains into a three-dimensional network structure, thereby improving the stability of the protein. In addition, studies have shown that L-cysteine ​​plays an important role in resisting oxidative stress in the periplasmic space of Escherichia coli. Therefore, as an important sulfur-containing amino acid, L-cysteine ​​is widely used in food, cosmetics, medicines, animal feed and other fields. At present, L-cysteine ​​is mainly produced by protein hydrolysis, chemical synthesis, enzymatic method and microbial fermentation. With the continuous increase in the market demand for L-cysteine ​​and the conditions of low cost, high efficiency and green production, the method of microbial fermentation is better. However, due to the complex cysteine ​​synthesis pathway in microorganisms, its industrial large-scale production still has certain challenges. Summary of the invention

[0003] In order to solve the problem of low yield of L-cysteine ​​synthesized by microbial fermentation in the prior art, the present invention uses rational design and CRISPR-Cas9 gene editing technology to provide a genetically engineered bacterium with high L-cysteine ​​yield and a construction method thereof, as well as the use of the genetically engineered bacterium in preparing L-cysteine ​​by microbial fermentation.

[0004] The technical solution adopted by the present invention is: a method for constructing a high-yield L-cysteine ​​engineering bacterium, the method comprising: enhancing the 3'-phosphoadenosine-5'-phosphosulfate synthesis ability in the chassis strain;

[0005] Wherein, the method for enhancing the synthesis ability of 3'-phosphoadenosine-5'-phosphosulfate comprises at least one of the following:

[0006] (1) Introducing and overexpressing the MET3 gene from Kluyveromyces lactis GG799 into the bottom plate bacteria;

[0007] (2) Introducing and overexpressing the N7489_009139 gene from Penicillium chrysogenum into the bottom plate bacteria;

[0008] (3) Overexpression of the cysD gene in the genome of the chassis bacteria.

[0009] Please refer to Figure 1The L-cysteine ​​metabolic pathway diagram and the modification sites shown in the figure. f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / ΔpoxB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / Δylb E-cysE f / ΔyjhE-cysE f , which has been disclosed in CN 116837015 A), in order to maintain the carbon-sulfur balance in the strain, a system metabolic engineering strategy was comprehensively applied, and CRISPR / Cas9 gene editing technology was used to introduce heterologous genes MET3 (cysD / N, encoding ATP sulfurylase) and N7489_009139 (CYSC, encoding APS kinase) by gene knock-in to enhance the expression level of key genes in the cysteine ​​synthesis pathway in Escherichia coli (engineered bacteria SSC8-2YJ1), and at the same time, the expression of the cysD gene in the chassis bacteria genome was further strengthened to continue to enhance the sulfur flux to the synthesis of L-cysteine, thereby promoting product synthesis by enhancing the synthesis ability of the sulfur donor 3'-phosphoadenosine-5'-phosphosulfate (PAPS), and finally a plasmid-free, antibiotic-free engineered strain SSC8-2YJ3 for high-yield L-cysteine ​​was obtained.

[0010] Table 1: Genes and corresponding pathways involved in gene editing

[0011] gene involved pathway MET3 ATP sulfurylase synthesis N7489_009139 APS kinase synthesis

[0012] Preferably, the method for enhancing the ability to synthesize 3'-phosphoadenosine-5'-phosphosulfate comprises: constructing the MET3 gene and the N7489_009139 gene into the pTrc99a plasmid and then transferring them into the chassis bacteria for overexpression. Specifically, the engineered bacteria SSC8 is used as the chassis bacteria, and the pTrc99a plasmid is used to overexpress the MET3 and N7489_009139 heterologous genes to enhance the expression intensity of MET3 and N7489_009139, and obtain the engineered bacteria SSC8 derivative, pTrc99a-MET3-N7489_009139, which is recorded as the engineered bacteria TKA1. Further preferably, the MET3 gene and the N7489_009139 gene are both regulated by the Trc promoter. Specifically, the engineered bacteria SSC8 was used as the chassis bacteria, and the pTrc99a plasmid was used to overexpress the heterologous genes MET3 and N7489_009139. Both genes were regulated by the Trc promoter to enhance the gene expression intensity, and the engineered bacteria SSC8 derivative, pTrc (MET3, N7489_009139), was obtained, which was recorded as the engineered bacteria TKA3.

[0013] Preferably, the method for enhancing the ability to synthesize 3'-phosphoadenosine-5'-phosphosulfate comprises: using CRISPR-Cas9-mediated gene editing technology to replace the original pseudogene yjhw on the genome of the base bacteria with the MET3 gene and the N7489_009139 gene and then overexpressing them. Specifically, using the engineered bacteria SSC8 as the base bacteria, using CRISPR-Cas9-mediated gene editing technology, the MET3 and N7489_009139 genes derived from pRSFDuet replace the original pseudogene yjhw on the genome of the starting strain to enhance the expression intensity of MET3 and N7489_009139, and obtaining the engineered bacteria SSC8derivative, yjhw::MET3-N7489_009139, recorded as the engineered bacteria SSC8-2YJ1.

[0014] Preferably, the method for enhancing the ability to synthesize 3'-phosphoadenosine-5'-phosphosulfate comprises: using CRISPR-Cas9-mediated gene editing technology to replace the in situ promoter of the cysD gene in the base bacteria genome with the Trc promoter and then overexpressing it. Specifically, using the engineered bacteria SSC8 as the base bacteria, using CRISPR-Cas9-mediated gene editing technology to replace the in situ promoter of the cysD gene in its genome with Ptrc, an engineered bacteria SSC8 derivative, cysD::Ptrc, is obtained, and is recorded as the engineered bacteria SSC8-2YJ2.

[0015] Preferably, the method for enhancing the ability to synthesize 3'-phosphoadenosine-5'-phosphosulfate comprises: using CRISPR-Cas9-mediated gene editing technology to replace the in situ promoter of the cysD gene in the genome of the chassis bacteria with the Trc promoter and then overexpress it, and replacing the original pseudogene yjhw on the genome of the chassis bacteria with the MET3 gene and the N7489_009139 gene and then overexpressing it. Specifically, the engineered bacteria SSC8 is used as the chassis bacteria, and the CRISPR-Cas9-mediated gene editing technology is used to replace the in situ promoter of the cysD gene in its genome with Ptrc to obtain the engineered bacteria SSC8. derivative, cysD::Ptrc, denoted as engineered bacteria SSC8-2YJ2; using engineered bacteria SSC8-2YJ2 as the starting strain, using CRISPR-Cas9-mediated gene editing technology, the MET3 and N7489_009139 genes regulated by the Ptrc promoter derived from pTrc99A replaced the original pseudogene yjhw on the genome of the starting strain, thereby enhancing the expression intensity of MET3 and N7489_009139, and obtaining the engineered bacteria SSC8derivative, cysD::Ptrc / yjhw::Ptrc:MET3(KI), N7489_009139(KI), denoted as engineered bacteria SSC8-2YJ3, i.e. the high-yield L-cysteine ​​engineered bacteria.

[0016] Preferably, the bottom plate bacteria is: E.coli W3110, pgk / serA f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / ΔpoxB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / Δylb E-cysE f / ΔyjhE-cysE f The bottom plate bacteria has been disclosed in CN 116837015 A and is denoted as SSC8.

[0017] Preferably, the nucleotide sequence of the MET3 gene is shown as SEQ ID NO.1; the nucleotide sequence of the N7489_009139 gene is shown as SEQ ID NO.2.

[0018] The present invention also provides a high-yield L-cysteine ​​engineering bacterium constructed by the method.

[0019] Preferably, the high-yield L-cysteine ​​engineering bacteria is any one of the following:

[0020] (1) E. coli W3110, pgk / serA f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / ΔpoxB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / Δylb E-cysE f / ΔyjhE-cysE f / yjhw::MET3-N7489_009139, denoted as engineered bacteria SSC8-2YJ1;

[0021] (2) E. coli W3110, pgk / serA f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / ΔpoxB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / Δylb E-cysE f / ΔyjhE-cysE f / cysD::Ptrc, denoted as engineered bacteria SSC8-2YJ2;

[0022] (3) E. coli W3110, pgk / serA f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / ΔpoxB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / Δylb E-cysE f / ΔyjhE-cysE f / cysD::Ptrc / yjhw::Ptrc:MET3(KI),N7489_009139(KI), denoted as engineered bacteria SSC8-2YJ3;

[0023] (4) E. coli W3110, pgk / serA f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / ΔpoxB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / Δylb E-cysE f / ΔyjhE-cysE f / pTrc(MET3,N7489_009139).

[0024] The present invention also provides the use of the high-yield L-cysteine ​​engineering bacteria in preparing L-cysteine ​​by microbial fermentation.

[0025] Preferably, the application comprises: inoculating the high-yield L-cysteine ​​engineered bacteria into a fermentation medium, fermenting and culturing at 30° C. and 180 rpm for 48 hours, and separating and purifying the fermentation liquid after the fermentation to obtain the L-cysteine.

[0026] Preferably, the shake flask fermentation medium is composed of: 42 g / L glucose, 1 g / L peptone, 9 g / L ammonium sulfate, 7 g / L sodium thiosulfate pentahydrate, 2.52 g / L disodium hydrogen phosphate decahydrate, 8 g / L yeast powder, 1 g / L potassium dihydrogen phosphate, 1 ml / L trace element solution, 1 ml / L vitamin B1 solution, the solvent is deionized water, and the pH value is natural; the trace element solution is composed of: 5 g / L manganese sulfate octahydrate, 500 g / L magnesium sulfate heptahydrate, 5 g / L ferrous sulfate heptahydrate, 5 g / L zinc sulfate, and the solvent is deionized water.

[0027] Preferably, the application comprises: filling a 500 mL shake flask with a volume of 20 to 50 mL of fermentation medium, sterilizing at 104° C. for 45 min, inoculating the high-yield L-cysteine ​​engineering bacteria strain into a test tube with a liquid volume of 10 mL, culturing at 37° C. and 180 rpm for 16 to 18 h, inoculating a 2% inoculum into a shake flask, and fermenting and culturing for 48 h at 30° C. and 180 rpm, and 1 g / LCaCO 3 Adjust the pH and add IPTG to a final concentration of 1 mM and VB to a final concentration of 5 mg / L 1 , obtaining a fermentation broth, and separating and purifying the fermentation broth to obtain the L-cysteine.

[0028] Beneficial effects of the present invention:

[0029] The present invention uses CRISPR / Cas9 gene editing technology to replace the in situ promoter of the cysD gene in the genome on the basis of existing engineered bacteria, further enhancing the expression level of the key enzyme encoding gene cysD in the L-cysteine ​​bioproduction pathway; then introduces heterologous double genes encoding ATP sulfurylase and APS kinase to enhance the supply of sulfonyl donor PAPS, and obtains a plasmid-free high-yield strain SSC8-2YJ3 that does not require the addition of antibiotics during the fermentation process, which is 49.2% higher than the starting strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The diagram is a diagram of the L-cysteine ​​metabolic pathway and the modification sites of the present invention.

[0031] Figure 2 The OD600 and L-cysteine ​​titer changes of TKA1 and TKA2 in Example 1 are shown.

[0032] Figure 3 The OD600 and L-cysteine ​​titer changes of SSC8-2YJ1 in Example 2.

[0033] Figure 4 The OD600 and L-cysteine ​​titer changes of TKA3 in Example 3.

[0034] Figure 5 The OD600 and L-cysteine ​​titer changes of SSC8-2YJ2 in Example 4.

[0035] Figure 6 The OD600 and L-cysteine ​​titer changes of SSC8-2YJ3 in Example 5. DETAILED DESCRIPTION

[0036] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0037] In the following examples, the final concentration of spectinomycin in the culture medium is 0.05 mg / L, and the final concentration of kanamycin in the culture medium is 0.05 mg / L.

[0038] The parent strain E. coli W3110 of the present invention is from the Coli Genetic Stock Center of Yale University, with a deposit date of August 5, 1975 and a deposit number of CGSC#4474, and has been disclosed in patents US2009 / 0298135A1 and US2010 / 0248311A1.

[0039] HPLC determination of L-cysteine ​​content:

[0040] Chromatographic conditions: C18 column, detection wavelength 260nm; column temperature 30℃;

[0041] Sample treatment: 1 mL of fermentation broth was centrifuged to separate the supernatant and precipitate. The precipitate was resuspended in 0.5 M sulfuric acid, mixed and allowed to stand for 3-5 minutes, then centrifuged and neutralized with 1 M sodium hydroxide. 100 μL of the supernatant was separated from the precipitate, and 500 μL of boric acid borax buffer and 300 μL of derivatization reagent were added. The reaction was carried out at 60°C and 600 rpm in the dark for 1 hour. 200-400 μL of the sample solution was taken for HPLC analysis;

[0042] Mobile phase: A pure acetonitrile, B acetonitrile / 50 mM sodium acetate buffer (17 / 83), adjusted to pH 4.9;

[0043] Data collection time: 23 minutes.

[0044] The primer sequence information used in the examples is shown in Table 2.

[0045] Table 2: Primer sequences

[0046] Primer name Sequence (5’-3’) pET-K-F ATGCCATCACCCCACGGA pET-K-R TTATTAGTGGTGGTGGTGGTGATGAA pET-A-F ATGAGTACAAATATAACTTTTCACGCTTCAGCTCTGACG pET-A-R TTATTAGTGATGGTGGTGGTGGTGCTCC 99a-PLine-F GGCTGTTTTGGCGGATGAG 99a-PLine-R GGTCTGTTTCCTGTGTGAAATTGTTA 99a-K-F TCACACAGGAAACAGACCATGCCATCACCCCACGG 99a-K-R TATATTTGTACTCATTTATTAGTGGTGGTGGTGGTGAT 99a-A-F CCACCACCACCACTAATAAATGAGTACAAATATAACTTTTCACGCTTCA 99a-A-R TCTCATCCGCCAAAACAGCCTTATTAGTGATGGTGGTGGTGGTGC 99a-KL-R TGAACCGCCGCCCCCAAATTGGAAGAAACCCTGGTCCTCCAAAAACAAAACCACGC 99a-LA-F ATTTGGGGGCGGCGGTTCAATGAGTACAAATATAACTTTTCACGCTTCAGCTCTGAC pT-yjhw-F CTAGGTATAATACTAGTATACTGGAAAAACTCTAACGGTTTTAGAGCTAGAA pT-yjhw-R ATTTCTAGCTCTAAAACCGTTAGAGTTTTTCCAGTATACTAGTATTATACCT yjhw-S5F TCTCTAGAGTCGACCTGCAGCGCAGTCAGGTACTTGAGCT yjhw-S5R CCGTGGGGTGATGGCATACTCTGCCTGATCCGGTATCG yjhw-X5F GCAAAGAAGGAGTAATAACCACAACAGACTACCTGAAGGG yjhw-X5R GCTGCACATGAACTCGAGTTGGGCTTTTGAGGATAAATCAATGATCAG PTD-TKA-F ATACCGGATCAGGCAGAGTATGCCATCACCCCACGG PTD-TKA-R TTCAGGTAGTCTGTTGTGGTTATTACTCCTTCTTTGCTGGCAGGT 99a-TK-R TATATTTGTACTCATGGTCTGTTTCCTGTGTGAAATTATTAGTGGTGGTGGTGGTGAT 99a-TA-F CCACCACCACCACTAATAATTTCACACAGGAAACAGACCATGAGTACAAATATAACT pT-cysD-F CTAGGTATAATACTAGTAGAAAATAGCGGTATTGCAAGTTTTAGAGCTAGAA pT-cysD-R ATTTCTAGCTCTAAAACTTGCAATACCGCTATTTTCTACTAGTATTATACCT pTarget-PLine-F CTCGAGTTCATGTGCAGCTCCATA pTarget-PLine-R CTGCAGGTCGACTCTAGAGAATTCA cysD-S5F TAGAGTCGACCTGCAGCGTCACGTTATGCCAGCTC cysD-S5R GGATGATTAATTGTCAAATGTTTCGACTATAGGGAGCGT cysD-X5F CACACAGGAAACAGACCATGGATCAAATACGACTTACTCACCT cysD-X5R GCTGCACATGAACTCGAGAGCTCCGGGCGCT Trc-F TCCCTATAGTCGAAACATTTGACAATTAATCATCCGGCTCG Trc-R AGTCGTATTTGATCCATGGTCTGTTTCCTGTGTGAAATTG 99a-TKTA-F CCGGATCAGGCAGAGTTTGACAATTAATCATCCGGCTCG 99a-TKTA-R AGGTAGTCTGTTGTGGTTATTAGTGATGGTGGTGGTGGTGC

[0047] Example 1: Construction of TKA1 and TKA2 and shake flask fermentation

[0048] SSC8 (E. coli W3110, pgk / serA f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / ΔpoxB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / ΔylbE-cysE f / ΔyjhE-cysE f ) was used as the starting strain, and the plasmid overexpression method was used to overexpress MET3 and N7489_009139 heterologous genes (nucleotide sequences are shown in SEQ ID No.1 and SEQ ID No.2) using pTrc99a plasmid to enhance the intensity of PAPS synthesis in the strain.

[0049] (1) Acquisition of heterologous genes MET3 and N7489_009139: The nucleotide and protein sequences of the MET3 gene (encoding ATP sulfurylase) from Kluyveromyceslactis GG799 and the N7489_009139 gene (encoding APS kinase) from Penicillium chrysogenum were queried on NCBI and obtained in pET28-KAST / APSK. PCR amplification was performed using pET-KF / R and pETA-F / R as primers, respectively. The PCR products were verified by nucleic acid gel electrophoresis and digested with Dpn I digestion enzyme at 37°C for 3 h. After purification with a Clean up kit and sequencing verification, the correct KAST / APSK fragment was obtained for subsequent ligation to the overexpression plasmid.

[0050] (2) Construction of pTrc99a-KAST-APSK plasmid: First, the initial pTrc99a plasmid was used as a template and 99a-PLine-F / R primers were used to linearize it by PCR. After the product was verified by nucleic acid gel electrophoresis, it was digested with Dpn I digestion enzyme at 37°C for 3 h. Secondly, the KAST / APSK fragment was used as a template and 99a-KF / R and 99a-AF / R were used as primers to amplify the KAST fragment (K1) with the upper homology arm of the pTrc99a plasmid and the lower homology arm of the APSK fragment, and the APSK fragment (A1) with the upper homology arm of the KAST fragment and the lower homology arm of the pTrc99a plasmid. After the three fragments were verified by nucleic acid gel electrophoresis, they were digested with Dpn I digestion enzyme at 37°C for 3 h. After purification by Clean up kit, (One stepclone kit, Vazyme Biotech, Nanjing, China) instructions: connect the pTrc99a vector, K1, and A1 fragments by fusion PCR, transform the PCR product into E. coli DH5α, screen on kanamycin sulfate plates, and sequence to verify the correct pTrc99a-KAST-APSK plasmid. The plasmid was extracted and transformed into SSC8 chassis bacteria for overexpression to obtain TKA1.

[0051] (3) Construction of pTrc99a-KAST-Linker-APSK plasmid: First, using the KAST / APSK fragment as a template and 99a-KF and 99a-KL-R, 99a-LA-F and 99a-AR as primers, PCR was used to amplify the KAST fragment (K2) with the upper homology arm of the pTrc99a plasmid and the lower homology arm of the Linker-APSK fragment, and the APSK fragment (A2) with the upper homology arm of the KAST-Linker fragment and the lower homology arm of the pTrc99a plasmid, respectively. After verification by nucleic acid gel electrophoresis, the fragments were digested with Dpn I digestion enzyme at 37°C for 3 h, purified with a Clean up kit and set aside. Secondly, the pTrc99a fragment linearized in (2) was amplified by (One step clone kit, Vazyme Biotech, Nanjing, China) instructions: connect the pTrc99a vector, K2, and A2 fragments by fusion PCR, transform the PCR product into E. coli DH5α, screen on kanamycin sulfate plates, and sequence to verify the correct pTrc99a-KAST-Linker-APSK plasmid. The plasmid was extracted and transformed into SSC8 chassis bacteria for overexpression to obtain TKA2.

[0052] (4) Shake flask fermentation: TKA1 and TKA2, with the starting strain SSC8 as the control group, were inoculated into 10 mL of LB medium, respectively, and cultured at 37°C and 200 rpm as pre-cultures; after 8-12 h, 1 mL of the pre-culture was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium at a 2% inoculum, and then cultured in a constant temperature shaker at 30°C and 180 rpm for 48 h for strain fermentation; after the fermentation was completed, 1 mL of the fermentation liquid was taken to measure the OD 600 At the same time, sample processing and HPLC detection, OD 600 and the L-cysteine ​​content in the fermentation broth Figure 2 shown.

[0053] As can be seen from the figure, overexpression of heterologous genes has a certain effect on the production of cysteine. By comparing TKA1 and TKA2, it was found that the production decreased after adding Linker, while the comparison between TKA1 and SSC8 showed that the production was slightly improved, but the OD 600 The results of the repeated experiments were consistent. It may be that the overexpression plasmid has resistance and has a certain inhibitory effect on the growth of the strain. Based on this result, it can be seen that the expression of heterologous genes to enhance the synthesis of ATP sulfurylase and APS kinase is effective on the yield. Therefore, the strain was subsequently modified in the genome.

[0054] LB medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, solvent is deionized water, pH value is natural.

[0055] Shake flask fermentation medium: glucose 42g / L, peptone 1g / L, ammonium sulfate 9g / L, sodium thiosulfate pentahydrate 7g / L, disodium hydrogen phosphate decahydrate 2.52g / L, yeast powder 8g / L, potassium dihydrogen phosphate 1g / L, 1ml / L trace element solution, 1ml / L vitamin B1 solution, the solvent is deionized water, and the pH value is natural; the trace element solution consists of: manganese sulfate octahydrate 5g / L, magnesium sulfate heptahydrate 500g / L, ferrous sulfate heptahydrate 5g / L, zinc sulfate 5g / L, and the solvent is deionized water.

[0056] Example 2: Construction of SSC8-2YJ1 and shake flask fermentation

[0057] Taking SSC8 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to replace the original pseudogene yjhw on the genome of the starting strain by gene knock-in, with the MET3 and N7489_009139 genes (nucleotide sequences as shown in SEQ ID No.1 and SEQ ID No.2) derived from pRSFDuet, so as to enhance the ability to synthesize PAPS and the intensity of sulfate metabolism.

[0058] (1) Construction of pTarget-yjhw plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as a template and pT-yjhw-F / R as primers for PCR amplification. The PCR product was verified by nucleic acid gel electrophoresis and digested with Dpn I digestion enzyme at 37°C for 3 h. The product was then transformed into E. coli DH5α and screened on a spectinomycin plate. The correct pTarget-yjhw plasmid was obtained by sequencing for subsequent ligation with Donor DNA.

[0059] (2) Construction of pTD-KAST-APSK plasmid: First, using the E. coli W3110 genome as a template, yjhw-S5F / R as primers were used to amplify the upstream part of the donor DNA (F1), and yjhw-X5F / R as primers were used to amplify the downstream part of the donor DNA (F2). Then, using pTrc99a-KAST-APSK as a template, the MET3 and N7489_009139 gene fragments (F3) were amplified using PTD-TKA-F / R primers; the plasmid pTarget-yjhw was incubated at 37°C for 8 h with Xba I and Pst I, and the DNA fragments were recovered using the Clean up kit; according to The pTarget-yjhw vector, fragments F1, F2, and F3 were connected together according to the instruction manual of the kit (One step cloning kit, Vazyme Biotech, Nanjing, China), and the pTD-KAST-APSK plasmid was obtained by sequencing verification.

[0060] (3) Introduce pCas plasmid (Addgene Plasmid #62225) into SSC8 (E. coli W3110, pgk / serA f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / ΔpoxB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / Δylb E-cysE f / ΔyjhE-cysE f), transfer the monoclonal colony to an LB test tube containing 0.05 mg / L kanamycin, and culture at 30°C overnight; then inoculate it into a 250 mL shake flask containing 50 mL LB medium at a volume concentration of 1%, and add 500 μl 1 mol / L L-arabinose, and culture at 150 rpm and 30°C until OD6000 is 0.4-0.6; collect the cells by centrifugation at 4000 rpm and 4°C for 10 min to prepare the electroporation competent state. The detailed process is described in (Molecular Cloning: A Laboratory Manual, 3ed Edition, 99-102).

[0061] (4) Use a pipette to take an appropriate amount of pTD-KAST-APSK plasmid (about 200 ng) and mix it with 100 μl of electroporation competent cells prepared in advance, and transfer them together into a pre-cooled 2 mm electroporation cup. After an ice bath for about 1-2 minutes, use an electroporator (MicroPluserTM, BIO-RAD) for electroporation transformation. After the electroporation is completed, immediately add 800 μl of LB culture medium and immediately and gently aspirate it, transfer it to a 2 mL Eppendorf tube, and after reviving at 30°C for 3-4 hours, apply it to an LB solid plate containing 0.05 mg / L kanamycin and 0.05 mg / L spectinomycin, and incubate it upside down at 30°C for 12-16 hours. Perform colony PCR verification using yjhw-KA-F / R as primers. If a fragment of about 2530 bp can be successfully cloned, it proves to be a SSC8-2YJ1 (SSC8 derivative, yjhw::MET3-N7489_009139) positive colony.

[0062] (5) Plasmid elimination: Use an inoculation loop to pick up a positive single colony and inoculate it into a LB liquid test tube containing 1 mM IPTG and 0.05 mg / L kanamycin. Culture it at 30°C overnight. The next day, streak the bacterial liquid onto a solid LB plate containing 0.05 mg / L kanamycin and culture it at 30°C for 24 h. When the bacteria grow to a certain size, pick some single colonies and streak them onto a LB plate containing 0.05 mg / L spectinomycin. Single colonies that cannot be streaked onto the LB plate containing 0.05 mg / L spectinomycin indicate that their pTarget-yjhw plasmid has been successfully eliminated. Single colonies with successfully eliminated pTarget-yjhw plasmid were picked up in LB test tubes and cultured overnight at 37°C to eliminate pCas plasmid. The next day, the bacterial solution was streaked on LB plates. After culturing at 37°C for 12 hours, some single colonies were picked up and streaked on LB plates containing 0.05 mg / L kanamycin. Single colonies that could not be streaked on LB plates containing 0.05 mg / L kanamycin had their pCas plasmid successfully eliminated, and finally the plasmid-free strain SSC8-2YJ1 (SSC8 derivative, yjhw::MET3-N7489_009139) was obtained.

[0063] (6) The constructed SSC8-2YJ1 production strain was used as the control group, and the shake flask test and detection were carried out according to the method of Example 1 (4). 600 and the L-cysteine ​​content in the fermentation broth Figure 3 shown.

[0064] As can be seen from the figure, increasing the copy number of heterologous MET3 and N7489_009139 genes in the genome by gene knock-in did not affect the growth of the bacteria. Compared with SSC8, the L-cysteine ​​shake flask titer of SSC8-2YJ1 was increased to 4.84 g / L. It may be that the introduction of the heterologous double genes enhanced the sulfate pathway to promote the synthesis of sulfur donors, thereby promoting the biosynthesis of L-cysteine ​​in the strain.

[0065] Example 3: TKA3 construction and shake flask fermentation

[0066] Using SSC8 as the starting strain, plasmid overexpression was used to overexpress MET3 and N7489_009139 heterologous genes (nucleotide sequences are shown in SEQ ID No.1 and SEQ ID No.2) using pTrc99a plasmid. Both genes used Trc promoter to regulate gene expression to enhance the intensity of PAPS synthesis in the strain.

[0067] (1) Construction of pTrc99a-Trc (KAST / APSK) plasmid: First, using pTrc99a-KAST-APSK plasmid as a template and primers 99a-KF and 99a-TK-R, 99a-TA-F and 99a-AR, PCR was used to amplify the KAST fragment (K3) having the upper homology arm of the pTrc99a plasmid with the Trc promoter and the lower homology arm of the APSK fragment with the Trc promoter, and the APSK fragment (A3) having the KAST fragment and the upper homology arm of the promoter Trc and the lower homology arm of the pTrc99a plasmid; the three fragments were verified by nucleic acid gel electrophoresis, digested with Dpn I digestion enzyme at 37°C for 3 h, purified with a Clean up kit and then purified by (One step clone kit, Vazyme Biotech, Nanjing, China) instructions: connect the pTrc99a vector, K3, and A3 fragments by fusion PCR, transform the PCR product into E. coli DH5α, screen on kanamycin sulfate plates, and sequence to verify the correct pTrc99a-Trc (KAST / APSK) plasmid. The plasmid was extracted and transformed into SSC8 chassis bacteria for overexpression to obtain TKA3.

[0068] (2) The constructed TKA3 production strain was used as a control group with the TKA1 constructed in Example 1, and the shake flask test and detection were carried out according to the method of Example 1 (4). 600 and the L-cysteine ​​content in the fermentation broth Figure 4 shown.

[0069] As can be seen from the figure, after adding a double Trc promoter to the heterologous double gene on the basis of TKA1 using an overexpression plasmid, the bacterial growth concentration was higher. Compared with TKA1, the L-cysteine ​​shake flask titer of TKA3 was increased to 4.93g / L. It may be that the Trc promoter has an enhancing effect on the gene encoding APS kinase, thereby promoting the biosynthesis of L-cysteine ​​in the strain.

[0070] Example 4: Construction of SSC8-2YJ2 and shake flask fermentation

[0071] Taking SSC8 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to replace the in situ promoter of the cysD gene in its genome with Ptrc (nucleotide sequence as shown in SEQ.ID NO.3) to enhance the ability of SSC8 chassis bacteria to synthesize PAPS and the intensity of sulfate metabolism.

[0072] (1) Construction of pTarget-cysD::Ptrc plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as a template and pT-cysD-F / R as primers for PCR amplification. The PCR product was digested with Dpn I at 37°C for 3 h. The PCR product of pTarget-cysD::Ptrc was amplified with linearized primers pTarget-PLine-F / R, and the pTarget-cysD::Ptrc linearized vector was purified with a Clean up kit for subsequent ligation with Donor DNA.

[0073] (2) Construction of pTD-cysD::Ptrc plasmid: Using the E. coli W3110 genome as a template, cysD-S5F / R primers were used to amplify the upstream part of the donor DNA (F1), cysD-X5F / R primers were used to amplify the downstream part of the donor DNA (F2), and pTrc99a plasmid was used as a template and Trc-F / R primers were used to amplify the fragment containing the homologous arms of the upstream and downstream parts of the donor DNA (F3). (One step clone kit, Vazyme Biotech, Nanjing, China) instructions pTarget-cysD::Ptrc linearized vector, fragments F1, F2, F3 were connected together, and the construction steps were the same as Example 2

[0074] (2) and obtain the pTD-cysD::Ptrc plasmid.

[0075] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the SSC8 competent cell. The method for preparing the SSC8 competent cell was the same as that in Example 2 (3).

[0076] (4) SSC8-2YJ2 positive colonies were constructed using the same construction method as in Example 2 (4).

[0077] (5) Plasmid elimination: The implementation method is the same as Example 2 (5) to obtain plasmid-free SSC8-2YJ2.

[0078] (6) The constructed SSC8-2YJ2 production strain was used as the control group, and the shake flask test and detection were carried out according to the method of Example 2 (6). 600 And the content of L-cysteine ​​in the fermentation broth is as follows Figure 5 shown.

[0079] As can be seen from the figure, after replacing the in situ promoter of the cysD gene with Ptrc through gene editing on the genome, the L-cysteine ​​production increased to 5.74g / L. The original cysD gene expression was insufficient, and the strong promoter was used to increase the expression, strengthen the sulfate pathway, and promote the increase of L-cysteine ​​production.

[0080] Example 5: Construction of SSC8-2YJ3 and shake flask fermentation

[0081] The engineered bacteria SSC8-2YJ2 prepared in Example 4 was used as the starting strain, and CRISPR-Cas9-mediated gene editing technology was used to replace the original pseudogene yjhw on the genome of the starting strain by gene knock-in, with the MET3 and N7489_009139 genes, which were respectively regulated by the Ptrc promoter derived from pTrc99A, to enhance the ability to synthesize PAPS and the intensity of sulfate metabolism.

[0082] (1) Construction of pTarget-yjhw plasmid: The construction method is the same as Example 2(1).

[0083] (2) Construction of pTD-yjhw-Trc (KAST / APSK) plasmid: First, the upstream portion (F1) of donor DNA and the downstream portion (F2) of donor DNA were obtained by the method of Example 2 (2). Then, the plasmid constructed in Example 3 (1) was used as a template, and 99a-TKTA-F / R was used as primers to amplify the KAST fragment with promoter pTrc and the APSK fragment with Trc promoter (F3). The PCR fragments were purified by Clean up kit to obtain F1, F2 and F3; The pTarget-yjhw vector, fragments F1, F2, and F3 were connected together according to the instruction manual of the kit (One step cloning kit, Vazyme Biotech, Nanjing, China), and the pTD-yjhw-Trc (KAST / APSK) plasmid was obtained by sequencing verification.

[0084] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the SSC8-2YJ2 competent cell obtained in Example 4. The preparation method of the SSC8-2YJ2 competent cell by electroporation was the same as that in Example 2 (3).

[0085] (4) SSC8-2YJ3 positive colonies were constructed using the same method as in Example 2 (4).

[0086] (5) Plasmid elimination: The implementation method is the same as Example 2 (5) to obtain plasmid-free SSC8-2YJ3.

[0087] (6) The constructed SSC8-2YJ3 production strain was used as a control group with the SSC8-2YJ2 constructed in Example 4, and the shake flask test and detection were carried out according to the method of Example 2 (6). 600 and the L-cysteine ​​content in the fermentation broth Figure 6 shown.

[0088] As can be seen from the figure, after enhancing the key genes of the sulfate pathway, the L-cysteine ​​production still increased significantly by about 6.06 g / L after increasing the copy number of heterologous MET3 and N7489_009139 genes at the pseudogene loci on the genome by gene knock-in. This shows the importance of sulfur flux in the pathway to L-cysteine ​​synthesis, and enhancing the sulfate pathway can promote the increase of L-cysteine ​​production in shake flasks.

[0089] The OD obtained after the shake flask test of the engineered strains constructed in Examples 1 to 5 was 600The results of L-cysteine ​​content in the fermentation broth are shown in Table 3. Compared with the method of introducing heterologous double genes by plasmid and regulating by double Trc promoter (engineering bacteria TKA3), the present invention attempts to introduce heterologous double genes into chassis bacteria (engineering bacteria SSC8-2YJ1) by knocking genes into the pseudogene site of chassis strains and overexpressing them. The results show that the heterologous double genes can be well expressed at the pseudogene site yjhw, thereby strengthening the sulfate pathway and promoting the synthesis of sulfur donors. Its effect on increasing L-cysteine ​​production (18.9%) is close to that of the plasmid introduction method (21.3%). Furthermore, based on the engineered bacteria SSC8-2YJ1, the present invention uses CRISPR-Cas9-mediated gene editing technology to continue to enhance the expression level of the key enzyme encoding gene cysD in the L-cysteine ​​bioproduction pathway, thereby obtaining a high-yield strain SSC8-2YJ3 that is free of plasmids and does not require the addition of antibiotics during the fermentation process. The L-cysteine ​​production is increased by 25.3% compared with the engineered bacteria SSC8-2YJ1 and by 49.2% compared with the starting strain. This improvement effect is unexpected, and an unexpected technical effect is achieved.

[0090] Table 3: OD of different strains 600 and L-cysteine ​​production

[0091] Strain Genotype <![CDATA[OD 600 ]]> Titer (g / L) SSC8 SSC8 22.707±0.927 4.065±0.099 TKA1 SSC8 derivative, pTrc99a-MET3-N7489_009139 18.093±0.554 4.066±0.058 TKA2 SSC8 derivative, pTrc99a-KAST-Linker-APSK 24.933±0.560 3.728±0.059 SSC8-2YJ1 SSC8 derivative, yjhw::MET3-N7489_009139 23.373±1.086 4.833±0.179 TKA3 SSC8 derivative, pTrc(MET3,N7489_009139) 29.720±0.861 4.930±0.132 SSC8-2YJ2 SSC8 derivative, cysD::Ptrc 27.133±1.102 5.740±0.105 <h2 style=";text-align:left;direction:ltr">SSC8-2YJ3 <h2 style=";text-align:left;direction:ltr"> SSC8 derivative, cysD::Ptrc / yjhw::Ptrc:MET3(KI),N7489_009139(KI) 24.680±0.520 6.057±0.086

[0092] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A method for constructing a high-yield L-cysteine ​​engineering bacterium, characterized in that: The method comprises: enhancing the ability to synthesize 3'-phosphoadenosine-5'-phosphosulfate in a chassis strain; Wherein, the method for enhancing the synthesis ability of 3'-phosphoadenosine-5'-phosphosulfate comprises at least one of the following: (1) Introducing and overexpressing the MET3 gene from Kluyveromyces lactis GG799 into the bottom plate bacteria; (2) Introducing and overexpressing the N7489_009139 gene from Penicillium chrysogenum into the bottom plate bacteria; (3) Overexpression of the cysD gene in the genome of the chassis bacteria.

2. The method according to claim 1, characterized in that The method for enhancing the synthesis ability of 3'-phosphoadenosine-5'-phosphosulfate comprises: using CRISPR-Cas9-mediated gene editing technology to replace the in situ promoter of the cysD gene in the chassis bacteria genome with the Trc promoter and then overexpress it.

3. The method according to claim 1, characterized in that The method for enhancing the ability to synthesize 3'-phosphoadenosine-5'-phosphosulfate comprises: using CRISPR-Cas9-mediated gene editing technology to replace the original pseudogene yjhw on the chassis bacteria genome with the MET3 gene and the N7489_009139 gene and then over-expressing them.

4. The method according to claim 1, characterized in that The method for enhancing the synthesis ability of 3'-adenosine phosphate-5'-phosphosulfate comprises: constructing the MET3 gene and the N7489_009139 gene into the pTrc99a plasmid and then transferring them into the chassis bacteria for overexpression.

5. The method according to claim 1, characterized in that The method for enhancing the ability to synthesize 3'-phosphoadenosine-5'-phosphosulfate comprises: using CRISPR-Cas9-mediated gene editing technology to replace the in situ promoter of the cysD gene in the chassis bacteria genome with the Trc promoter and then overexpress it, and replacing the original pseudogene yjhw on the chassis bacteria genome with the MET3 gene and the N7489_009139 gene and then overexpressing it.

6. The method according to claim 1, characterized in that The chassis bacterium is: E. coli W3110, pgk / serA f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / ΔpoxB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / ΔylbE-cysE f / ΔyjhE-cysE f .

7. The method according to claim 1, characterized in that The nucleotide sequence of the MET3 gene is shown in SEQ ID NO.1; the nucleotide sequence of the N7489_009139 gene is shown in SEQ ID NO.

2.

8. An engineered bacterium with high L-cysteine ​​production obtained by the method according to any one of claims 1 to 7.

9. The high-yield L-cysteine ​​engineering bacteria according to claim 8, characterized in that: Any of the following: (1)E.coli W3110,pgk / serA f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / Δpo xB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / ΔylbE-cysE f / ΔyjhE-cysE f / yjhw::MET3-N7489_009139; (2)E.coli W3110,pgk / serA f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / Δpo xB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / ΔylbE-cysE f / ΔyjhE-cysE f / cysD::Ptrc: <h2 style=";text-align:left;direction:ltr">(3) E.coli W3110, pgk / serA<h2 style=";text-align:left;direction:ltr"> f <h2 style=";text-align:left;direction:ltr"> / serB / serC / cysE<h2 style=";text-align:left;direction:ltr"> f <h2 style=";text-align:left;direction:ltr"> / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / Δpo xB / ΔmetR / eamA / eamB<h2 style=";text-align:left;direction:ltr"> f <h2 style=";text-align:left;direction:ltr"> / tolC / ΔydjN / ΔyjiP-cysE<h2 style=";text-align:left;direction:ltr"> f <h2 style=";text-align:left;direction:ltr"> / ΔyjiR-cysE<h2 style=";text-align:left;direction:ltr"> f <h2 style=";text-align:left;direction:ltr"> / ΔyeeJ-cysE<h2 style=";text-align:left;direction:ltr"> f <h2 style=";text-align:left;direction:ltr"> / ΔycdN-cysE<h2 style=";text-align:left;direction:ltr"> f <h2 style=";text-align:left;direction:ltr"> / ΔydeU-cysE<h2 style=";text-align:left;direction:ltr"> f <h2 style=";text-align:left;direction:ltr"> / ΔylbE-cysE<h2 style=";text-align:left;direction:ltr"> f <h2 style=";text-align:left;direction:ltr"> / ΔyjhE-cysE<h2 style=";text-align:left;direction:ltr"> f <h2 style=";text-align:left;direction:ltr"> / cysD::Ptrc / yjhw::Ptrc:MET3(KI),N7489_009139(KI); (4)E.coli W3110,pgk / serA f / serB / serC / cysE f / cysB / ΔsdaA / ΔsdaB / ΔtdcG / Δyham / ΔtnaA / ΔyciW / ΔgpmA / ΔpykF / Δpo xB / ΔmetR / eamA / eamB f / tolC / ΔydjN / ΔyjiP-cysE f / ΔyjiR-cysE f / ΔyeeJ-cysE f / ΔycdN-cysE f / ΔydeU-cysE f / ΔylbE-cysE f / ΔyjhE-cysE f / pTrc(MET3,N7489_009139)。 10. Use of the high-yield L-cysteine ​​engineering bacteria according to claim 8 in preparing L-cysteine ​​by microbial fermentation.

Images