Method for regulating intracellular and extracellular synthesis positions of nano zero-valent palladium and method for regulating adsorbing capacity of palladium liquid

Abstract

The invention discloses a method for regulating and controlling intracellular and extracellular synthesis positions of nano zero-valent palladium and a method for regulating and controlling the adsorbing capacity of palladium liquid, and belongs to the technical field of genetic engineering technology and nano material preparation. The invention aims to provide a method for regulating and controlling intracellular and extracellular synthesis positions of nano zero-valent palladium. The invention discloses a method for regulating and controlling intracellular and extracellular synthesis positions of nano zero-valent palladium, which comprises the following steps of: incubating recombinant escherichia coli by using palladium liquid, and reacting under an anaerobic condition by using formate as an enzyme substrate to regulate and control the positions of the nano zero-valent palladium; according to the recombinant escherichia coli, any one or two of genes for coding catalytic subunits of [NiFe] hydrogenase 1 and [NiFe] hydrogenase 2 are knocked out on the basis of original escherichia coli. A mild hydrogen source is used for replacing a traditional dangerous hydrogen source, and intracellular and extracellular directional synthesis of nano-palladium is achieved through strain modification. The method is expected to have great application potential in metal nanoparticle preparation, environmental restoration, biomedicine and chemical industry.

Description

Technical Field

[0001] The invention belongs to the field of gene engineering technology and nano material preparation technology, and specifically relates to a method for regulating the intracellular and extracellular synthesis positions of nano zero-valent palladium and a method for regulating the adsorption amount of palladium liquid. Background Art

[0002] Nanometal catalysts are catalysts whose active sites are composed of nanoscale metal particles. In the field of catalysis, many metal catalysts and their oxides exhibit special properties because they can provide empty orbitals or electrons in chemical reactions, thereby producing intermediates, reducing the activation energy of the reaction, and making subsequent reactions easier. In particular, nanometal catalysts, due to their unique surface effects, quantum size effects, macroscopic quantum tunneling effects and other properties, show many unique properties, and combine the advantages of homogeneous catalysts and heterogeneous catalysts. They have the characteristics of high activity, high stability, high selectivity, easy recovery, good economy and environmental friendliness. Therefore, the catalytic performance of nanometal catalysts is significantly better than that of traditional catalysts, and they are called fourth-generation catalysts at home and abroad. They are mainly used in catalytic reactions, drug delivery, environmental protection, battery applications and solid propellants.

[0003] There are many hosts for the biological synthesis of nanoparticles, including plants, microorganisms such as bacteria and fungi. These hosts synthesize different types of nanoparticles through their own unique biological processes, providing new methods and tools for the fields of materials science and nanotechnology. Bacteria are very abundant in the environment, have strong adaptability, reproduce quickly, and have low cultivation costs. They have received extensive attention in the biological synthesis of nanoparticles. The ability of bacteria to convert metal ions into nanoparticles is mainly attributed to intracellular proteins, enzymes and other biochemical substances. At present, there are pathways for the biosynthesis of Pd NPs using microorganisms as carriers, most of which are based on H 2 As a hydrogen source, Pd is reduced by enzymatic reaction 2+ However, the use of hydrogen is dangerous and 2 In the synthesis process of hydrogen source, due to the position of the catalytic subunit of the key enzyme, the product position is single and uncontrollable. Precise regulation of the synthesis position of PdNPs is crucial to unleash the potential of metal-enzyme cascade catalysis, which is expected to provide a new reference strategy for the development of non-natural products and drugs. Summary of the invention

[0004] The purpose of the present invention is to provide a method for regulating the intracellular and extracellular synthesis locations of nano zero-valent palladium.

[0005] The present invention provides a method for regulating the intracellular and extracellular synthesis locations of nano zero-valent palladium. After incubating recombinant Escherichia coli with a palladium solution, formate is used as an enzyme substrate to react under anaerobic conditions to regulate the location of the nano zero-valent palladium. The recombinant Escherichia coli is based on the original Escherichia coli and any one or two of the genes encoding the catalytic subunits of [NiFe] hydrogenase 1 and [NiFe] hydrogenase 2 are knocked out.

[0006] It is further defined that the palladium solution is Na 2 PdCl 4 Aqueous solution or K 2 PdCl 4 Aqueous solution.

[0007] It is further defined that the concentration of the palladium solution is 0.5-1.5 mM, the incubation temperature is 20-50° C., the time is 20-30 min, and the pH is 3.5-6.

[0008] It is further defined that the water-soluble formate is an aqueous solution of HCOONa or an aqueous solution of HCOOK.

[0009] It is further defined that the formate concentration in the reaction system is 5-25 mM and the reaction time is 24-72 h.

[0010] Further defined, the sequence of the gene encoding the [NiFe] hydrogenase 1 catalytic subunit is shown as SEQ ID NO.1; and the sequence of the gene encoding the [NiFe] hydrogenase 2 catalytic subunit is shown as SEQ ID NO.2.

[0011] The present invention provides an application of the above-mentioned recombinant Escherichia coli in regulating the adsorption amount of palladium liquid.

[0012] It is further defined that the palladium solution is Na 2 PdCl 4 Aqueous solution or K 2 PdCl 4 aqueous solution; the concentration of the palladium solution is 0.5-1.5mM.

[0013] The present invention provides a method for regulating the adsorption amount of palladium liquid. The recombinant Escherichia coli is placed in the palladium liquid and reacted for 20-30 minutes.

[0014] It is further defined that the palladium solution is Na 2 PdCl 4 Aqueous solution or K 2 PdCl 4 aqueous solution; the concentration of the palladium solution is 0.5-1.5mM.

[0015] Beneficial effects: The present invention uses Escherichia coli MC4100 as the starting strain, uses the Kan fragment with the homologous arm of the target gene to transform Escherichia coli, and uses the homologous recombination technology to knock out the genes hyaB and hybC on the Escherichia coli genome, and successfully constructs the genetically engineered bacteria MC4100 (ΔhyaB, ΔhybC), making it unable to express [NiFe] hydrogenase 1 and [NiFe] hydrogenase 2, laying an experimental foundation for the synthesis position of nano-palladium. The bacteria can adsorb palladium ions and reduce palladium ions through sodium formate as an electron donor to form black biological palladium nanoparticles. This can be achieved within the conditions of biomass 0.4-0.5g / L, sodium formate concentration 5-25mM, palladium ion concentration less than 2mM, temperature 20-50°C and pH 2.2-7. The product is characterized by transmission electron microscopy (TEM) and X-ray photoelectron spectroscopy (XPS), indicating that Escherichia coli can adsorb and reduce palladium ions to form nanoparticles that can be regulated inside or outside the cell. Compared with the current synthesis cases of palladium, the present invention uses a mild hydrogen source instead of a traditional hazardous hydrogen source, and realizes the directional synthesis of nano-palladium inside and outside the cell through strain modification. This method is expected to have great application potential in the preparation of metal nanoparticles, environmental remediation, biomedicine and chemical industries. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is the agarose gel electrophoresis diagram of different strains in Example 1;

[0017] Figure 2 Transmission electron microscope images of strains with different Pd NPs loads in Example 2;

[0018] Figure 3 EDS and XPS spectra of the Pd NPs-loaded strain MC4100 (ΔhyaB, ΔhybC) in Example 2;

[0019] Figure 4 Transmission electron microscope images of strains with different Pd NPs loads in Example 2;

[0020] Figure 5 EDS and XPS spectra of the Pd NPs-loaded strain MC4100 (ΔhyaB, ΔhybC) in Example 2;

[0021] Figure 6 is the size distribution histogram of Pd NPs synthesized intracellularly in MC4100-S;

[0022] Figure 7 Pd 2+ The variation of adsorption rate and adsorption amount per mg of MC4100-S with the pH of the system;

[0023] Figure 8TEM dark field images of MC4100-S loaded with Pd NPs prepared under different pH conditions; AH are original TEM images of double knockout bacteria sections at pH 2.2-pH 6, A: pH 2.2; B: pH 3; C: pH 3.5; D: pH 4; E: pH 4.5; F: pH 5; G: pH 5.5; H: pH 6;

[0024] Fig. 9 Pd in ​​MC4100-S loaded with Pd NPs prepared under different pH conditions 0 / Pd 2+ proportion. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited by the embodiments.

[0026] Unless otherwise specified, the materials, reagents, instruments and methods used in the following examples are conventional materials, reagents, instruments and methods in the art and can be obtained through commercial channels.

[0027] Culture medium formula: LB medium: 10 g / L peptone, 5 g / L yeast powder, 10 g / L NaCl, the rest is water, 121°C, sterilization for 20 min.

[0028] Example 1. Construction of genetically engineered bacteria MC4100 (ΔhyaB, ΔhybC)

[0029] 1) Add 5 μL of plasmid pKD46 to 100 μL of MC4100 heat shock competent cells, mix gently, place on ice for 30 min, heat shock in a 42°C water bath for 45 s, immediately place on ice for 5 min, add 700 μL of LB liquid culture medium, place in a shaker at 30°C, 200 rpm for 1 h, centrifuge at 7000 rpm for 3 min, remove 700 μL of supernatant, resuspend the remaining bacteria, and evenly spread the bacterial solution on the solid LB culture medium with Amp with a sterile spreading stick, place in an incubator at 30°C and invert for 12-16 h to obtain strain MC4100 (pKD46). Then, the Kan-resistant fragment with the hyaB homology arm was used to electrotransform MC4100 (pKD46). The voltage of the electroporator was adjusted to 2500 V. An appropriate amount of donor DNA was aspirated and added to the bacterial solution in the ice bath. The mixture was immediately aspirated into the electroporation cup. 600 μL of LB medium was aspirated and the electroporation button was pressed at the same time. After the electroporation, LB medium was immediately added to the electroporation cup. The mixture was aspirated into a centrifuge tube. The tube was incubated at 37°C for 2 h. After centrifugation at 7000 rpm for 3 min, the supernatant was discarded and the remaining 100 μL was coated on the Kan plate. The tube was incubated at 37°C overnight to obtain the single-knockout MC4100 (ΔhyaB).

[0030] 2) The construction process of MC4100 (ΔhybC) is the same as above, except that the gene hyaB is replaced by hybC.

[0031] 3) The strain MC4100 (ΔhyaB) was made heat-shock competent, transformed with plasmid pCP20, coated on Amp plates, and cultured at 30°C overnight to heat-induce the expression of FLP recombinase and eliminate the Kan gene. The grown monoclonal was streaked on a non-resistant plate. After the colonies grew out at 30°C, the temperature was raised to 42°C and cultured overnight. The plasmid was gradually lost. The grown monoclonal was divided and streaked on Kan and Amp plates and cultured at 30°C to observe the results of resistance elimination and pCP20 plasmid loss. The same monoclonal did not grow on Kan and Amp plates. Growth on the non-resistant plate indicated that Kan was eliminated and the pCP20 plasmid was lost, thus obtaining the MC4100 (ΔhyaB) strain.

[0032] 4) Add 5 μL of plasmid pKD46 to 100 μL of MC4100 (ΔhyaB) competent cells, mix gently, place on ice for 30 min, heat shock in a 42°C water bath for 45 s, immediately place on ice for 5 min, add 700 μL of LB liquid culture medium, place in a shaker at 30°C, 200 rpm for 1 h, centrifuge at 7000 rpm for 3 min, remove 700 μL of supernatant, resuspend the remaining bacteria, and evenly spread the bacterial solution on the solid LB culture medium with Amp with a sterile spreading stick, place in an incubator at 30°C and invert for 12-16 h to obtain strain MC4100 (ΔhyaB, pKD46). Then, the Kan-resistant fragment with the hybC homology arm was used to electrotransform MC4100 (ΔhyaB, pKD46), and the voltage of the electroporator was adjusted to 2500V. An appropriate amount of donor DNA was aspirated and added to the bacterial solution in the ice bath, mixed and immediately aspirated into the electroporation cup, 600μL of LB medium was aspirated, and the electroporation button was pressed at the same time. After the electroporation, LB medium was immediately added to the electroporation cup, mixed and aspirated into a centrifuge tube, incubated at 37°C for 2h, centrifuged at 7000rpm for 3min, discarded the supernatant, and the remaining 100μL was coated on the Kan plate, and cultured at 37°C overnight. At this point, the double-knockout bacteria MC4100 (ΔhyaB, ΔhybC) were obtained.

[0033] Agarose gel electrophoresis results Figure 1As shown. Ya and Yb are wild bacteria MC4100, Ya corresponds to hyaB and homology arms, with a theoretical size of 1994bp; Yb corresponds to hybC and homology arms, with a theoretical size of 1904bp. Da corresponds to strain MC4100 (ΔhyaB), and Db corresponds to single knockout strain MC4100 (ΔhybC). The theoretical size of the bands is 1417bp. Sa and Sb are double knockout bacteria MC4100 (ΔhyaB, ΔhybC), Sa corresponds to hyaB homology arms, with a theoretical size of 308bp; Sb corresponds to Kan and hybC homology arms, with a theoretical size of 1417bp. The positions of the bands are consistent with the theoretical results, and through sequencing comparison, the map similarity is very high. Through gel electrophoresis detection and comprehensive analysis of sequencing results, it can be determined that the gene knockout is successful. hyaB sequence: (SEQ IDNO.1)

[0034] ATGAGCACTCAGTACGAAACTCAGGGATACACCATCAATAATGCCGGACGCCGCCTG

[0035] GTGGTCGACCCGATTACGCGCATCGAAGGCCACATGCGCTGCGAAGTGAATATTAAC

[0036] GATCAGAATGTGATCACCAATGCCGTCTCCTGCGGCACCATGTTTCGCGGGCTGGAGA

[0037] TCATCCTACAAGGGCGCGACCCGCGCGATGCGTGGGCGTTCGTTGAACGTATCTGCGG

[0038] CGTCTGTACTGGCGTACACGCCCTGGCTTCGGTTTACGCCATCGAAGATGCTATCGGT

[0039] ATTAAAGTGCCGGACAACGCCAATATCATCCGCAACATTATGCTGGCAACGCTCTGGT

[0040] GCCACGATCATCTGGTGCACTTCTATCAGCTTGCCGGGATGGACTGGATCGATGTGTT

[0041] AGATGCGCTGAAAGCCGACCCGCGGAAAACCTCCGAACTGGCGCAAAGTCTCTCCTC

[0042] TTGGCCGAAATCATCCCCTGGCTATTTCTTCGACGTACAAAACCGCCTGAAAAAATTT

[0043] GTTGAAGGCGGGCAGTTGGGGATCTTCCGCAATGGCTACTGGGGGCACCCGCAGTAC

[0044] AAACTGCCGCCAGAAGCTAACCTGATGGGCTTTGCCCACTATCTCGAAGCTCTCGATT

[0045] TCCAGCGTGAAATTGTCAAAATCCACGCGGTCTTTGGCGGTAAAAACCCGCATCCAAA

[0046] CTGGATTGTCGGCGGGATGCCTTGCGCCATCAACATTGACGAAAGCGGCGCGGTCGG

[0047] GGCAGTCAATATGGAACGCCTGAACCTGGTGCAGTCAATTATCACCCGCACGGCGGA

[0048] CTTCATTAACAACGTGATGATCCCCGACGCCTTAGCCATCGGTCAGTTCAACAAACCG

[0049] TGGAGCGAAATCGGCACTGGTCTTTCTGATAAATGCGTTCTCAGCTACGGCGCATTCC

[0050] CGGATATTGCCAACGACTTTGGCGAGAAAAGTCTGCTGATGCCTGGCGGCGCGGTGAT

[0051] TAACGGCGACTTCAACAATGTGCTGCCAGTGGATTTGGTTGATCCGCAGCAGGTGCAG

[0052] GAGTTTGTCGACCACGCCTGGTATCGATATCCCAACGATCAGGTCGGGCGTCATCCGT

[0053] TCGATGGCATCACCGACCCGTGGTACAACCCCGGCGATGTCAAAGGCAGCGATACCA

[0054] ACATTCAGCAGCTGAATGAACAGGAACGCTACTCGTGGATCAAAGCGCCACGCTGGC

[0055] GCGGTAACGCGATGGAAGTGGGGCCGCTGGCGCGCACGTTAATCGCTTATCACAAAG

[0056] GCGATGCTGCGACCGTTGAGTCGGTCGATCGCATGATGTCGGCGTTGAACCTGCCGCT

[0057] TTCCGGTATCCAGTCAACGTTAGGCCGCATTTTGTGCCGCGCGCACGAAGCGCAGTGG

[0058] GCCGCAGGTAAGTTGCAGTATTTCTTCGACAAGCTGATGACCAACCTGAAAAACGGC

[0059] AATCTCGCCACTGCTTCCACGGAAAAATGGGAACCTGCAACCTGGCCGACAGAGTGC

[0060] CGTGGTGTCGGTTTTACCGAAGCGCCGCGCGGGGCGTTAGGCCACTGGGCCGCCATTC

[0061] GCGATGGCAAGATTGATCTCTACCAGTGCGTGGTGCCGACCACCTGGAACGCCAGCCC

[0062] GCGCGATCCCAAAGGGCAGATTGGCGCTTATGAAGCGGCGCTGATGAACACCAAAAT

[0063] GGCGATCCCCGAGCAACCGCTGGAGATCCTGCGTACTCTGCACAGCTTTGACCCGTGC

[0064] CTCGCCTGTTCAACACACGTGCTGGGCGACGACGGTAGCGAGCTGATCTCCGTGCAGG

[0065] TGCGTTAA

[0066] hybC sequence: (SEQ ID NO.2)

[0067] ATGAGCCAGAGAATTACTATTGATCCGGTAACCCGTATTGAGGGGCATTTACGCATCG

[0068] ATTGCGAAATCGAAAATGGCGTCGTTTCGAAAGCATGGGCTTCCGGTACCATGTGGCG

[0069] CGGCATGGAAGAGATCGTGAAAAACCGCGATCCGCGCGATGCATGGATGATTGTGCA

[0070] ACGTATCTGTGGCGTATGTACTACCACTCACGCGCTGTCTTCCGTTCGTGCGGCAGAA

[0071] AGTGCGCTGAATATCGACGTTCCGGTTAACGCGCAATACATCCGTAACATCATTCTGG

[0072] CTGCGCACACCACGCATGACCATATTGTTCATTTCTATCAGCTTTCGGCGCTGGACTGG

[0073] GTGGACATCACTTCTGCACTGCAAGCTGACCCAACCAAAGCCTCCGAAATGCTGAAA

[0074] GGCGTTTCGACCTGGCACCTGAACAGTCCGGAAGAGTTCACCAAAGTTCAGAACAAG

[0075] ATCAAAGATCTGGTTGCCAGCGGTCAGTTGGGTATTTTCGCTAATGGCTACTGGGGTC

[0076] ATCCGGCGATGAAACTGCCGCCGGAAGTGAACCTGATTGCGGTAGCGCACTACCTGC

[0077] AAGCGTTGGAGTGCCAGCGTGACGCTAACCGCGTCGTGGCGCTGCTGGGCGGTAAAA

[0078] CGCCGCACATTCAGAACCTGGCGGTAGGTGGTGTCGCGAACCCGATCAACCTCGACG

[0079] GTTTGGGCGTGCTGAACCTTGAGCGCCTGATGTACATCAAGTCTTTCATCGACAAACT

[0080] GAGCGACTTTGTTGAGCAGGTTTATAAGGTTGATACCGCAGTTATTGCCGCGTTCTAC

[0081] CCGGAATGGCTGACACGCGGTAAAGGTGCGGTGAACTACCTGAGCGTGCCGGAATTC

[0082] CCGACCGACAGTAAAAACGGCAGCTTCCTGTTCCCGGGCGGCTACATTGAGAATGCG

[0083] GATCTGTCCTCGTATCGTCCGATCACTTCTCATTCCGATGAATACCTGATCAAAGGCAT

[0084] TCAGGAAAGCGCGAAGCACTCCTGGTATAAAGACGAAGCGCCGCAGGCACCGTGGGA

[0085] AGGCACCACCATTCCGGCTTATGATGGTTGGTCTGACGACGGGAAATATTCCTGGGTG

[0086] AAATCACCGACTTTCTACGGCAAAACGGTAGAAGTGGGGCCACTGGCTAATATGCTG

[0087] GTGAAACTGGCGGCAGGTCGCGAATCTACCCAGAACAAACTGAATGAAATCGTTGCG

[0088] ATTTATCAGAAACTGACTGGCAACACGCTGGAAGTGGCACAGCTGCACTCCACGCTG

[0089] GGCCGTATTATTGGTCGTACCGTTCACTGCTGTGAATTGCAGGATATCCTGCAAAACC

[0090] AATACAGTGCACTGATCACCAATATCGGCAAAGGCGATCACACCACCTTTGTGAAGCC

[0091] GAAATTCCGGCAACGGGTGAATTCAAAGGTGTTGGCTTCCTCGAAGCGCCGCGCGGT

[0092] ATGCTCTCTCACTGGATGGTTATTAAAGACGGTATCATCAGCAACTACCAGGCGGTTG

[0093] TTCCATCAACCTGGAACTCTGGTCCGCGTAACTTCAATGATGACGTCGGTCCTTACGA

[0094] GCAGTCGCTGGTGGGTACACCGGTTGCCGATCCGAATAAACCGCTGGAAGTGGTGCG

[0095] TACCATTCACTCCTTTGACCCGTGCATGGCCTGTGCGGTACACGTAGTGGATGCTGACGGCAACGAAGTGGTTTCAGTGAAGGTTCTGTAA.

[0096] Example 2. A method for regulating the amount of palladium solution adsorbed and regulating the intracellular and extracellular synthesis locations of nano-zero-valent palladium. Three groups of experiments were conducted in this embodiment to illustrate the importance of the present invention.

[0097] Blank group: wild strain E. coli MC4100;

[0098] Control group: single knockout strains E. coli MC4100 (ΔhyaB) and E. coli MC4100 (ΔhybC);

[0099] Experimental group: The double knockout strain E. coli MC4100 (ΔhyaB, ΔhybC) was named MC4100-S.

[0100] The four activated strains were inoculated into a 50 mL centrifuge tube containing 45 mL of LB liquid medium (containing 50 mg / L kanamycin) at a ratio of 1:45, and cultured overnight at 37 °C under microaerobic conditions. The OD 600 The cells were diluted to 1.0±0.02, 80 mL of bacterial solution was added to each group, and the cells were centrifuged at 8000 rpm for 10 min to collect the cells, and the culture medium was removed by washing twice with MOPS buffer (pH=7). After washing, 80 mL of 1 mM Na 2 PdCl 4(pH 3.5), vortexed and incubated for 25 min, centrifuged at 8000 rpm for 10 min to collect the cells, washed twice with MOPS buffer, and retained the supernatant. The absorbance was calculated using SnCl 2 Methods: The residual palladium in the supernatant was measured for calculation. 80 mL of 25 mM sodium formate was added to the palladium-treated cells, transferred to a 250 mL anaerobic bottle, and shaken at 37 °C until the reaction mixture changed color (24 h). After the reaction, the cells were collected by centrifugation at 8000 rpm for 10 min. The product was fixed with 2.5% glutaraldehyde overnight, then dehydrated, infiltrated, dried, and sliced. Finally, the internal situation of the bacteria was observed using a high-resolution transmission electron microscope. XPS (X-ray photoelectron spectroscopy) sample preparation only requires the cells to be crushed and dried overnight in a freeze dryer, and then the valence distribution of Pd is tested and analyzed using an X-ray photoelectron spectrometer.

[0101] Figure 2 TEM image of Pd-loaded Escherichia coli in Example 2 (Na 2 PdCl 4 , pH = 3.5), where a is the wild bacteria MC4100, b and c are the single knockout bacteria MC4100 (ΔhyaB) and MC4100 (ΔhybC), respectively, and d is the double knockout bacteria MC4100 (ΔhyaB, ΔhybC). It can be seen from the figure that the white particles (zero-valent Pd) in a are mostly located in the periplasmic space and the outside of the membrane, and a small amount is located on the cytoplasmic side, the white particles in b and c are partly located in the periplasmic space and the outside of the membrane, and partly located on the inside of the membrane and in the cytoplasm, while most of the white particles in d are located in the cytoplasm and the inside of the membrane, and only a small amount of particles are located on the outside of the membrane and the periplasmic space. Figure 3 a in the figure is the result of EDS point scanning, and a Pd peak appears, indicating that the white particles are Pd. The product is tested by XPS, and the peak fitting results are as follows: Figure 3 As shown in b, the Pd in ​​the product exists in two forms: +2 valence and 0 valence. The appearance of 0 valence indicates that the synthesis process can achieve Pd 2+ The reduction of Pd nanoparticles was successfully obtained, and the +2 valence peak was higher than the 0 valence peak, indicating that the enzyme activity was low and the reducing ability was weak under this condition. In short, under pH 3.5, this pathway can achieve the biosynthesis of Pd nanoparticles, and the synthesis position is consistent with the theoretical results, indicating that the strain modification is successful.

[0102] The adsorption amount, yield and adsorption rate of zero-valent Pd of MC4100-S were tested: the results are as follows Figure 6-Figure 8 As shown, Figure 6Statistical analysis shows that the particle size of Pd NPs synthesized intracellularly is about 6 nm, which is presumably due to the intracellular biomolecules acting as capping agents and stabilizers. The adsorption of palladium by Escherichia coli under acidic conditions is mainly attributed to the electrostatic attraction between the two. And the experimental results are as follows Figure 7 As shown. As the pH gradually decreases, Pd 2+ The adsorption rate and the amount of adsorption per milligram of bacteria gradually increased. The adsorption amount at pH 2.2 can reach 137.38 mg / g, while the adsorption amount at pH 7 is only 27.13 mg / g. The adsorption rate at pH 2.2 increased by 44.83% compared with pH 7. Because Escherichia coli is a Gram-negative bacterium, its isoelectric point (pH PZC ) is 4.0-5.0, when the pH of the strain system is less than pH PZC When pH>pH PZC Therefore, at lower pH, the surface of the bacteria is positively charged, and Pd 2+ Mainly [PdCl 4 ] 2- It exists in a form that makes it easier to achieve cell adsorption through electrostatic action.

[0103] In order to study the effect of pH conditions on the location of Pd intracellular synthesis, the results are as follows Figure 8 As shown in the figure, MC4100-S synthesized Pd NPs under different pH conditions, and TEM was used to observe and analyze the synthesis position of Pd. It can be clearly seen that there are no white particles in the product spectrum under pH 2.2 conditions, while there are obvious white particles at pH 3.5-6. In addition, considering the influence of Os in the early stage, the products of this batch of experiments were not treated with Os. Combined with the characterization analysis of pH 6 products, it is shown that FDH inactivation under pH 2.2 conditions cannot reduce Pd 2+ , while pH3.5-6 conditions can achieve intracellular synthesis of Pd monomer. From the perspective of product location, white particles are mostly located on the cytoplasmic side under pH3-4 conditions, while white particles are mostly located on the inner membrane surface and periplasmic space under pH4.5-6 conditions.

[0104] Fig. 9 This indicates that the enzyme activity gradually increases from pH 2.2 to pH 6, the proportion of 0 valence increases, and the reducing ability increases.

[0105] Figure 4 TEM image of Pd-loaded Escherichia coli in Example 2 (Na 2 PdCl 4pH = 6), where a is the wild bacteria MC4100, b and c are the single knockout bacteria MC4100 (ΔhyaB) and MC4100 (ΔhybC), respectively, and d is the double knockout bacteria MC4100 (ΔhyaB, ΔhybC). It can be seen from the figure that the white particles produced by the four bacteria are all located in the periplasmic space and the outside of the cell wall. Figure 5 a in the figure is the result of EDS point scanning. A Pd peak appears, indicating that the white particles are Pd. The product is tested by XPS, and the peak fitting results are as follows: Figure 5 As shown in b, the Pd in ​​the product exists in two forms: +2 valence and 0 valence. The appearance of 0 valence indicates that the synthesis process can achieve Pd 2+ The reduction of Pd nanoparticles was successfully obtained, and the 0-valence peak was higher than the +2-valence peak, indicating that the enzyme activity was higher and the reducing ability was stronger under this condition. 2 PdCl 4 Under pH 6 conditions, this pathway can achieve the biosynthesis of Pd nanoparticles.

[0106] In the double knockout strain E. coli MC4100 (ΔhyaB, ΔhybC), Na 2 PdCl 4 Under pH 6 conditions, zero-valent Pd nanoparticles were synthesized outside the cells, and Na 2 PdCl 4 At pH 3.5, zero-valent Pd nanoparticles were synthesized inside the cells.

[0107] Comparative Example 1. A method for regulating the intracellular and extracellular synthesis location of nano zero-valent palladium

[0108] The four activated strains were inoculated into a 50 mL centrifuge tube containing 45 mL of LB liquid medium (containing 50 mg / L kanamycin) at a ratio of 1:45, and cultured overnight at 37 °C under microaerobic conditions. The OD 600 The cells were diluted to 1.0±0.02, 80 mL of bacterial solution was added to each group, and the cells were centrifuged at 8000 rpm for 10 min to collect the cells, and the culture medium was removed by washing twice with MOPS buffer (pH=7). After washing, 80 mL of 1 mM Na 2 PdCl 4 (pH 2.2 or 7), vortexed and incubated for 25 min, centrifuged at 8000 rpm for 10 min to collect the cells, washed the precipitate twice with MOPS buffer, and retained the supernatant. The absorbance was calculated using SnCl 2Methods: The residual palladium in the supernatant was measured for calculation. 80 mL of 25 mM sodium formate was added to the palladium-treated cells, transferred to a 250 mL anaerobic bottle, and shaken at 37 °C until the reaction mixture changed color (24 h). After the reaction, the cells were collected by centrifugation at 8000 rpm for 10 min. The product was fixed with 2.5% glutaraldehyde overnight, then dehydrated, infiltrated, dried, and sliced. Finally, a high-resolution transmission electron microscope was used to observe the internal conditions of the bacteria. XPS sample preparation only requires the cells to be crushed and dried overnight in a freeze dryer, and then the valence distribution of Pd is tested and analyzed using an X-ray photoelectron spectrometer.

[0109] Results 2 PdCl 4 (pH 2.2) only double knockout was performed, and no white particles were produced. 2 PdCl 4 (pH7) took pictures of different strains, and Na 2 PdCl 4 The results of the experiments were similar to those of the samples of pH 6.

[0110] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A method for regulating the intracellular and extracellular synthesis location of nano zero-valent palladium, characterized in that: After the recombinant Escherichia coli is incubated with a palladium solution, formate is used as an enzyme substrate to react under anaerobic conditions to regulate the position of nano zero-valent palladium; the recombinant Escherichia coli is based on the original Escherichia coli and any one or two of the genes encoding the catalytic subunits of [NiFe] hydrogenase 1 and [NiFe] hydrogenase 2 are knocked out.

2. The method according to claim 1, characterized in that The palladium solution is a Na2PdCl4 aqueous solution or a K2PdCl4 aqueous solution.

3. The method according to claim 2, characterized in that The concentration of the palladium solution is 0.5-1.5 mM, the incubation temperature is 20-50° C., the time is 20-30 min, and the pH is 3.5-6.

4. The method according to claim 1, characterized in that: The water-soluble formate is HCOONa aqueous solution or HCOOK aqueous solution.

5. The method according to claim 4, characterized in that The formate concentration in the reaction system is 5-25 mM, and the reaction time is 24-72 h.

6. The method according to claim 1, characterized in that The sequence of the gene encoding the [NiFe] hydrogenase 1 catalytic subunit is shown in SEQ ID NO.1; and the sequence of the gene encoding the [NiFe] hydrogenase 2 catalytic subunit is shown in SEQ ID NO.

2.

7. Use of the recombinant Escherichia coli according to claim 1 in regulating the adsorption capacity of palladium solution.

8. The use according to claim 7, characterized in that: The palladium solution is a Na2PdCl4 aqueous solution or a K2PdCl4 aqueous solution; the concentration of the palladium solution is 0.5-1.5mM.

9. A method for regulating the adsorption amount of palladium liquid, characterized in that: The recombinant Escherichia coli according to claim 1 is placed in a palladium solution and reacted for 20-30 minutes.

10. The method according to claim 9, characterized in that The palladium solution is a Na2PdCl4 aqueous solution or a K2PdCl4 aqueous solution; the concentration of the palladium solution is 0.5-1.5mM.

Images