Primer group and kit for rapidly detecting rhizomucor and rhizopus

Abstract

The invention discloses a primer group and a kit for rapidly detecting rhizomucor and rhizopus, and the primer group comprises an amplification primer pair and a probe for detecting one or more of rhizomucor microsporus, rhizopus microsporus, rhizomucor and rhizopus to form a stable multiplex PCR reaction kit system. It is ensured that rhizomucor and rhizopus pathogens which are common in clinic can be effectively detected. Experiments show that the primer group and the kit have extremely high specificity and sensitivity, can detect rhizomucor and rhizopus pathogens with the concentration of 4-5 pg / mu L to the minimum, can realize rapid, efficient and accurate detection, greatly shorten the detection time, save the detection cost and improve the detection efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and particularly relates to a primer set, a kit and a method for rapidly detecting Rhizomucor and Rhizopus. Background Art

[0002] Mucormycosis is an invasive fungal infection caused by fungi of the order Mucorales, which are widely found in the natural environment, such as soil and decaying organic matter. Mucor infections enter the body through inhalation of spores, wound infections, etc., and are more likely to cause invasive infections in immunocompromised patients, mainly affecting immunocompromised patients. In recent years, the incidence of mucormycosis has been on the rise worldwide, especially in patients with diabetes, hematological tumors, and organ transplant recipients. In recent years, an increasing trend of mucormycosis has also been observed in infected people (especially diabetic patients). Mucormycosis infections progress rapidly and have a high mortality rate, so rapid and accurate clinical detection is crucial.

[0003] The early symptoms of mucormycosis are usually non-specific, such as fever and dyspnea, which increases the difficulty of clinical detection. The diagnosis of mucormycosis generally relies on the following methods: (1) Direct microscopy: Observe fungal spores and hyphae structures from clinical specimens (such as tissues or secretions), which show characteristic broad, non-septate fungal hyphae structures under the microscope. This method is quick, but it relies on microscopic observation techniques and has low sensitivity, especially for low-concentration infections. (2) Culture detection: Clinical samples are cultured for fungi and the isolated strains are identified. Mucor grows rapidly on culture media, but is easily contaminated by other strains or bacteria. In addition, this method is time-consuming and usually requires several days to culture and isolate Mucor. (3) Histopathological testing: Obtain infected tissue samples through biopsy or surgery and perform pathological analysis. This method can confirm mucormycosis, but it is more damaging to the patient and requires professional pathological equipment and technology. (4) Serological testing: Serological testing has limited application in the diagnosis of mucormycosis. Although some antigen tests (such as GM tests) are relatively mature in the diagnosis of aspergillosis, there is a lack of specific antigens in mucormycosis, so the diagnostic sensitivity and specificity of serological tests for mucormycosis are not high. (5) Molecular biological methods: For example, PCR amplification of Mucor-specific DNA sequences can greatly improve the sensitivity and specificity of diagnosis. However, due to the large number and diversity of Mucor species, the molecular markers for different strains may be different, resulting in limited applicability of molecular testing. However, these methods have the following characteristics: (1) Long diagnostic time, such as existing culture and pathological detection methods usually take several days or even longer, which may delay treatment. (2) Low sensitivity: Direct microscopy and serological testing have low sensitivity, especially in the early stages of infection or low bacterial concentrations, and are difficult to detect accurately. (3) Poor specificity: Molecular testing is not very specific.

[0004] There is still a lack of research on specific markers for different Mucor strains, which may lead to misdiagnosis or missed diagnosis when the infection sources are diverse (4). It is difficult to meet the diversity of Mucor species: some molecular biological methods and pathological tests require multiple times to cover one to a few extremely limited Mucor species, which increases the cost of clinical applications and other limitations.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] In view of the need for short diagnosis time, high sensitivity / specificity and wide coverage of Mucor species for Mucor pathogen detection, the present invention provides a multiplex fluorescent PCR primer, kit and detection method for detecting multiple Mucor species. Only four pairs of primer set probes are used for fluorescent PCR to comprehensively detect the common Mucor species including Rhizomucor microsporus, Rhizomucor microsporus and Rhizomucor and Rhizopus. The method is simple to operate, greatly saves time, reagents and costs, and can quickly and effectively detect common species in Mucor at one time and has the advantages of high sensitivity and specificity.

[0007] Embodiment 1. A primer set for rapid detection of Mucor pathogens, characterized in that it comprises amplification primer pairs and probes for detecting one or more of Rhizomucor microsporus, Rhizomucor microsporus, Rhizomucor spp., and Rhizopus spp.,

[0008] The nucleotide sequences of the amplification primer pair of Rhizomucor pusillus are shown in SEQ ID NO:1 and SEQ ID NO:2, and the nucleotide sequence of the probe of Rhizomucor pusillus is shown in SEQ ID NO:3;

[0009] The nucleotide sequences of the amplification primer pair for Rhizopus microsporus are shown in SEQ ID NO:4 and SEQ ID NO:5, and the nucleotide sequence of the probe for Rhizopus microsporus is shown in SEQ ID NO:6;

[0010] The nucleotide sequences of the amplification primer pair for Rhizomucor are shown in SEQ ID NO:7 and SEQ ID NO:8, and the nucleotide sequence of the probe for Rhizomucor is shown in SEQ ID NO:9;

[0011] The nucleotide sequences of the amplification primer pair for Rhizopus are shown in SEQ ID NO:10 and SEQ ID NO:11, and the nucleotide sequence of the probe for Rhizopus is shown in SEQ ID NO:12.

[0012] Embodiment 2. The primer set for rapid detection of Mucor pathogens according to embodiment 1 is characterized in that the probe for the Mucor pathogen is an oligonucleotide fluorescent probe, the 5' end of which is labeled with a fluorescent reporter group and the 3' end of which is labeled with a fluorescent quencher group.

[0013] Embodiment 3. A kit for rapid detection of Mucor pathogens, characterized in that it comprises the amplification primer pair and probe described in embodiment 1 or 2.

[0014] Embodiment 4. The kit for rapid detection of Mucor pathogens according to embodiment 3 is characterized in that the kit further comprises a PCR mixture, wherein the PCR mixture comprises DNA polymerase, dNTP, Mg 2+ , Buffer.

[0015] Embodiment 5. The kit for rapid detection of Mucor pathogens according to embodiment 3 or 4 is characterized in that the molar concentration range of the primer pairs and the probe is 1 to 100 μM, for example, 5 to 10 μM, for example, 10 to 20 μM, for example, 20 to 50 μM.

[0016] Embodiment 6. The kit for rapid detection of Mucor pathogens according to embodiment 3 or 4 is characterized in that the kit is used to prepare a PCR reaction composition.

[0017] Embodiment 7. A kit for rapid detection of Mucor pathogens according to embodiment 3 or 4, characterized in that the kit is used for fluorescent PCR detection, comprising the following steps:

[0018] Extract DNA from the sample to obtain sample DNA;

[0019] preparing a PCR reaction composition;

[0020] Performing PCR amplification and detecting the Mucor pathogen;

[0021] Wherein, the Mucor pathogens include one or more of Rhizomucor microsporus, Rhizomucor microsporus, Rhizomucor spp., and Rhizopus spp.

[0022] Embodiment 8. The kit for rapid detection of Mucor pathogens according to embodiment 7 is characterized in that the PCR reaction composition is prepared as follows:

[0023] The sample DNA, PCR mixed solution, nuclease-free water and the primer set described in embodiment 1 or 2 are fully mixed to obtain the PCR reaction composition.

[0024] Embodiment 9. A method for using the kit of any one of embodiments 3 to 8 for non-diagnostic purposes, characterized in that it comprises using the kit for rapid detection of Mucor pathogens of any one of embodiments 3 to 8 to perform fluorescent PCR detection, comprising the following steps:

[0025] Extract DNA from the sample to obtain sample DNA;

[0026] preparing a PCR reaction composition;

[0027] Performing PCR amplification and detecting the Mucor pathogen;

[0028] Wherein, the Mucor pathogens include one or more of Rhizomucor microsporus, Rhizomucor microsporus, Rhizomucor spp., and Rhizopus spp.

[0029] Embodiment 10. The method according to embodiment 9, characterized in that the PCR reaction composition is prepared as follows:

[0030] The sample DNA, PCR mixture, nuclease-free water and the primer set described in embodiment 1 or 2 are fully mixed to prepare the PCR reaction system;

[0031] The PCR amplification reaction conditions are:

[0032] The pre-denaturation process was 95°C for 1-5 min for 1 cycle; the denaturation and extension process was 95°C for 10-20 s, 59-61°C for 20-50 s for a total of 40-45 cycles.

[0033] Embodiment 11. The method according to embodiment 10 is characterized in that the PCR amplification reaction conditions are:

[0034] The pre-denaturation process was 95°C for 3 min for 1 cycle; the denaturation and extension process was 95°C for 15 s and 60°C for 30 s for a total of 45 cycles.

[0035] The present invention can simultaneously perform multiple fluorescence PCR in one reaction tube by designing primers at the species level for the genomes of two species, Rhizomucor microsporus and Rhizomucor microsporus, which are common in Mucor disease, and all species in the genus covered by the Rhizomucor genus at the genus level, and detect the differences between Mucor pathogens through fluorescence differentiation. After optimizing the reaction system and conditions, a complete multiple fluorescence PCR reaction system is determined.

[0036] The present invention has the following technical effects:

[0037] 1. The present invention adopts multiplex fluorescence PCR technology to design species or genus level specific primer sets and kits, and establishes a method for rapid identification of Mucor pathogens based on the primer sets or kits. The method only requires one sample addition, one reaction tube and one reaction system to complete the detection of two common Mucor species within 2 hours. It has the advantages of being fast, efficient and accurate, greatly shortening the detection time, saving the detection cost and improving the detection efficiency.

[0038] 2. The multiplex fluorescent PCR primer set used in the present invention can be used alone or in any combination, and can show a stable detection effect. The entire reaction process is fully closed, effectively avoiding false positive detection results caused by environmental pollution. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0040] Figure 1 This is the specific detection result of the Rhizomucor microplus primer set.

[0041] Figure 2 This is the specific detection result of Rhizopus microsporus primer set.

[0042] Figure 3 The results are specific for the Rhizomucor primer set.

[0043] Figure 4 The results are specific for the Rhizopus primer set.

[0044] Figure 5 This is the detection limit result of the Rhizomucor microplus primer set.

[0045] Figure 6 The detection limit of the primer set for Rhizopus microsporus

[0046] Figure 7 The results are the detection limits of the Rhizomucor primer set.

[0047] Figure 8 The detection limit of the primer set is shown in Figure 2. DETAILED DESCRIPTION

[0048] Now, various exemplary embodiments of the present invention are described in detail, which should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present invention. It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not used to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the range is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded in the range. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by conventional technicians in the field of the present invention. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe methods and / or materials related to the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0049] Unless otherwise defined hereinafter, the meaning of all technical terms and scientific terms used in the specific embodiments of the present invention are intended to be the same as those generally understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain the present invention.

[0050] As used in the present invention, the terms "comprise", "comprising", "having", "containing" or "involving" are inclusive or open-ended, and do not exclude other unrecited elements or method steps. The term "consisting of" is considered to be a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists of only these embodiments.

[0051] The terms "approximately" and "substantially" in the present invention represent the accuracy interval that can be understood by those skilled in the art and still guarantee the technical effect of the feature in question. The term usually means ±10%, preferably ±5% of the deviation from the indicated value. Indefinite or definite articles such as "a" or "an", "the" used when referring to a singular noun include the plural form of the noun.

[0052] In addition, the terms first, second, third, (a), (b), (c), and the like in the specification and claims are used to distinguish similar elements and are not necessarily required to describe a sequential or chronological order. It should be understood that the terms so used are interchangeable under appropriate circumstances, and that the embodiments described in the present invention can be implemented in other sequences than those described or illustrated in the present invention.

[0053] Some of the terms used in the present invention are defined as follows:

[0054] The primer pair of the present invention comprises a forward primer (-F) and a reverse primer (-R) for PCR amplification;

[0055] The primer set of the present invention comprises a primer pair and a probe (-P) for PCR amplification;

[0056] To implement this method, the present invention provides the following scheme:

[0057] On the one hand, the present invention provides a primer set for rapid detection of Rhizomucor and Rhizopus, comprising four pairs of amplification primer pairs for detecting Rhizomucor micropus, Rhizopus microsporus, Rhizomucor genus and Mucor species covered by Rhizopus genus and a fluorescent probe, wherein the nucleotide sequences of the amplification primer pairs of Rhizomucor micropus are shown in SEQ ID NO:1 and SEQ ID NO:2, and the nucleotide sequence of the probe of Rhizomucor micropus is shown in SEQ ID NO:3; the nucleotide sequences of the amplification primer pairs of Rhizomucor microsporus are shown in SEQ ID NO:4 and SEQ ID NO:5, and the nucleotide sequence of the probe of Rhizomucor microsporus is shown in SEQ ID NO:6; the nucleotide sequences of the amplification primer pairs of Rhizomucor genus are shown in SEQ ID NO:7 and SEQ ID NO:8, and the nucleotide sequence of the probe of Rhizomucor genus is shown in SEQ ID NO:9; the nucleotide sequences of the amplification primer pairs of Rhizopus genus are shown in SEQ ID NO:10 and SEQ ID NO:11, and the nucleotide sequence of the probe of Rhizopus genus is shown in SEQ ID NO:12.

[0058] The sequence information described in this application is as follows:

[0059] SEQ ID NO:1:CTCTCCTTCCCAAATGCTGC

[0060] SEQ ID NO:2:CATGTCGAGCCAACCAGAAC

[0061] SEQ ID NO:3:AGCCTCCCTCTATGGCCCATCT

[0062] SEQ ID NO:4:ACTTGCTTCACTTACCAACCG

[0063] SEQ ID NO:5:CGAGCTTTATATCCCTATGAACCC

[0064] SEQ ID NO:6:CACCAGCCTGATTCCAGTTGTGC

[0065] SEQ ID NO:7: CTTGGTCATGAGCGTCTCCT

[0066] SEQ ID NO:8:TTGCCTACTGCTACATCGCT

[0067] SEQ ID NO:9:ATCCGCGCGAAGGATGCCC

[0068] SEQ ID NO:10:GCCGTTGCTTACCGTCAAA

[0069] SEQ ID NO:11:GCACGTTCCAAAAGACGAGA

[0070] SEQ ID NO:12:TCGTCCTCCTGGTCGTGAAGC

[0071] In some embodiments, the probe for the Mucor pathogen is an oligonucleotide fluorescent probe, the 5' end of which is labeled with a fluorescent reporter group and the 3' end of which is labeled with a fluorescent quencher group.

[0072] Another aspect of the present invention provides a multiplex PCR detection kit for rapid detection of Rhizomucor and Rhizopus, wherein the detection kit comprises the primer pair and the probe.

[0073] Preferably, the kit further comprises a PCR mixture (e.g., Luna Universal Probe qPCR Master Mix), template DNA, and nuclease-free water. The PCR mixture comprises DNA polymerase, dNTP, Mg 2+ , Buffer.

[0074] In some embodiments, the molar concentration range of the primer pairs and probes of the kit for rapid detection of Mucor pathogens is 1-100 μM, such as 5-10 μM, such as 10-20 μM, such as 20-50 μM.

[0075] In some embodiments, the kit for rapid detection of Mucor pathogens is used to prepare a PCR reaction composition.

[0076] In some embodiments, the kit is used for fluorescent PCR detection, comprising the following steps:

[0077] Extract DNA from the sample to obtain sample DNA;

[0078] preparing a PCR reaction composition;

[0079] Performing PCR amplification and detecting the Mucor pathogen;

[0080] Wherein, the Mucor pathogens include one or more of Rhizomucor microsporus, Rhizomucor microsporus, Rhizomucor spp., and Rhizopus spp.

[0081] In some embodiments, the PCR reaction composition of the kit for rapid detection of Mucor pathogens is prepared as follows:

[0082] The sample DNA, PCR mixed solution, nuclease-free water and the primer set are fully mixed to obtain the PCR reaction composition.

[0083] The present application also discloses a method for using the kit for non-diagnostic purposes, including using the kit for rapid detection of Mucor pathogens to perform fluorescent PCR detection, including the following steps:

[0084] Extract DNA from the sample to obtain sample DNA;

[0085] preparing a PCR reaction composition;

[0086] Performing PCR amplification and detecting the Mucor pathogen;

[0087] Wherein, the Mucor pathogens include one or more of Rhizomucor microsporus, Rhizomucor microsporus, Rhizomucor spp., and Rhizopus spp.

[0088] In some embodiments, the kit PCR reaction composition is prepared as follows:

[0089] The sample DNA, PCR mixture, nuclease-free water and the primer set are fully mixed to prepare the PCR reaction system;

[0090] The PCR amplification reaction conditions are:

[0091] The pre-denaturation process was 95°C for 1-5 min for 1 cycle; the denaturation and extension process was 95°C for 10-20 s, 59-61°C for 20-50 s for a total of 40-45 cycles.

[0092] Preferably, the PCR amplification reaction conditions are: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, and extension at 60°C for 30 s; further, pre-denaturation is performed for 1 cycle, and denaturation and extension are performed for 45 cycles.

[0093] Preferably, the PCR reaction system comprises: 0.8 μL of each primer (10 μM), 0.4 μL of probe (10 μM), 10 μL of 1×Luna Universal Probe qPCR Master Mix (i.e., PCR mixture), 4 μL of nuclease-free water, and 4 μL of sample nucleic acid.

[0094] The above ranges can be used alone or in combination. The present application can be more easily understood through the following examples.

[0095] Example

[0096] Example 1 Design of multiplex fluorescent PCR primers for rapid detection of multiple Mucor species

[0097] 1. Composition of the kit

[0098] (1) Primer set: amplification primer pairs and probes for detecting Rhizomucor microsporus, Rhizomucor microsporus and their Rhizomucor and Rhizopus spp.;

[0099] Table 1 Primer set sequence information

[0100]

[0101]

[0102] (2) Kit configuration process:

[0103] Prepare 20 μl PCR reaction solution (as shown in Table 2):

[0104] Table 2 20 μl PCR reaction system (i.e. PCR reaction composition)

[0105]

[0106] Among them, Luna Universal Probe qPCR Master Mix is ​​a PCR mixture containing DNA polymerase, dNTP, Mg 2+ , Buffer, etc.; the forward primer, reverse primer and probe comprise the primer set mixture shown in Table 1.

[0107] Example 2 Method for testing specificity of the detection kit

[0108] To verify the specificity of the primer set, bacterial suspensions of relevant bacterial species or clinical samples were used, and after concentration dilution determination, the samples were diluted to an appropriate concentration for fluorescence PCR detection.

[0109] 1. Extract sample nucleic acid

[0110] A DNA extraction kit was used to extract nucleic acid according to the instructions of the extraction kit to extract the DNA of pathogenic microorganisms in the sample. Specific tests of other fungi or common pathogens were added to verify the specificity of the primer set. The specific sample conditions are shown in Table 4.

[0111] 2. Preparation of PCR reaction system (i.e., PCR reaction composition)

[0112] The extracted DNA was used as a template; the above primer set was used to perform quadruple fluorescence PCR. The quadruple fluorescence quantitative PCR reaction system was shown in Table 2 above, added to a 0.2 mL PCR reaction tube, and then 4 μL of sample DNA was added, and water was added to 20 μL, and then the cover was gently closed and fully mixed to obtain a PCR reaction system. Subsequently, a PCR reaction was performed in a fluorescence PCR instrument, and the PCR reaction program was shown in Table 3 below.

[0113] Table 3 PCR reaction program

[0114]

[0115] 3. On-machine testing

[0116] Fluorescence PCR equipment can be used for testing, and then the positive and negative judgment can be made based on the corresponding fluorescence curve and Ct value of the test, where Ct≤35 is considered a positive value.

[0117] 4. Specificity test results

[0118] The specificity test results of the primer sets are shown in Table 4 and Appendix Figure 1-4 The results showed that the primer set of the present invention correctly detected all species covered by common clinical pathogens, and did not detect any species not covered, without any false detection or misdetection, indicating that the primers and kit of the present invention have extremely high specificity.

[0119] Table 4 Kit specificity test results

[0120]

[0121]

[0122] Note:

[0123] +——represents positive

[0124] -——represents negative

[0125] Example 3 Primer set detection limit and sensitivity test

[0126] To verify the detection limit of the primer set, the bacterial strains isolated from clinical samples were gradiently diluted, and the bacterial nucleic acid concentration was 400-500 ng / μL as the original nucleic acid concentration. Four gradient dilutions with a gradient of 10 times were performed, and fluorescent PCR detection was performed after gradient dilution to the appropriate concentration.

[0127] 1. Sample nucleic acid extraction is the same as the sample nucleic acid extraction in Example 2, wherein the sample conditions are detailed in Table 5.

[0128] 2. Sample dilution

[0129] The bacterial concentration of Rhizomucor microsporus and Rhizopus microsporus isolated from clinical samples was adjusted to 400-500 ng / μL with normal saline according to the original concentration gradient, and then four gradients of 10-fold gradient dilution were performed.

[0130] 3. Test according to the detection method described in Example 2

[0131] After the PCR reaction is completed, the positive and negative of the sample is judged according to the fluorescence curve and Ct value to obtain the detection line of the kit of the present invention and the sensitivity test. The detailed results are shown in Table 5 and Appendix Figure 5-8 The test results show that the detection limits of the two species of Rhizomucor and Rhizopus microsporus detected by the kit of the present invention reach 40-50pg / μL, and the detection limits of the two genus level primer sets of Rhizomucor and Rhizopus reach 4-5pg / μL, indicating that the kit of the present invention has extremely high detection sensitivity and also has extremely high specificity in similar species.

[0132] Table 5 Detection limit and sensitivity results of the kit

[0133]

[0134] Note: () represents the Ct value obtained by PCR curve

[0135] +——represents positive

[0136] -——represents negative

[0137] The primer set and kit for rapid detection of multiple Mucor pathogens of the present invention have the advantages of rapid, efficient, high sensitivity, high specificity, low cost and good promotion, and can play an important role in the rapid identification of common Rhizomucor and Rhizopus in clinical practice. The above-described embodiments are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made by ordinary technicians in the field to the technical solution of the present invention should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer set for rapid detection of Mucor pathogens, characterized in that: The invention comprises amplification primer pairs and probes for detecting one or more of Rhizomucor microsporus, Rhizomucor microsporus, Rhizomucor spp., and Rhizopus spp., The nucleotide sequences of the amplification primer pair of Rhizomucor pusillus are shown in SEQ ID NO:1 and SEQ ID NO:2, and the nucleotide sequence of the probe of Rhizomucor pusillus is shown in SEQ ID NO:3; The nucleotide sequences of the amplification primer pair for Rhizopus microsporus are shown in SEQ ID NO:4 and SEQ ID NO:5, and the nucleotide sequence of the probe for Rhizopus microsporus is shown in SEQ ID NO:6; The nucleotide sequences of the amplification primer pair for Rhizomucor are shown in SEQ ID NO:7 and SEQ ID NO:8, and the nucleotide sequence of the probe for Rhizomucor is shown in SEQ ID NO:9; The nucleotide sequences of the amplification primer pair for Rhizopus are shown in SEQ ID NO:10 and SEQ ID NO:11, and the nucleotide sequence of the probe for Rhizopus is shown in SEQ ID NO:

12.

2. The primer set for rapid detection of Mucor pathogens according to claim 1, characterized in that: The probe for the Mucor pathogen is an oligonucleotide fluorescent probe, the 5' end of which is labeled with a fluorescent reporter group, and the 3' end of which is labeled with a fluorescent quencher group.

3. A kit for rapid detection of Mucor pathogens, characterized in that: The method comprises the amplification primer pair and the probe according to claim 1 or 2.

4. The kit for rapid detection of Mucor pathogens according to claim 3, characterized in that: The kit also includes a PCR mixture, which includes DNA polymerase, dNTP, Mg 2+ , Buffer.

5. The kit for rapid detection of Mucor pathogens according to claim 3 or 4, characterized in that: The molar concentration range of the primer pair and the probe is 1-100 μM, such as 5-10 μM, such as 10-20 μM, such as 20-50 μM.

6. The kit for rapid detection of Mucor pathogens according to claim 3 or 4, characterized in that: The kit is used for preparing a PCR reaction composition.

7. The kit for rapid detection of Mucor pathogens according to claim 3 or 4, characterized in that: The kit is used for fluorescent PCR detection, comprising the following steps: Extract DNA from the sample to obtain sample DNA; preparing a PCR reaction composition; Performing PCR amplification and detecting the Mucor pathogen; Wherein, the Mucor pathogens include one or more of Rhizomucor microsporus, Rhizomucor microsporus, Rhizomucor spp., and Rhizopus spp.

8. The kit for rapid detection of Mucor pathogens according to claim 7, characterized in that: The PCR reaction composition is prepared as follows: The sample DNA, PCR mixed solution, nuclease-free water and the primer set according to claim 1 or 2 are fully mixed to obtain the PCR reaction composition.

9. A method for using the kit according to any one of claims 3 to 8 for non-diagnostic purposes, characterized in that: The method comprises using the rapid detection kit for Mucor pathogens according to any one of claims 3 to 8 to perform fluorescent PCR detection, comprising the following steps: Extract DNA from the sample to obtain sample DNA; preparing a PCR reaction composition; Performing PCR amplification and detecting the Mucor pathogen; Wherein, the Mucor pathogens include one or more of Rhizomucor microsporus, Rhizomucor microsporus, Rhizomucor spp., and Rhizopus spp.

10. The method according to claim 9, characterized in that The PCR reaction composition is prepared as follows: The sample DNA, PCR mixture, nuclease-free water and the primer set according to claim 1 or 2 are fully mixed to prepare the PCR reaction system; The PCR amplification reaction conditions are: The pre-denaturation process was 95°C for 1-5 min for 1 cycle; the denaturation and extension process was 95°C for 10-20 s, 59-61°C for 20-50 s for a total of 40-45 cycles.

Images