Improved polymer degrading enzymes

Abstract

The present invention relates to methods of identifying enzymes and methods of screening for optimized enzymes for degrading polymers, such as plastics. The invention also relates to polymer degrading enzymes and nucleic acids encoding these enzymes, as well as expression cassettes and host cells comprising these nucleic acids. The invention also relates to the use of these enzymes or host cells comprising nucleic acids encoding these enzymes to degrade polymers such as plastics. Finally, the invention also relates to crystal structures of the plastic degrading enzymes and uses of these structures.

Description

Technical Field

[0001] The present invention relates to a rapid throughput method for identifying and optimizing novel polymer degrading enzymes (e.g., plastic degrading enzymes). The present invention also relates to novel polymers (e.g., plastic degrading enzymes), crystal structures of these enzymes, and methods of using these crystal structures. Background Art

[0002] 460 million tons of plastic are produced worldwide each year, 90% of which is produced from fossil fuels. About 79% accumulates in landfills or the natural environment.

[0003] Poly(ethylene terephthalate) (PET) is the most abundant polyester plastic, with nearly 70 million tons produced worldwide each year for use in textiles and packaging. If this plastic could be recycled, it would reduce fossil fuel consumption and the use of landfills.

[0004] Currently, only a small number of PETases (enzymes that degrade PET into its constituent monomers) are known. These have been discovered by low-throughput methods such as agarose-based screening with soluble enzymes. Although these screening techniques have been widely used in recent decades to access the huge diversity provided by metagenomic libraries, screening activities can be laborious, cost- and time-intensive. Summary of the invention

[0005] It will be important to find more efficient PETases and more efficient plastic-degrading enzymes in general as well as other enzymes that degrade polymers that accumulate in the environment.

[0006] The inventors have addressed this problem in the art using a new approach to discover and improve enzymes that degrade polymers (eg plastics such as PET).

[0007] Therefore, in a first aspect, a method for identifying a plastic degrading enzyme or optimizing a plastic degrading enzyme is provided, the method comprising:

[0008] a) encapsulating the gene library into a plurality of microfluidic droplets, each microfluidic droplet comprising at least one gene, and each microfluidic droplet further comprising:

[0009] i) an expression system for expressing the gene; and

[0010] ii) plastic particles;

[0011] b) detecting degradation of the plastic particles in the microfluidic droplets; and

[0012] c) Selecting a microfluidic droplet in which plastic degradation has been detected.

[0013] Detection of degradation can optionally be performed by detecting a reduction in light scattering caused by the plastic particles.

[0014] Optionally, the gene library is:

[0015] a) metagenomic libraries; or

[0016] b) Directed evolution library.

[0017] If the gene library is a metagenomic library, optionally the method further comprises:

[0018] a) identifying the plastic degrading enzyme; and optionally

[0019] b) preparing a directed evolution library from the plastic degrading enzyme, and repeating the method of the first aspect using the directed evolution library.

[0020] The above-mentioned method for optimization can optionally be performed before a screening method, wherein the screening method comprises:

[0021] a) encapsulating the gene library into a plurality of microfluidic droplets, each microfluidic droplet comprising at least one gene, and each microfluidic droplet further comprising:

[0022] i) an expression system for expressing the gene; and

[0023] ii) soluble plastic simulants;

[0024] b) detecting cleavage of the soluble plastic simulant in the microfluidic droplets; and

[0025] c) Selecting a microfluidic droplet in which lysis has been detected.

[0026] In another aspect, an esterase is provided, the esterase having at least 70% or more sequence identity with:

[0027] a) SEQ ID NO. 2; or

[0028] b) SEQ ID NO. 4; or

[0029] c) SEQ ID NO.6.

[0030] On the other hand, provided is an isolated and / or recombinant nucleic acid encoding any of the plastic hydrolases described herein; an expression cassette or vector comprising the isolated or recombinant nucleic acid; or a host cell comprising the isolated and / or recombinant nucleic acid or the expression cassette or vector.

[0031] In another aspect, there is provided use of any esterase described herein to degrade plastic.

[0032] In another aspect, there is provided a crystal of an esterase as described herein and according to the claims.

[0033] In another aspect, a computer readable data storage medium is provided, which is encoded with the atomic coordinates of the residues in Table 2 or 3, or Fig.16 or the atomic coordinates in 17.

[0034] In another aspect, there is provided a residue having a root mean square deviation of less than or with Fig.16 The root mean square deviation of the atomic coordinates is less than The atomic coordinates of Fig.16 or Fig.17 The coordinates of amino acids 12-325, optionally Fig.17 The coordinates of amino acids 2-267 of ) are used for the following purposes:

[0035] a) Optimizing plastic degradation activity through computational design;

[0036] b) Optimizing thermal stability through computational design;

[0037] c) designing plastic hydrolases; or

[0038] d) Phase the structural biology data obtained from the protein.

[0039] In another aspect, there is also provided:

[0040] A method for screening an optimized plastic degrading enzyme, the method comprising:

[0041] a) encapsulating a gene library having variant gene sequences of the plastic degrading enzyme into a plurality of microfluidic droplets, each microfluidic droplet comprising at least one variant gene sequence of the plastic degrading enzyme, and each microfluidic droplet further comprising:

[0042] i) an expression system for expressing the gene; and

[0043] ii) plastic particles;

[0044] b) detecting degradation of the plastic particles in the microfluidic droplets; and

[0045] c) Selecting a microfluidic droplet in which plastic degradation has been detected.

[0046] In another aspect, there is also provided:

[0047] A method for identifying a plastic degrading enzyme, the method comprising:

[0048] a) encapsulating the gene library into a plurality of microfluidic droplets, each microfluidic droplet comprising at least one gene, and each microfluidic droplet further comprising:

[0049] i) an expression system for expressing the gene; and

[0050] ii) plastic particles;

[0051] b) detecting degradation of the plastic particles in the microfluidic droplets; and

[0052] c) Selecting a microfluidic droplet in which plastic degradation has been detected.

[0053] In another aspect, there is also provided:

[0054] A hydrolase, optionally an esterase, having at least 70% or more sequence identity with:

[0055] a) SEQ ID NO.2, optionally wherein the enzyme comprises any one or more of the following mutations of SEQ ID NO.2:

[0056] i) A9S; and / or

[0057] ii) A118E; and / or

[0058] iii) A19T;

[0059] or

[0060] b) SEQ ID NO.4;

[0061] or

[0062] c) SEQ ID NO.6.

[0063] In another aspect, there is also provided:

[0064] A polypeptide having 100% sequence identity to SEQ ID NO. 2, 4 or 6, optionally 100% sequence identity to SEQ ID NO. 2, except for the following mutations:

[0065] a) A9S; and / or

[0066] b) A118E; and / or

[0067] c) A19T; or

[0068] d) A118E and / or F221S and / or S235G; and / or

[0069] e) A118E and / or F221S; and / or

[0070] f) A19T and / or A118E and / or F221S; and / or

[0071] g) F221S.

[0072] On the other hand, a hydrolase having at least 70% identity to SEQ ID NO. 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32, or a polypeptide having 100% identity to SEQ ID NO. 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 is also provided. DETAILED DESCRIPTION

[0073] method

[0074] Encapsulation

[0075] Encapsulation in microfluidic droplets can be performed using a droplet generation module.

[0076] Gene library

[0077] A gene library means two or more genes, ie two or more different nucleic acid sequences.

[0078] The gene library can be in the form of a metagenomic library. That is, a library containing sequences from environmental samples. This type of gene library can contain genes that are substantially different from each other in structure and function because these are random sequences collected from environmental samples.

[0079] Alternatively, the gene library can be in the form of a directed evolution library. In a directed evolution library, the gene library is derived from an original nucleic acid sequence, which has been mutated to form a variant of the original gene sequence, i.e., it is a variant library or a randomized DNA library. Two or more genes from the library can include, for example, the original gene and a mutant variant with one or more nucleic acid changes for the original sequence.

[0080] The one or more genes in each microfluidic droplet are from the gene library. The genes can be cloned into vectors in the library. That is, the library can contain multiple vectors, each vector containing one or more genes. Each gene in the library can also have a promoter. That is, the gene is part of an expression cassette.

[0081] Expression system

[0082] An expression system refers to the components required to transcribe a gene and translate it into an enzyme.

[0083] The expression system can be an in vitro translation expression system, or a cell, wherein the cell comprises the expression system, for example, a bacterial cell.

[0084] If the expression system is a cell, a lysis buffer for lysing the cells may also be encapsulated.

[0085] In the case of using cells to express genes, the genes can be cloned into vectors and transformed into cells for expression. That is, the expression system and gene are, for example, bacterial cells containing vectors, which contain genes cloned into the vectors. The vectors can contain promoters for expressing genes.

[0086] After encapsulation, the droplets can be incubated to allow gene expression (and / or degradation of the plastic particles). For example, the incubation ranges from 30 seconds to 4 weeks. For example, 1-5 hours, 24 hours, or 48 hours. If a short incubation time is used, the incubation can be performed on the chip. After the incubation time, a lysis buffer can be added to the droplets, for example by picoinjection. Alternatively, the genes can be expressed in the cells before the cells are incorporated into the droplets. In this way, the lysis buffer can be incorporated into the droplets together with the cells.

[0087] Plastic particles

[0088] Plastic particles are solid. The size of the particles can be 50-1000nm. For example, 100-200nm, such as 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000nm, or any range in these sizes. Dynamic light scattering can be used to verify the uniform size of the particles. The polydispersity of the particles can be less than 1. That is, the particles are monodisperse. The crystallinity of the particles can be between 1%-40% (a portion of the sample is crystalline, i.e., 8% means that 8% of the sample is crystalline and the rest is amorphous). For example, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 10%, 15%, 20%, 25%, 30%, 35% or 40%, or a range of any one of these values. This can be measured by differential scanning calorimetry (DSC). By this technique, the glass transition temperature (Tg), melting temperature (Tm) and heat of melting ΔHm and heat of cold crystallization ΔHc can be determined. By comparison with the heat of melting of a 100% crystalline sample, the percent crystallinity can be calculated. A microfluidic droplet can contain one or more plastic particles.

[0089] The particles can be prepared by precipitation from a plastic substrate and solvent evaporation.

[0090] Prior to precipitation and solvent evaporation, the plastic substrate may be in an amorphous or crystalline form.

[0091] When the plastic substrate is, for example, PET or polyamide, the solvent may be 1,1,1,3,3,3-hexafluoro-2-propanol or a mixture of chloroform and trifluoroacetic acid. In the case where the plastic substrate is PCL, PES or PLA, the solvent may be dichloromethane (DCM). In the case where the plastic substrate is polyvinyl chloride (PVC), tetrahydrofuran (THF) may be used as a solvent.

[0092] When nanoparticles are suspended in microfluidic droplets, the nanoparticles can be suspended in Tween (polysorbate, such as Tween-80). Before scattering, the resulting concentration in the droplet can be 0.1%-0.5% Tween (Tween to droplet volume) or, for example, 0.05%-1%. Other surfactants can also be used, such as Triton, SDS or poly (vinyl alcohol).

[0093] Detection of degradation

[0094] Detection of degradation can be performed by light scattering. If the droplets contain an enzyme with plastic degrading activity, the light scattering from the particles will be smaller compared to droplets that do not contain an enzyme with plastic degrading activity. Degradation means breaking down the polymer particles into their constituent monomers.

[0095] choose

[0096] Selection means selecting droplets containing enzymes with plastic degradation activity and separating them from droplets that do not exhibit plastic degradation.

[0097] Identification of enzymes

[0098] Plastic-degrading enzymes can be identified from the gene sequences in the droplets. The identity of the gene can be verified by sequencing the nucleic acid comprising the gene in the droplets. This can be done by recovering and purifying the DNA of the gene from the droplets and subsequently sequencing the DNA.

[0099] Screening methods

[0100] Optionally, a primary screening method can be performed to detect enzymes that may have plastic degrading properties. The primary screening method uses a soluble plastic simulant. When cleaved, the soluble plastic simulant releases a detectable signal. For example, when screening for plastic degrading enzymes that degrade plastics containing ester bonds, the soluble plastic simulant can be an ester (rather than a polymer) covalently bonded to a signaling molecule (e.g., fluorescein). For example, the soluble plastic simulant can be a fluorescein ester, such as fluorescein dihexanoate. When this soluble plastic simulant is cleaved, an increase in fluorescence can be detected.

[0101] The gene sequence of a plastic degrading enzyme can be identified from the microfluidic droplets in which lysis has been detected. The enzyme encoded by this gene sequence can then be optimized as described below.

[0102] Further enzyme optimization

[0103] Screening for optimized enzymes means searching for and optionally identifying sequence variants (mutants) with polymer (e.g., plastic) degradation activity. The method may further include selecting optimized variants. The variants may be improved from the original plastic degrading enzyme in a variety of ways, such as functionally improved compared to the original enzyme. The improved function may be better polymer degradation activity or thermal stability or other functional improvements.

[0104] Directed evolution refers to the mutation of the nucleotide sequence encoding the enzyme. The resulting mutants can then be screened to find improved functional mutants.

[0105] Microfluidic devices

[0106] The one or more microfluidic devices used are designed to firstly encapsulate the library (inserts consisting of a single gene or multiple genes), plastic particles and the expression system of the genes in microfluidic droplets (droplet generation module); and secondly detect and sort the droplets (scattering sorter module).

[0107] These functions can be split between two devices, allowing for droplet incubation and degradation, or they can be part of one device.

[0108] The droplet generation module may include a droplet generation junction in fluid communication with one or more channels, the one or more channels being adapted to allow genes, expression systems, plastic particles, and a dispensing fluid (e.g., oil) to flow into the droplet generation junction. The droplet generation junction is adapted to encapsulate the genes, expression systems, and plastic particles in the dispensing fluid.

[0109] After encapsulation and a period of incubation to allow the enzyme catalyzed reaction to proceed, the microfluidic droplets are sorted. The sorter may include a bifurcated sorting junction downstream of the droplet generation junction, the bifurcated sorting junction being in fluid communication with the first outlet channel and the second outlet channel, wherein the bifurcated sorting junction is adapted to sort the droplets into a first set of droplets that exit via the first outlet channel and a second set of droplets that exit via the second outlet channel.

[0110] The mechanism can be by detecting fluorescence or by detecting light scattering. The detection can be compared to a control droplet in which the gene is not present (or in which the gene encoding the inactive enzyme is present). If the detection is light scattering, if the plastic has degraded, the light scattering will decrease. If the detection is by fluorescence, the fluorescence signal will increase with enzyme activity.

[0111] The light signal from the light scattering can be detected using two optical fibers at an angle of approximately 90° to each other (see Figure 2A). In addition, the droplet channel introduced into the detection point can be at an angle of about 90° to the detection fiber and 180° to the incident light. This allows the fiber to be inserted close to the microfluidic channel.

[0112] The diameter of the optical fiber providing the incident light can be smaller than the droplet and the detection optical fiber.

[0113] Enzymes

[0114] Plastic degradation

[0115] Plastic degradation refers to the ability to break down plastic polymers into their constituent parts.

[0116] The enzyme may be a hydrolase. For example, the enzyme may belong to the EC 3 enzyme class. The degradation may be by catalyzing the hydrolysis of the polyester into acids and alcohols. That is, the enzyme is, for example, an esterase or a lipase or a cutinase. The enzyme may belong to the hydrolase class classified as EC 3.1.

[0117] Degradation can be by catalyzing the hydrolysis of the polyamide, thereby releasing the amine and the carboxylic acid. That is, the enzyme is a nylon hydrolase or nylonase. They can belong to the class of hydrolases classified as EC 3.5.1.117.

[0118] For example, SEQ ID NO. 2, 4 and 6 are hydrolases, such as esterases, and can be further classified as PETases. For example, SEQ ID NO. 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 and 32 are hydrolases and can be further classified as nylon hydrolases.

[0119] plastic

[0120] Plastic means a synthetic material comprising polymers that can be molded, extruded, pressed or otherwise formed into a rigid or somewhat flexible form.

[0121] The plastic may be polyester, polyamide; polyethylene, polyurethane or polyolefin.

[0122] The plastic may include any of the following: polyethylene terephthalate (PET), polytrimethylene terephthalate (PTT), polyethylene succinate (PES), polybutylene terephthalate (PBT), polyethylene isosorbide terephthalate (PEIT), polylactic acid (PLA), polyhydroxyalkanoate (PHA), polybutylene succinate (PBS), polybutylene succinate adipate (PBSA), polybutylene terephthalate adipate (PBAT), polyethylene furanoate (PEF), polycaprolactone (PCL), poly(ethylene adipate) (PEA), polyethylene naphthalate (PEN), polystyrene (PS), polypropylene (PP), polyvinyl chloride (PVC), polyurethane (PUR) (e.g., spandex), polyamide (PA), polycarbonate (PC), and blends / mixtures of any polymer described herein. The particles may comprise or consist of any of the above mentioned plastics or blends / mixtures.

[0123] The plastic may be a polyamide, such as nylon. The nylon may be nylon 6 or nylon 12, or nylon 6,6.

[0124] Reorganization

[0125] Recombinant means an exogenous nucleic acid sequence that is not native to the cell in which the nucleic acid is expressed.

[0126] Sequence Listing

[0127]

[0128]

[0129] Table 1. SEQ ID numbers of enzymes (used in sequence listings)

[0130] Sequence identity

[0131] Sequence identity can be calculated using any suitable software such as BLAST (Altschul, SF, Gish, W., Miller, W., Myers, EW & Lipman, DJ (1990) "Basic local alignment search tool." J. Mol. Biol. 215:403-410.).

[0132] The claimed enzymes may have at least 70%, 75%, 80%, 85%, 90%, 95% or 90% sequence identity with any of the enzymes listed in Table 1. The enzymes may additionally be truncated to provide core secondary structural elements for function, e.g., by removing 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) amino acids from the N-terminus and / or C-terminus of the construct.

[0133] Sequence identity is calculated relative to the full-length sequence.

[0134] Separation

[0135] The protein or nucleic acid may be isolated. "Isolated" means that the protein or nucleic acid molecule is not in its native state, but has been purified to at least a certain degree or has been produced synthetically, for example, by recombinant methods. Thus, the term "isolated" includes the possibility that the molecule is combined with other biological or non-biological materials (such as cells, suspensions of cells or cell fragments, proteins, peptides, expression vectors, organic or inorganic solvents, or other appropriate materials), but excludes the situation where the protein is in the state found in nature.

[0136] Mutants

[0137] Mutant means an enzyme that is different from the wild type (e.g., full-length wild type form) (i.e., variant, and these terms are used interchangeably in this application). Mutants can be obtained by various techniques well known in the art. In particular, examples of techniques for changing the DNA sequence encoding the wild-type protein include, but are not limited to, site-directed mutagenesis, random mutagenesis, and synthetic oligonucleotide construction. That is, a variant or mutant may have an altered amino acid sequence.

[0138] Corresponding means the equivalent amino acids in any sequence of the enzyme.

[0139] Corresponding or equivalent amino acids can be found using sequence alignment software (such as the BLAST sequence alignment tool mentioned above).

[0140] Nucleic Acids

[0141] These nucleic acids may have 70%, 75%, 80%, 85%, 90%, 95% or 100% sequence identity to those listed in Table 1.

[0142] Expression cassette

[0143] The term "expression cassette" refers to a nucleic acid construct comprising a coding region (ie, a nucleic acid of the invention) and an operably linked regulatory region (ie, comprising one or more control sequences).

[0144] The expression cassette may be part of an expression vector. As used herein, the term "expression vector" means a DNA or RNA molecule comprising an expression cassette of the invention. Preferably, the expression vector is a linear or circular double-stranded DNA molecule.

[0145] The expression cassette can be part of an in vitro transcription and translation system, or can be expressed by a host cell.

[0146] Host cells

[0147] Host cells can be transformed, transfected or transduced in a transient or stable manner. The expression cassette or vector of the present invention is introduced into the host cell so that the cassette or vector is maintained as a chromosomal integrant or as an autonomously replicating extrachromosomal vector. The term "host cell" also encompasses any offspring of a parent host cell that is not identical to the parent host cell due to mutations occurring during replication. The host cell can be any cell useful for producing a variant of the present invention, such as a prokaryotic cell or a eukaryotic cell. For example, a prokaryotic host cell can be any Gram-positive or Gram-negative bacterium. Nucleic acid, expression cassette or expression vector according to the present invention can be introduced into a host cell by any method known to the technician, such as electroporation, conjugation, transduction, competent cell transformation, protoplast transformation, protoplast fusion, bioballistic "gene gun" transformation, PEG-mediated transformation, lipid-assisted transformation or transfection, chemical-mediated transfection, lithium acetate-mediated transformation, liposome-mediated transformation.

[0148] Optionally, more than one copy of a nucleic acid, cassette or vector of the invention may be inserted into a host cell to increase production of the variant.

[0149] In certain embodiments, the host cell is a recombinant microorganism. The present invention does allow engineering of microorganisms with improved ability to degrade polyester-containing materials. For example, the sequences of the present invention can be used to supplement wild-type strains of fungi or bacteria known to be able to degrade polyester in order to improve and / or increase strain capabilities.

[0150] use

[0151] The above description of the enzymes applies to the use of these enzymes.

[0152] Enzyme structure

[0153] The atomic coordinates of RR1102 (designated variant) have been deposited under accession number PDB ID: 6ZZV.

[0154] The atomic coordinates of CI5En2-A9S (designated variant) have been deposited under accession number PDB ID: 7NCQ.

[0155] The active site residues are given in Tables 2 and 3 below.

[0156] RMSD

[0157] The single root mean square deviation (RMSD) is a measure of the average distance between the backbone atoms of superimposed protein structures. RMSD can be calculated using any algorithm, for example as described in Coutsias EA, Seok C, Dill KA (2004). "Using quaternions to calculate RMSD". J Comput Chem. [Journal of Computational Chemistry] 25(15): 1849-1857.

[0158] Table 2. Active site residues

[0159] Active site residues RR11O2 S149 / D311 / E212 / H308

[0160] Table 3. Active site residues of CI5En2

[0161] Active site residues Cl5En2-wt S138 / D184 / H216

[0162] The atomic coordinates of these residues can be found in Fig.16 and 17 Found in.

[0163] The atomic coordinates may be on a computer readable medium.

[0164] In addition to Table 3, the active site residues may include any one or more of the following: Asn 137, Tyr 72, Val 71, Thr 220, Phe 221, Leu 217, Leu 222, Phe 68, Ala 67, Ile 186, Met 139, Ala 187, Trp 163, Leu 66, and Phe 65. For example, in addition to those in Table 3, the active site residues may include all of these residues.

[0165] Uses of atomic coordinates

[0166] Atomic coordinates can be used to optimize the plastic degradation activity of an enzyme by computational design (i.e., by computer-implemented methods), which may include computationally mutating amino acids within the active site to: i) alter plastic substrate binding or ii) increase the rate of the hydrolysis reaction. This can be done using https: / / funclib.weizmann.ac.il / bin / steps Atomic coordinates can also be used in the same way to increase the thermostability of an enzyme. This can be done using https: / / pross.weizmann.ac.il / step / pross-terms / .

[0167] By "optimizing thermostability" is meant increasing the predicted melting temperature of an enzyme.

[0168] Atomic coordinates can also be used to design plastic hydrolases, for example using the protocol described by Richter F, Leaver-Fay A, Khare SD, Bjelic S, Baker D (2011) De Novo Enzyme Design Using Rosetta3. PLoS ONE 6(5): e19230.

[0169] The atomic coordinates used can be Fig.16 or the amino acid coordinates in 17. Fig.16 The amino acid coordinates of RR1102 are listed. Amino acid residues 12-325 are listed in Fig.16 middle. Fig.17 The amino acid coordinates of CI5En2-A9S are listed. Amino acid residues 2-267 are listed at Fig.17 middle.

[0170] These coordinates can additionally be truncated to core secondary structure elements, for example by removing 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) amino acids from the N-terminus and / or C-terminus.

[0171] Throughout this specification, unless the context requires otherwise, the terms "comprise" or "include" or variations such as "comprises or comprising", "includes or including", will be understood to imply that the method or kit includes the stated integer or groups of integers but not excluding any other integer or groups of integers.

[0172] Further features of the invention

[0173] In addition, the plastic particles can alternatively be biopolymer particles. For example, particles comprising or consisting of biopolymers such as chitin, lignocellulosic biomass, cellulose, starch, alginate, natural rubber, keratin, cutan or melanin. Biopolymers refer to polymers produced by living organisms such as plants and microorganisms or derived from living organisms rather than derived from petroleum (the traditional source of polymers).

[0174] Therefore, the method may be a method for identifying a biopolymer degrading enzyme or optimizing a biopolymer degrading enzyme, the method comprising:

[0175] a) encapsulating the gene library into a plurality of microfluidic droplets, each microfluidic droplet comprising at least one gene, and each microfluidic droplet further comprising:

[0176] i) an expression system for expressing the gene; and

[0177] ii) biopolymer particles;

[0178] b) detecting degradation of the biopolymer particles in the microfluidic droplets; and

[0179] c) Selecting a microfluidic droplet in which biopolymer degradation has been detected.

[0180] The embodiments described above with respect to plastic particles apply equally to those described herein with respect to biopolymers.

[0181] The present invention is also described by the following numbered clauses:

[0182] 1. A method for screening an optimized polymer degrading enzyme, the method comprising:

[0183] a) encapsulating a gene library having variant gene sequences of the polymer degrading enzyme into a plurality of microfluidic droplets, each microfluidic droplet comprising at least one variant gene sequence of the polymer degrading enzyme, and each microfluidic droplet further comprising:

[0184] i) an expression system for expressing the gene; and

[0185] ii) polymer particles;

[0186] b) detecting degradation of the polymer particles in the microfluidic droplets; and

[0187] c) Selecting a microfluidic droplet in which polymer degradation has been detected.

[0188] 2. A method for identifying a polymer degrading enzyme, the method comprising:

[0189] a) encapsulating the gene library into a plurality of microfluidic droplets, each microfluidic droplet comprising at least one gene, and each microfluidic droplet further comprising:

[0190] i) an expression system for expressing the gene; and

[0191] ii) polymer particles;

[0192] b) detecting degradation of the polymer particles in the microfluidic droplets; and

[0193] c) Selecting a microfluidic droplet in which polymer degradation has been detected.

[0194] 3.a) The method according to clause 1, wherein

[0195] The gene library is a directed evolution library; or

[0196] b) The method of clause 2, wherein the gene library is a metagenomic library; and / or

[0197] c) The method according to Item 2, wherein the method further comprises preparing a gene library having a variant gene sequence of the identified polymer degrading enzyme, and performing the method according to Item 1.

[0198] 4. The method of any one of clauses 1 to 3, wherein the polymer is a biopolymer, such as any of the biopolymers described above.

[0199] 5. The method of clause 4, wherein degradation is detected by detecting a decrease in light scattering caused by the biopolymer particles.

[0200] 6. The method of clause 2, wherein the method is performed prior to a screening method for identifying a gene sequence of a polymer degrading enzyme (optionally a biopolymer degrading enzyme), wherein the screening method comprises:

[0201] a) encapsulating the gene library into a plurality of microfluidic droplets, each microfluidic droplet comprising at least one gene, and each microfluidic droplet further comprising:

[0202] i) an expression system for expressing the gene; and

[0203] ii) a soluble polymer mimetic (optionally a soluble biopolymer mimetic);

[0204] b) detecting cleavage of the soluble polymer mimetic in the microfluidic droplet; and

[0205] c) selecting a microfluidic droplet in which lysis has been detected, optionally wherein the gene library is a metagenomic library.

[0206] Each document, reference, patent application or patent cited herein is expressly incorporated herein by reference in its entirety, which means that the reader should read and consider the above documents as part of this article. For the sake of brevity only, the documents, references, patent applications or patents cited herein are not repeated herein. Reference to the cited materials or information contained herein should not be understood as an admission that the materials or information are part of the common general knowledge or are known in any country. BRIEF DESCRIPTION OF THE DRAWINGS

[0207] Figure 1Functional metagenomics of esterase activity in microfluidic droplets is shown. (a) Pooled metagenomic libraries from eight different sources contain 1.25 x 10 6 members and insert sizes ranging from 1 to 5 kb. (b) Pooled metagenomic DNA was transformed into efficient Escherichia coli (E. coli) cells and compartmentalized into water-in-oil droplets under a Poisson distribution (λ = 0.35, 24.6% of the droplets were individually compartmentalized) together with 20 μM (1) fluorescein dihexanoate substrate and cell lysis reagent. (c) Droplets were incubated off-chip at room temperature for 24 to 72 hours and (d) sorted by FADS. The gate was adjusted to fluorescence above the reaction background, and the sorted droplets were de-emulsified and (e) DNA recovered. (f) The recovered plasmids were transformed into E. coli BL21 and the cells were plated on LB agar plates containing 1% (2) tributyrin and used for secondary screening by detecting transparent halos around positive hit colonies. (g) Potential candidates were sequenced and the predicted genes were annotated. (h) Genes encoding esterases / lipases or α / β hydrolases were compared with known databases and cloned into expression vectors to obtain kinetic and promiscuity curves for identification of hits with unique features of (i).

[0208] Figure 2a. Design of the microfluidic device used during the experiment. (a) Flow focusing device for generating monodisperse water-in-oil droplets. Two aqueous solutions containing substrate and cells were injected from inlets 2 and 3, respectively. Inlet 1 was used for the oil-surfactant mixture. Droplets were collected from outlet 4. The depth of the droplet generation device was 80 μm. The channel at the flow focusing junction was 50 μm wide, and there was an additional 25 μm wide constriction that promoted droplet formation. (c) Sorting device for scattering-activated screening of droplets. Number 5 indicates the inlet of the droplet emulsion, and numbers 6 and 7 represent the inlets of space and bias oil, respectively. The inlet of the 5M NaCl solution for generating the high-voltage signal is marked with 8 and 9, which are used for the ground [GND(-)] and signal [signal(+)] electrodes, respectively. The outlets of the positive channel (ch+) and the negative channel (ch-) are marked with numbers 10 and 11, respectively. Numbers 12 and 13 indicate the insertion sites of the FC / PC fibers, 25 μm, 0.1 NA and 105 μm, 0.22 NA (Thorlabs, UK), respectively. The depth of the entire sorting device is 100 μm, except for the reinjection chamber, which is 50 μm deep. The width of the channel at the sorting junction is 50 μm wide. The scale bar is 5 mm.

[0209] Figure 2b. Scheme of the optical setup for scattering-activated droplet sorting. The setup is a modification of a previously proposed system for fluorescence-activated droplet sorting (van Loo et al. ACS Synth. Biol. 2019, 8, 12, 2690-2700). Most of the microfluidic device is illuminated by red light from the microscope lamp through a 593 nm long pass filter F1 (FF01-593 / LP-25, Semrocks) and a lens (L1) of the microscope light collector. The transmitted red light is then collected by an objective lens (usually 10x or 20x), which leaves the microscope through a photographic window and is recorded by a fast camera (Miro eX4, Phantom, USA). Light from a 488 nm laser (Stratus) passed through a neutral density filter OD=1 (NE10A, Toll Laboratories) and was then delivered to the sorting junction by coupling to an input light fiber (25 μm, 0.1 NA, FC / PC, Toll Laboratories) via a C1 collimator (adjustable FC / PC collimator, CFC-11X-A, Toll Laboratories). Typically, the input intensity of the laser was set to 10 mW, which was converted to 1 mW on the chip after passing through an ND filter. Light emitted from a detection fiber (25 μm, 0.1 NA, FC / PC Toll Laboratories) was connected via a C2 collimator (CFC-11X-A, Toll Laboratories) to a detector tube housing an F2 bandpass filter (FL488-10 nm, Toll Laboratories) 50 mm before the detector mounted on a photomultiplier tube PMT (PM002, Toll Laboratories). A single spherical lens (L2, L3) is used to focus light on the detectors of the camera and PMT. The scattered light signal is recorded by the PMT coupled to the FPGA NI card and analyzed in real time by a custom written LabVIEW program. The black arrow indicates the direction of the signal and trigger in the system. When the scattered light signal is higher than the threshold value set arbitrarily, the FPGA card triggers a series of electronic devices to generate a high-voltage pulse (1kV): pulse generator PG (TGP110, Thurlby Thandar Instrument Company) -> function generator FG (TG200, Thurlby Thandar Instrument Company) -> high-voltage amplifier AMP (610E, Trek Company (Trek)). By filling with a "salt electrode" of 5M NaCl solution 7, a short 2ms long pulse is delivered to the microfluidic device with a delay of 2.5ms, and as a result, the high fluorescent droplet deviates to the collection channel for positive "hit" (b). The duration and delay of the pulse can be improved according to the flow rate and the desired sorting flux (up to 350Hz), depending on the quality of the input emulsion.

[0210] Figure 3Shown is the process from fluorescent droplet sorting to positive hit identification. A metagenomic library of over 1 million members was sorted for esterase activity using (1) fluorescein dihexanoate as a bait substrate. Water-in-oil droplets were incubated at room temperature for up to 3 days and sorted above threshold via FADS, where (A) shows fluorescence histograms of sorted droplets after incubation of Activity I for 1 day (10 million droplets screened, 126 droplets sorted - representing a sorting fraction of 0.0012%) and 2 days (5.7 million droplets screened, 110 droplets sorted - representing a sorting fraction of 0.0019%). After droplet sorting and DNA recovery, the recovered plasmids were transformed into cells for secondary screening (B and C). (B) Transparent halos were formed around colonies of potential positive candidates for esterase activity by hydrolysis of 1% (2) tributyrin to glycerol and butyrate. (C) Activity was further confirmed via reaction with fluorescein dihexanoate. When using a fluorescence microplate reader, the hydrolysis of fluorescein dihexanoate to fluorescein monohexanoate and hexanoic acid by positive candidates can be monitored. P35 and Est30 were used as negative and positive controls, respectively, and the gray dashed line represents the background reaction of the negative control. Reactions were performed in triplicate, and the standard error of the measurement is shown as an error bar.

[0211] Figure 4 shows metagenomic hits: exploration of the α / β hydrolase superfamily and their activities. The context of the sequences of the metagenomic hits was investigated along with their functional activities towards p-NP acyl esters, pH profiles and melting temperatures. (A) A sequence network was generated using sequences retrieved from the α / β hydrolase clan (CL0028 from Pfam classification) and the 13 metagenomic hits identified in this work. The created network contains 370,000 sequences clustered into 20,000 nodes representing 80% of CL0028. The node size is proportional to the number of sequences represented (range 1 to 2600, median 4). Connecting lines represent e-values ​​<10 -20of alignments with a median alignment length of 312. (B, C, and D) Functional characterization of metagenomic hits. ORFs encoding esterase / lipase activities were individually cloned into expression vectors, and the corresponding recombinant proteins were tested for p-NP acyl esters (B), pH (C), and melting temperature (D). (B) The catalytic efficiency of metagenomic hits was measured for different p-NP acyl esters [acetate (C2), butyrate (C4), hexanoate (C6), octanoate (C8), decanoate (C10), dodecanoate (C12), myristate (C14), and palmitate (C16)]. Reactions were performed at 22°C in a buffer containing 50 mM Tris-HCl pH 8.0 and 0.3% (v / v) Triton X-100. (C) pH profiles were performed for 1 mM p-NP C6 in citrate buffer (pH 4.0, 5.0, and 6.0), phosphate (pH 6.0, 7.0, and 8.0), Tris-HCl (pH 7.0, 8.0, and 9.0), or CAPS (pH 9.5, 10.0, and 11.0). (D) Melting temperatures (Tm) were determined via thermal shift assays, where their denaturation promotes the release of Sypro Orange, and the released fluorescence (λ) was measured by a temperature ramp from 20°C to 100°C. 激发 =410nm,λ 发射 =610 nm). Experiments were performed in triplicate and data were normalized prior to Kaleidagraph analysis. Assays were performed in a buffer containing 100 mM Tris-HCl pH 8.0 and 100 mM NaCl.

[0212] Figure 5Exploration of sequence space to discover PET hydrolases is shown. (A) Sequence network of currently known PETases and the novel esterase metagenomic-derived RR11O2. 3408 sequences were retrieved from the MGnify and NCBI databases, and the resulting sequence network is shown here (sequences with 20% to 50% identity are not shown). Grey nodes represent sequences extracted from MGnify and NCBI. Red nodes represent RR11O2, blue nodes represent known PETases, green and orange nodes represent reported cutinases and esterases showing PET activity, respectively, and light blue nodes represent polyester degrading enzymes described in the literature. In order to presumptively characterize sequence clusters, identification of PETases, cutinases, esterases, and RR11O2 in the network helps define potential clusters. Clusters of RR11O2, Cl5En2, and PETases are written in grey. (B) PET hydrolase catalyzes the depolymerization of poly(ethylene terephthalate) (PET) into bis(2-hydroxyethyl) terephthalate (BHET), mono(2-hydroxyethyl)-terephthalic acid (MHET) or terephthalic acid (TPA) and ethylene glycol (EG). During characterization via high performance liquid chromatography (HPLC), MHET and TPA have been identified as the major products. (C) Enzymatic degradation of PET by RR11O2, Cl5En2 and control LCC, LCC-ICCG and IsPET enzymes. HPLC analysis of compounds released from crystallized PET films after three days of incubation at 37°C using 6 μM of the enzyme. The absorbance at 250 nm was monitored.

[0213] Figure 6 Functional screening of enzymes from a metagenomic library via fluorescence-activated droplet sorting (FADS) followed by a directed evolution cycle using droplet-based scattered light-activated sorting (SADS). Figure 1As described, in order to screen the metagenomic library for esterase activity, isolated environmental DNA (eDNA) was cloned into a plasmid. After transforming the bacterial cells, the single cells were co-encapsulated in microdroplets with a lysing agent and a fluorescein dihexanoate substrate. After incubation outside the chip, the droplets were reinjected into the FADS sorting device and positive hits were selected. Rescreening and sequencing after recovering the DNA resulted in new esterases that showed promiscuous activity against PET. This enzyme was used together with known PET enzymes to generate sequence networks. Cl5En2 was identified as a new PET hydrolase in the cluster. This enzyme was subjected to directed evolution activities. Single bacterial cells were encapsulated in microdroplets with a lysing agent and PET nanoparticles used as assay substrates. The droplets were incubated in a droplet chamber and reinjected into the sorting module. The SADS module relies on optical fibers integrated into the chip at a 90° angle. Schematic diagram showing the main principles of the assay. If the enzyme degrades plastic nanoparticles, the intensity of the scattered light decreases. DNA was recovered from the positive droplets and rescreened and sequenced to produce improved PET hydrolases. For further improvement, iterative rounds of evolution were performed. (B) Subsequent independent video frames depicting a sorting event. The microdroplet sorting device measures the intensity of light scattering as the droplet flows in front of the optical fiber. When the measured value is within a user-defined threshold, dielectrophoretic sorting of "positive" droplets is triggered. (C) Histogram of light scattering detected for co-encapsulated Cl5En2 (600nM) or buffer control and PET nanoparticles. The signal of the enzyme-containing droplets decreases over time due to the depolymerization of PET. (D) Bar graph showing the results of sorting experiments performed with single-cell droplet lysates of an error-prone PCR library expressing Cl5En2. Sorting was performed after two weeks of incubation at room temperature. The values ​​of light scattering from sorted positive droplets are marked in green and represent 0.5% of the population.

[0214] Figure 7 Structural features of RR11O2, a member of a protein of unknown function (DUF3089), are shown. (A) Protein structure of RR11O2, with chain A (left) shown as a B-factor analysis and chain B (right) shown as a cartoon (α-helix is ​​dark salmon and β-strand is black). (B) Details of the cavity (blue) of RR11O2 and the catalytic triad (cyan) S149, D311 and H308. (C) The catalytic efficiency of RR11O2 was measured for p-NP acyl esters [acetate (C2), butyrate (C4), hexanoate (C6), octanoate (C8), decanoate (C10), dodecanoate (C12), myristate (C14) and palmitate (C16)]. Reactions were performed at 22°C in a buffer containing 50 mM Tris-HCl pH 8.0 and 0.3% (v / v) Triton X-100.

[0215] Figure 8Shows the predicted binding modes of p-nitrophenol acyl esters with different chain lengths. The maximum binding sites of RR1102 predicted by the PRANK server (18) (considered the active sites) are colored red (pocket A) and blue (pocket B). (A) All 10 poses of the binding modes generated for each substrate binding to the active site of RR1102. Substrates with alkyl chains C2 to C8 are predicted to bind within the inner active site pocket (pocket A) in all predicted binding modes. However, C10 to C16 are predicted not to fit within the active site pocket (pocket A). This predicted binding mode is verified by the lack of activity towards substrates with chain lengths C10 to C16. (B) Activity of the substrates used in the modeling study. (C) Structures of the substrates used in the modeling study.

[0216] Figure 9a shows the screening and characterization of the improved variants. (A) After sorting the ep-PCR library of Cl5En2, variants with higher activity compared to the wild type were enriched. After recovering and transforming the DNA, colonies were randomly picked from the unsorted original library and the sorted samples at 8 days, two weeks, and five weeks, and subsequently plated for assays against the p-NP C12 substrate. The data were normalized relative to the rate of Cl5En2-wt. The bar graph gives the comparison of variants showing higher activity (activity > wt) or lower activity (activity < wt) compared to the wt. (B) Variants with higher activity than the wild type were enriched after three rounds of evolution of Cl5En2. The box plot shows the mean ( ), median (–), quartiles (box), and range (whiskers). (C) Activity of the variants with improvement compared to Cl5En2-wt and the metagenome-derived hit RR11O2. PET nanoparticles were incubated with 6 μM enzyme at 37 °C for one hour. The amounts of released monomer TPA and MHET were determined by HPLC and the corresponding standard curves of TPA and MHET. (D) Shows the results of a time-course experiment conducted over 22 hours in microdroplets of amorphous PET NP incubated with 600 nM A10 and Cl5En2-wt.

[0217] Figure 9b shows the thermal stability of Bla-Cl5En2-wt, its variants, and the IsPET enzyme. The melting temperature (Tm) of the purified enzymes was determined via a thermal shift assay, where their denaturation promotes the release of Sypro Orange, and the released fluorescence was measured by a temperature ramp from 25 °C to 95 °C (λ 激发 = 410 nm, λ 发射 = 610 nm). Experiments were performed in triplicate, and the data were normalized before analysis with Kaleidagraph. The assays were conducted in a buffer containing 100 mM Tris-HCl pH 8.0 and 100 mM NaCl.

[0218] Fig.10 The structural features of Cl5En2-A9S (PDB code 7NCQ) are shown. (A) Protein structure of Cl5En2-A9S obtained at high resolution. Cl5En2-A9S exhibits an α / β fold, and two molecules (chains A and B) are observed in the unit cell. (B) Residues that make up the catalytic triad (S138, D184, and H216).

[0219] Fig.11 RR11O2 is shown with a substrate transparent inlet and inner cavity. (A and B) RR11O2 is shown as a blue surface, and the inlet into the catalytic triad is highlighted with dots and gray arrows (A) and black arrows (B and C). B-The protein surface is shown with 60% transparency, allowing visualization of the residues of the catalytic triad (S149, D311 and H308) inside the protein. (C) The cavity of RR11O2 is shown in the same position as in (A) and (B) and after a 90° flip to the right. The import position is shown with a black arrow.

[0220] Fig.12 Secondary and tertiary structure comparisons of RR1102 with members from the α / β fold family are shown. (A) Diagram of the secondary structure of RR1102. Structurally conserved secondary structures between RR1102 and other α / β fold hydrolases are color matched. (B) Overview of the secondary structures of α / β hydrolases. Structurally conserved secondary structures between RR1102 and other α / β fold hydrolases are color matched. Gray secondary structures are non-conserved; (C) β-sheets and α-helices of the α / β hydrolase fold conserved in RR1102; for (A), (B), and (C), the structurally conserved structures are color matched. (D) Structural alignment of RR1102 (PDB code 6ZZV) against a representative α / β hydrolase fold (PDB code 1UFO). Alignment was performed using the super function in Pymol; (E) Structural alignment of the B-sheet of RR1102 with the B-sheet of PDB code 1UFO; (F) Structural alignment of the conserved α-helices of RR1102 and 1UFO; Structural alignment of the conserved α-helices and β-sheets of RR1102 and 1UFO; (G) Full structural alignment of RR1102 (PDB 6ZZV) against the full structure of a representative α / β hydrolase fold (PDB code 1UFO).

[0221] Fig.13The catalytic triad of RR1102 (PDB 6ZZV) is shown. Structural alignment of the conserved α-helix α-F from RR1102 and α-C from PDB code 1UFO. (A) Position of the nucleophile (Ser149 of RR1102 and Ser113 of PDB code 1UFO), (B) Position of Asp183 of the catalytic triad from PDB code 1UFO compared to the positions of Asp311 and Glu212 in RR1102. There is little conservation of secondary structure in this part of RR1102; (C) Structural alignment of α-J from RR1102 and α-E from PDB code 1UFO. The position of the basic His of the catalytic triad from both structures is shown; (D) Position of the catalytic triad in the 10 structures with the highest structural similarity identified by the DALI server; (E) Position of the possible third member of the catalytic triad in the active site of RR1102.

[0222] Fig.14 Shown is a study of the flexibility of the loops on the RR11O2 structure (PDB 6ZZY). (A) Normalized B-factors of chain A of the 3D structure of RR11O2 with respect to the two active site loops (loop 1 and loop 2). (B) Position of the flexible active site and loop (loop 1) in the structure of RR11O2. (C) Structure of chain A of RR11O2, where color and size represent B-factors; (D) Position of the flexible active site loop and predicted binding mode of the substrate.

[0223] Fig.15a The hydrodynamic diameter distribution of PET NPs is shown. Starting from amorphous films or crystalline powders, the particle size was determined by dynamic light scattering (DLS). The polydispersity index (PdI) of the suspension is shown.

[0224] Fig.15b Enzymatic degradation of amorphous and crystalline PET NPs is shown. HPLC analysis of the released products after one week of incubation at 30°C with 6 μM pExp-bla-Cl5En2-WT. The absorbance at 250 nm was monitored, which detected the released TPA and MHET.

[0225] Fig.15c Dynamic light scattering (DLS) measurements of stabilized nylon 6 and nylon 66 nanoparticles (NPs) were performed to determine size distribution. (A) Nylon 6 NPs stabilized with 0.1% SDS. (B) Nylon 66 NPs stabilized with 0.1% SDS. d: diameter; PdI: polydispersity index.

[0226] Fig.16 The atomic coordinates of RR1102 are shown.

[0227] Fig.17The atomic coordinates of CI5En2-A9S soaked with BHET are shown.

[0228] Fig.18 The protein structure of Cl5En2-A9S (PDB code 7ZJ9) soaked with BHET is shown. Crystals of Cl5En2-A9S were obtained under Proplex H2 (0.1M MES pH 6.5, 1M LiSO4) conditions and they were soaked in a mother solution reservoir containing 3.5mM for 46min. High-resolution datasets under . Surface display (A) and cartoon display (B) of Cl5En2-A9S in complex with BHET hydrolysis product TPA. (C) Catalytic triad of Cl5En2 (S138, D184 and H216, green) in complex with TPA (blue). The presence of sulfate in crystallization conditions is shown in all figures.

[0229] Fig.19 The protein structure of Cl5En2-A9S co-crystallized with polycaprolactone PCL (PDB code 7ZJA) is shown. Cl5En2-A9S crystallized in the presence of PCL nanoparticles and successfully formed crystals under the conditions of "classical H8" [0.1M MES pH6.5, 30% w / v, PEG MME5K, 0.2M (NH4)2SO4]. Cl5En2-A9S co-crystallized with PCL was obtained. High-resolution datasets. Surface display (A) and cartoon representation (B) of Cl5En2-A9S in complex with 6-hydroxyhexanoic acid, a PCL hydrolysis product. (C) Catalytic triad of Cl5En2 (S138, D184, and H216, green) in complex with 6-hydroxyhexanoic acid (blue).

[0230] Figure 20 shows a) dynamic light scattering (DLS) measurements of 5 mg / mL lignin nanoparticles (NPs) to determine the size distribution (d: diameter; PdI: polydispersity index) and b) scattering-activated measurements of droplets containing lignin NPs (5 mg / mL lignin NPs were encapsulated in 150 pL droplets).

[0231] Fig.21 Exploration of sequence space to discover new nylonases is shown. (A) Homologs of NylC were extracted from the MGnify database (NCBI accession code: Q1EPR5.2) and used to generate a sequence network consisting of 1583 node and 69291 edge sequences. (B) The first neighbor sequence of NylC was identified and the closest candidates were selected (C), which included Nyl2 (MGnify code: MGYP000645618208).

[0232] Fig. 22 Exploration of sequence space to discover new nylonases is shown. (A) Homologs of NylC were extracted from the MGnify database (NCBI accession code: Q1EPR5.2) and used to generate a sequence network consisting of 1583 node and 69291 edge sequences. (B) The first link of MGYP000645618208 (sequence retrieved from MGnify under the listed code) was identified and the sequence space was divided into clusters (from 1 to 3). Potential nylonase candidates were selected from each cluster, including: Nyl5 (MGnify code: MGYP000544655629, from cluster 1) and Nyl9 (MGnify code: MGYP000403660814, from cluster 3).

[0233] Fig.23 High performance liquid chromatography (HPLC) analysis of products released from the depolymerization of nylon 6 nanoparticles is shown. The reaction was monitored after one week of incubation at 37°C using 10 μM of the enzymes Nyl-2, Nyl-3, Nyl-5, Nyl-9 and buffer control. Released 6-aminohexanoic acid was detected by measuring the absorbance at 220 nm. The time offset was 2%.

[0234] Fig.24a High performance liquid chromatography (HPLC) analysis of products released from depolymerization of nylon 6 nanoparticles is shown. The reaction was measured after 3 days of incubation at 37°C using 18 μM of the enzyme Bla-Nyl soil and a buffer control. Released 6-aminohexanoic acid was detected by measuring the absorbance at 220 nm. Figure 24b High performance liquid chromatography (HPLC) analysis of the products released by depolymerization of tights samples is shown. The reaction was measured after incubation at 37°C using 18 μM of the enzymes Nyl-2, Nyl-5, Nyl-9, Nyl-10, Nyl-11, Nyl-12, Nyl-14, Nyl-Mar-2, Nyl-18, Nyl-20, Nyl-24, Nyl-25, as well as a negative buffer control and a positive Nyl-C control over a period of 1 week. The released 6-aminohexanoic acid (Ahx) was detected by measuring the absorbance at 220 nm.

[0235] Fig.25Exploration of sequence space on the Uniprot / SwissProt / NCBI database to discover new nylonases is shown. Homologs of amidase (NCBI code WP_011209364.1), NylA (NCBI accession codes: P13397 and P13398), NylB (NCBI accession code P07061), and NylC (NCBI accession code: Q1EPR5.2) were extracted from the Uniprot / SwissProt / NCBI database and used to generate a sequence network consisting of 9,770 sequences. The first neighbor sequence of NylC was identified, and 295 sequences were retrieved for phylogenetic analysis. The sequences retrieved were Nyl-10 (Uniprot code A0A1C6V3K0), Nyl-11 (Uniprot code A0A138ZXG5), Nyl-12 (Uniprot code A0A1M7HAK8) and Nyl-14 (Uniprot code WP243569406.1).

[0236] Fig.26 Exploration of sequence space on the full-length database MGnify to discover new nylonases is shown. (A) Homologs of amidase (NCBI code WP_011209364.1), NylA (NCBI accession codes: P13397 and P13398), NylB (NCBI accession code P07061), and NylC (NCBI accession code: Q1EPR5.2) were extracted from the MGnify / full-length database and used to generate a sequence network consisting of 10,233 sequences. (B) The first neighbor sequence of NylC was identified, and (C) 497 sequences were retrieved for phylogenetic analysis. The sequences retrieved were Nyl 18-FL (MGnify code MGYP000370831902 / 2-317), 20-FL (MGnify code MGYP000123679597 / 3-313), 24-FL (MGnify code MGYP000614730541 / 11-353) and 25-FL (MGYP000554001943 / 18-373).

[0237] Fig. 27Exploration of sequence space on the soil database MGnify to discover new nylonases is shown. Homologs of amidase (NCBI code WP_011209364.1), NylA (NCBI accession codes: P13397 and P13398), NylB (NCBI accession code P07061), and NylC (NCBI accession code: Q1EPR5.2) were extracted from the MGnify / soil database and used to generate a sequence network consisting of 1,108 sequences. The first neighbor sequence of NylC was identified and 77 sequences were retrieved for phylogenetic analysis. The retrieved sequences were soil 1 (MGnify code MGYP000120183263 / 1-286).

[0238] Fig.28 Exploration of sequence space on the marine database MGnify to discover new nylonases is shown. (A) Homologs of amidase (NCBI code WP_011209364.1), NylA (NCBI accession codes: P13397 and P13398), NylB (NCBI accession code P07061), and NylC (NCBI accession code: Q1EPR5.2) were extracted from the MGnify / marine database and used to generate a sequence network consisting of 7,089 sequences. The first neighbor sequence of NylC was identified and (C) 344 sequences were retrieved for phylogenetic analysis. The retrieved sequences are marine2 (MGnify code MGYP000645432643 / 3-305).

[0239] Examples

[0240] Various aspects of the invention will now be described, by way of example only, and with reference to the following experiments.

[0241] General Materials and Methods:

[0242] Fabrication of a microfluidic chip for scattering-activated droplet sorting (SADS)

[0243] Microfluidic devices for droplet generation and droplet sorting were fabricated following classical soft lithography procedures by patterning with high-resolution acetate masks and SU-8 photoresist. To fabricate a single PDMS [poly(dimethylsiloxane)] microfluidic device, 20-30 g of silicone elastomer base and curing agent (Sylgard TM184, Dow Corning (Dow Corning, the United States) in a plastic cup with a ratio of 10: 1 (v: v), and then degassed in a vacuum chamber. Next, PDMS was poured onto the SU-8 master wafer and cured at 65 ° C in an oven for at least 4 hours. The patterned PDMS chip was then plasma bonded to a 50mm x 75mm x 1mm (length x width x thickness) glass slide in a low-pressure oxygen plasma generator (Femto, Diener Electronics, Germany). Next, the device was rinsed with 1% (v / v) trichloro (1H, 1H, 2H, 2H-perfluorooctyl)-silane (Sigma Aldrich, the United Kingdom) in HFE-7500 (3M, the United States) and baked on a hot plate at 75 ° C for 30 minutes to evaporate the fluorocarbon oil and silane mixture.

[0244] Fabrication of the sorting chip requires additional integration with an incident light and a detection multimode optical fiber with an FC / PC type connector. The incident fiber (Catalog No. M67L02, Toll Laboratories) has a cladding diameter of 125 μm and a core diameter of 25 μm, with a numerical aperture (NA) of 0.1. The detection fiber (Catalog No. M43L02, Toll Laboratories) has a cladding diameter of 125 μm and a core diameter of 105 μm, with an NA of 0.22. Both fibers were cut at their ends to remove one of the FC / PC connectors, followed by a three-hole fiber stripper (Catalog No. FTS4, Toll Laboratories) to remove the clamped outer protective PVC, cut with a scalpel. The protective threads and finally the acrylate coating are removed using a fiber stripping tool (Catalog No. T06S13, Thor Labs). In the next step, the tip of the fiber tip is cut using a ceramic fiber scriber (Catalog No. CSW12-5, Thor Labs) to obtain a flat tip. The quality of the cleavage is checked by passing a low power (e.g., 0.1 mW) laser through the fiber and visually inspecting the shape of the light beam emitted from the fiber tip. If necessary, the cleavage is repeated until a spherical shape of the light beam is observed. The fiber end is fixed to the microfluidic chip at least 1 day before the experiment. The fiber fixing process is performed on a microscope stage, and a microscopic camera is used to verify the position of the fiber end. First, the microfluidic channel containing the optical fiber is filled with liquid PDMS, and then the fiber tip is manually inserted into the chip. In addition, the fiber tip is manually inserted into the chip by using epoxy glue ( The optical fiber was attached to the glass slide of the chip using a two-component epoxy paste adhesive to stabilize the optical fiber. The entire chip was placed on a microscope stage overnight to allow the PDMS and glue to cure at room temperature. This chip can be used for several sorting experiments, provided that they are carefully washed with pure HFE-7500 and dried by blowing them with compressed air after each use.

[0245] Expression of gene library

[0246] To express the enzyme, the following protocol can be used:

[0247] • Transform E. coli cells with the gene library and grow the cells in culture flasks.

[0248] When cells reach a specific OD, use IPTG to induce protein expression. For example, induce with 0.4 mM IPTG at an OD of 0.5.

[0249] - Incubate the culture at 20°C overnight.

[0250] Encapsulate single cells into droplets along with lysis agents.

[0251] Another strategy that can be used is to encapsulate single cells into droplets along with the culture. The cells are first grown inside the droplets, then IPTG can be injected to induce protein expression. Lysing agents and plastic nanoparticles can then be injected.

[0252] Preparation of PET film

[0253] PET films for enzymatic degradation were prepared by dissolving 200 mg of PET particles in 10 mL of dichloromethane or a 4:1 mixture of chloroform and trifluoroacetic acid, respectively. 500 μL or 1 mL of the dissolved solution was evaporated in a 1.5 mL open tube at 96° C. The crystallinity of the plastic films was determined using differential scanning calorimetry (DSC) (1.5.).

[0254] Characterization of plastic substrates by differential scanning calorimetry (DSC)

[0255] PET samples (particles, films and nanoparticles) were analyzed by a DSCQ2000 instrument (TA Instruments, Newcastle, USA) equipped with an autosampler and an intercooler system. Approximately 1 mg of dried sample was subjected to a temperature program consisting of a first heating, cooling and second heating cycle under a nitrogen atmosphere. The first heating cycle was run at a rate of 5 K / min between -20 ° C and +300 ° C. Subsequently, the second heating cycle was performed to 300 ° C at a constant rate of -10 K / min and a constant rate of 10 K / min, respectively. The resulting thermal analysis diagram was analyzed using TA Universal Analysis 2000 software. Starting from the first heating cycle, the glass transition temperature (T g ), melting temperature (T m ) and melting heat ΔH m and cold crystallization heat ΔH c The percentage of crystallinity K was calculated by the following equation:

[0256]

[0257] ΔH m is the melting enthalpy, ΔH, which can be determined by integrating the endothermic melting peak. c is the cold crystallization enthalpy and can be determined by integrating the exothermic cold crystallization peak. The experimental heat of fusion of the polymer divided by the reported literature value for the enthalpy to melt a 100% crystalline polymer (140 J / g for PET).

[0258] DNA sequencing, primer walking and ORF analysis

[0259] All colonies showing transparent halos during the secondary screening were selected for Sanger DNA sequencing using M13-forward primer (5'-TGT AAAACG ACG GCC AGT-3') and M13-reverse primer (5'-CAG GAA ACAGCT ATG AC-3'). Sequencher 5.4.5 version (Genes Codes Corporation) was used to generate overlapping groups. If necessary, primer walking sequencing method was performed. All overlapping groups obtained were compared with sequences deposited in the National Center for Biotechnology Information (NCBI) by local alignment BLAST tools for non-redundant proteins (nr) and metagenomics (env_nr) and Pfam databases. ORF prediction was performed using ORFfinder (https: / / www.ncbi.nlm.nih.gov / orffinder / ) by using any alternative start codons, and ORFs predicted for esterase / lipase activity were compared with Pfam, ESTHER and UniProtKB databases.

[0260] Phylogenetic analysis

[0261] Amino acid sequences representing 48 members of 19 families described in the literature were retrieved from public databases. These sequences, together with 13 sequences of metagenomic-derived hits identified in this work, were used as input files for sequence alignment using ClustalW, and the resulting output files were submitted to MEGA 7 to build a suitable evolutionary model. The phylogenetic tree was built by using the maximum likelihood method according to a model based on the JTT matrix, with a bootstrap of 1,000 replicates.

[0262] Cloning of selected

[0263] All potential ORFs for esterase activity were selected for cloning for further biochemical characterization. The selected genes were amplified by PCR using designed primers with restriction endonuclease sites using Phusion high-fidelity DNA polymerase (Cat. No. F530L, ThermoFisher Scientific). The amplified fragments were cloned into pHAT or pHAT3 vectors for protein expression, and recombinant plasmids were used to transform E. coli DH5ɑ cells, E. coli BL21 cells (DE3) (Cat. No. C2527H, New England BioLabs) or SHuffle T7 expression cells (Cat. No. C3029H, New England BioLabs).

[0264] Protein overexpression and purification

[0265] The transformed cells were grown in 5 mL LB medium containing 100 μg mL-1 ampicillin at 37°C for 16 hours, and the obtained culture was used to inoculate 500 mL LB (100 μg mL-1 ampicillin). The cells were grown at 37°C until OD 600nmThe pH value of the protein was 0.5 to 0.6, and protein expression was induced by adding 400 μM IPTG at 20°C for 20 hours. After expression, cells were harvested by centrifugation at 4000 g for 20 minutes at 4°C and resuspended in 35 mL of 50 mM Tris-HCl pH 8.0 for cell lysis via Emulsiflex (Avestin). The extract was brought to 50 mM Tris-HCl pH 8.0, 250 mM NaCl, 10 mM imidazole, 10 mM β-mercaptoethanol and 5% (v / v) glycerol and centrifuged at 8,000 g for 45 minutes at 4°C to remove cell debris. The supernatant is loaded onto a Super Nickel NTA affinity resin (Catalog No. Super-NiNTA25, Protein Ark) pre-equilibrated with purification buffer [50mMTris-HCl pH8.0, 250mM NaCl, 10mM imidazole and 5% (v / v) glycerol], and the recombinant protein is eluted using a stepwise imidazole gradient (10, 50, 100, 200, 500mM imidazole). The soluble expression of the recombinant protein is confirmed by SDS-PAGE gel, and the selected fraction is concentrated by centrifugation using an appropriate cutoff value based on its molecular weight with an Amicon Ultra-15 filter (Merck-Millipore). In order to eliminate contaminants, additional protein purification steps are performed at 4°C by size exclusion chromatography using a column HiLoad 16 / 60 Superdex 75 or 200 (GE Healthcare). For samples free of contaminants, buffer exchange was performed through a Sephadex G-25PD10 column (Cat. No. 17085101, GE Healthcare) according to the manufacturer's protocol. All recombinant proteins were stored in 50 mM Tris-HCl pH 8.0, 100 mM NaCl, and 2.5% (v / v) glycerol, and protein concentration was determined by measuring absorbance at 280 nm using a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies).

[0266] Substrates used in this work include:

[0267] (1) fluorescein dihexanoate, (2) tributyrin, (3c) pNP-hexanoate; (3e) pNP-decanoate; (3f) pNP-dodecanoate.

[0268] Biochemical characterization

[0269] The activity of all esterase hits was determined by monitoring the release of p-nitrophenol via hydrolysis of p-nitrophenol (p-NP) carboxylesterase. The amount of p-nitrophenol released was quantified by absorbance at 405nm (εpNP=17000M-1.cm-1) using a Spectramax 190 microplate reader (Molecular Devices). Unless otherwise indicated, measurements were performed in triplicate using a 96-well plate at 22°C in 50mM Tris-HCl pH 8.0 and 0.3% (v / v) Triton X-100, with a final assay volume of 100 μL. Substrate specificity was studied by measuring the hydrolysis of the following p-NP-fatty acyl esters: butyrate (C4), hexanoate (C6, from TCI Chemicals, H0484), octanoate (C8), decanoate (C10), dodecanoate (C12), myristate (C14) and palmitate (C16). Kinetic parameters for each substrate were obtained by nonlinear regression of the data using the Michaelis-Menten equation: V = Vmax*[S] / (Km+[S]), where V is the rate, Vmax is the maximum rate achieved by the reaction, S is the substrate concentration, and Km is the Michaelis-Menten constant.

[0270] The effect of pH was evaluated by measuring enzyme activity in 50 mM buffers containing 0.3% (v / v) Triton X-100 at pH 4.0 to 11.0: sodium citrate at pH 4.0, pH 5.0, and 6.0; phosphate at pH 6.0, 7.0, 8.0; Tris-HCl at pH 7.0, 8.0, and 9.0; N-cyclohexyl-3-aminopropanesulfonic acid (CAPS) at pH 9.5, 10.0, 11.0.

[0271] Determination of thermal stability

[0272] Melting temperature curves were recorded on a Rotor-Gene 6000 real-time PCR instrument (Corbett), with fluorescence excited at 470nm, and measured at 610nm with a step length of 0.5°C between 25°C and 95°C. Samples were prepared in triplicate, and contained 8 μM enzymes in 50mM Tris-HCl pH 8.0, 100mM NaCl, 2.5% glycerol, and 5x Sypro orange protein gel stain (Thermo Fisher). Samples were prepared to obtain a final assay volume of 20 μL, which was adjusted with a buffer containing 100mM Tris-HCl pH 8.0 and 100mM NaCl. Melting curves were analyzed on KaleidaGraph (Synergy Software Company), and fitted by using equation m1+((m1-m2) / (1+exp((m3-M0) / m4))).

[0273] Circular Dichroism (CD)

[0274] CD measurements were performed using a JASCO J-810 spectrophotometer equipped with a Peltier-type temperature controller and a thermostatic cell holder coupled to a thermostatic bath. In order to verify the effect of pH in the folding of RR11O2 and RR11O2 M1_L9del, the enzyme was diluted in the following buffer: 100 mM sodium phosphate at pH 6.0, 7.0, and 8.0, and 50 mM borate at pH 8.8. Three consecutive scans from 190 to 250 nm were compiled for each experiment, and the contribution of the corresponding buffer baseline was subtracted from the average spectrum. The measurements were performed at a concentration of 5.2 μmol of RR11O2 and a concentration of 5.39 μmol of RR11O2 M1_L9del, respectively.

[0275] Cloning, expression and purification of IsPET enzyme

[0276] The IsPETase gene (GenBank accession number GAP38373.1) was inserted into the pCri18-a (Addgene, #61326) plasmid by Gibson-Assembly-PCR6 to generate the plasmid pCri18-a-IsPETase. The plasmid was used to transform Bacillus subtilis 168. The recombinant protein contains a C-terminal 6×His tag for purification. The recombinant Bacillus subtilis strain was grown at 37°C in 2YT medium supplemented with 5μg / mL chloramphenicol. After induction by adding 0.5mM IPTG, the culture was further incubated at 20°C for 18 hours. The culture was centrifuged (13,000xg, 10min, 4°C), and the supernatant was applied to a Ni-NTA column equilibrated with buffer A containing 50mM Tris-HCl, 150mM NaCl and 50% glycerol (pH 8). After washing with 20 column volumes of buffer A containing 20 mM imidazole, the bound protein was eluted with 500 mM imidazole in buffer A. The enzyme in the elution buffer was further exchanged to buffer A by an Amicon ultra-4 centrifugal filter device (Millipore, USA), and then stored at 4° C. The degree of protein purity was confirmed by sodium dodecyl sulfate polyacrylamide gel electrophoresis, and the concentration was determined by Nanodrop 2000 (Thermo Fisher Scientific, USA) using Mw 30.2 kDa and extinction coefficient ε = 39,400 M-1 cm-1.

[0277] Example 1: Initial Pre-Screening Method

[0278] To screen esterase activity with high sensitivity and high throughput, we developed a screening platform using microfluidics. To explore the diversity provided by metagenomics, a previously generated DNA metagenomic library derived from eight different sources (marine sludge, goose pond, sandy soil, vanilla pod, medium compost, thermophilic mature compost, and bovine rumen) and consisting of 1,250,000 members was encapsulated in water-in-oil droplets, which took into account the insights gained from substrate and buffer screening and the enrichment achieved for the active esterase Est30.

[0279] like Figure 1As shown, pooled metagenomic DNA was transformed into E. coli, and the cells were encapsulated into approximately 2 pL droplets along with lysis buffer and (1) fluorescein dihexanoate substrate under a Poisson distribution of λ = 0.35 (approximately 70.4% of the droplets were empty, approximately 24.6% of the droplets contained 1 cell, and approximately 4.3% of the droplets contained 2 cells). The resulting droplets were incubated off-chip at room temperature, and after incubation, the emulsion was reinjected into the sorting chip and sorted using fluorescence-activated droplet sorting for up to three days ( Figure 2B ). Plasmids were recovered from the sorting droplets, transformed into E. coli BL21, and cells were plated on LB agar plates containing tributyrin for secondary screening. Colonies displaying clear halos were selected for plasmid isolation and DNA sequencing, followed by gene annotation and biochemical characterization in other cases to identify candidates displaying unique features.

[0280] Additional experimental details are as follows:

[0281] Metagenomic library preparation for droplet encapsulation. 20 ng of DNA from a metagenomic library called "SCV" was transformed into E. coli 10G Elite (Cat. No. 60051-2, Luria) on Luria Bertani (LB) agar plates containing 50 μg / mL kanamycin (50-fold library size) to generate approximately 5 x 10 7 Variants. The plates were incubated overnight at 37°C and then moved to room temperature (about 22°C) for 48 hours. The colonies were scraped off the plates using 3×3mL liquid LB containing 50μg / mL kanamycin, cooled on ice, and washed three times by centrifugation at 5,000g for 5 minutes, and resuspended in buffer (50mM TrisHCl pH8.0, 100mM NaCl, 50μg / mL kanamycin and a tablet of EDTA-free protease inhibitor (Roche), final volume 50mL). The washed cell suspension was diluted to OD in a buffer with 25% v / v Percoll (Sigma Aldrich). 600nm 0.8.

[0282] Droplet generation and incubation. Droplets were generated in a dual flow focusing junction ( Figure 1 ). The first water flow is at OD 600nmThe first aqueous stream contained a cell suspension at 0.8; the second aqueous stream consisted of 20 μM fluorescein dihexanoate, 0.4x BugBuster (BugBuster 10X Protein Extraction Reagent, Catalog No. 70921-4, Merck Millipore), and 27 to 33 U / μL rLysozyme (Catalog No. 71110, Merck Millipore) in a buffer containing 100 mM NaCl and 100 mM Tris-HCl pH 8.0. For the oil phase, HFE-7500 (3M) containing 1% w / w fluorosurfactant-008 (RAN Biotech) was used. The flow rate of each aqueous stream was 50 μL / h, and the flow rate of the oil phase was 500 μL / h, resulting in a droplet volume of approximately 2 pL and an expected droplet occupancy of λ=0.35. The droplets were collected into an inverted 500 μL microcentrifuge tube (modified by access holes for inserting the tube at the top and bottom) and then sealed with adhesive glue (Scotch-Weld PR1500, 3M). The droplets were incubated at room temperature (about 22° C.) and in the dark under static conditions for up to 72 hours.

[0283] Fluorescence activated droplet sorting (FADS). Droplets are injected into the sorting chip at 5 μL / h from a modified microcentrifuge tube ( Figure 1) and spaced with 100 μL / h of fluorinated oil HFE7500, resulting in a sorting frequency of about 300 Hz. The droplet injection rate was increased to 15 μL / h (to a rate of 2,000 Hz), and the oil flow was adjusted to produce sufficient separation to sort individual droplets. The chip was monitored using a microscope (IX73, Olympus) light source with a long pass filter (593 nm, BrightLine Semrock) and a high-speed camera (Miro eX4, Phantom Research). To measure droplet fluorescence, a laser beam (488 nm, 30 mW, 85BCD30 Melles-Griot, attenuated with ND 1.0) was enlarged 10 times and focused by a dichroic mirror (495 nm, Olympus) onto the microfluidic channel upstream of the sorting junction. The induced fluorescence was collected through an air objective (LUCPlanFLN 40x / 0.6, Olympus), passed through a long pass filter (488 nm, RazorEdge Semrock), a dichroic mirror (555 nm, Toll Labs) and a final band pass filter (525 / 28 nm, BrightLine Semrock) before reaching the detector of a photomultiplier tube (PM002, Toll Labs). The signal was fed to the analog input pin of a Virtex-5 LX30 FPGA (PCIe-7841R, NI). The FPGA quantified the width at the signal threshold, the width at half maximum, the area and the amplitude of each droplet signal. The droplet data was streamed to a custom LabView program for visualization and setting the sorting threshold. If the droplet met the sorting criteria, a trigger was sent to a pulse generator to generate a 5 V pulse with a width of 500 μs (TGP110, Thurlby Thandar Instruments). This pulse controls a function generator (20MHz DDS function generator TG 2000, TTi) operating in external gate mode to generate a 10kHz square wave signal at an adjustable amplitude (7 to 9V), which is then amplified 100 times with a voltage amplifier (TREK 601c) to start the sorter. The electrodes are prepared by filling the channels with saline solution (5M NaCl) and connected to the amplifier via a syringe (19).

[0284] Plasmid recovery and efficient transformation. 100 μL of 2ng / μL salmon sperm DNA (Catalog No. 15632-011, Invitrogen) and 100 μL of 1H, 1H, 2H, 2H-perfluorooctanol (97%, Catalog No. B20156.30, Alfa Aesar) were added to the sorting droplets collected in low binding DNA tubes (Catalog No. 183225J, Eppendorf). The tube was vortexed for 30 seconds and centrifuged at 1,000g for 1min. The hydrolase was transferred to a new low binding DNA tube using a low retention pipette tip (maxymumrecovery, Axygen), and the same procedure was repeated twice more with 100 μL of salmon sperm solution and 100 μL of 1H, 1H, 2H, 2H-perfluorooctanol. The resulting 300 μL recovered DNA solution was purified using the Zymo Clean and Concentrate-5 kit (Cat. No. D4004, Zymo Research) according to the manufacturer's protocol. After a 5-minute incubation time, the DNA was eluted with 12 μL ultrapure distilled water (Cat. No. 10977-035, Invitrogen).

[0285] Secondary screening is carried out with tributyrin. In the solution recovered, the plasmid recovered by 2 μ L is electrotransformed into Escherichia coli 10G Elite (Cat. No. 60051-2, Luxigen), and the cells are recovered at 37 ℃ and 450rpm for 1 hour with 1 mL of recovery culture medium (Cat. No. 80026-1, Luxigen). The transformed cells are plated on LB agar plates containing 50 μ g / mL kanamycin and 1% tributyrin (97%, Catalog No. W222305, Sigma-Aldrich), and these plates are incubated at 37 ℃ for one day, then incubated at room temperature. The presence of transparent halo around the colony is checked in the plate every day, and positive colonies are selected to be prepared in small amounts for DNA sequencing with Genejet plasmid miniprep kit (Cat. No. K0503, Thermo Fisher Scientific).

[0286] Results: New esterases have been discovered from different regions of sequence space

[0287] In total, two screening campaigns were performed and approximately 30.6 million droplets were screened, 15.7 million droplets were screened over two days in campaign I and 14.9 million droplets were screened over three days in campaign II, respectively. Considering the applied Poisson distribution of λ=0.35, 28.9% of the droplets contained 1 or 2 cells, so approximately 8.8 million droplets would contain metagenomic plasmids. In both screening campaigns, the metagenomic libraries were covered sevenfold, allowing the identification of 34 colonies that exhibited clearing halos in campaign I. Campaign I is shown in Figure 3 middle.

[0288] DNA sequencing analysis of candidates from activity I showed that 27 candidates were identified as potential positive hits, owing to low-quality readings, 4 candidates could not be sequenced, 2 candidates were vectors without inserts, and 1 candidate was shown as a false positive. Regarding activity II, although 18 candidates were identified as potential positive hits, only one was confirmed as a new hit (RR11) because other candidates were previously identified in activity I. Potential positive candidates were tested for activity against fluorescein dihexanoate, and the reaction was monitored over time with a microplate reader. As shown, compared with the negative control P35, the candidate exhibited higher activity, the activity of P35 being shown as a gray bar, and the gray dotted line represents the comparison of this negative control with the identified metagenomic hit.

[0289] To obtain full-length contigs of the eDNA insert from each metagenomic hit, a primer walking strategy was applied and primers were designed in such a way that after up to four rounds of DNA sequencing, full-length sequences of each metagenomic insert were obtained. Analysis of full-length contigs showed that out of 28 potential hits (27 candidates from campaign I and 1 candidate from campaign II), 10 hits were unique in campaign I and 1 was unique in campaign II, giving a total of 11 unique metagenomic-derived hits.

[0290] Contig analysis of candidate N20 allowed the identification of ORF n20o1, which addresses the family DUF3089 (Pfam code PF11288) of proteins of unknown function, a small family with 630 members on the Pfam database.

[0291] Thirteen ORFs from the 11 unique metagenomic hits identified were assigned to esterase / lipase functions. Sequence comparison of these 13 ORFs against the NCBI (metagenomic proteins, env_nr) and UniprotKB databases showed that 69% and 30.7% of the ORFs shared less than or more than 50% sequence similarity with them, respectively. The ORF with the lowest sequence identity was rr11o2, which showed 38% sequence similarity with a hypothetical protein from the hydrocarbon metagenome (NCBI accession code KUG22667.1) and 64% sequence similarity with an uncharacterized protein from Oribacterium sp. (UniprotKB accession number A0A1H3Y0C3).

[0292] The comparison of 13 ORFs with Pfam and ESTHER databases shows that 8 families can be distributed according to Pfam respectively and 9 families can be distributed according to ESTHER. This shows that different families can be explored in the screening process. In addition, according to the lipolytic enzyme classification proposed at present, this screening platform allows access to 6 different families (II, III, V, VII, X, XIX). 4 candidate substances can not be accurately addressed to any family.

[0293] To address the activity of the metagenomic hits, each ORF was cloned individually into an expression vector and the corresponding recombinant proteins were tested for p-NP acyl esters with different chain lengths. As expected, the highest catalytic efficiency was observed for esters with medium chain lengths (e.g., butyrate, hexanoate, and octanoate), which is consistent with the chain lengths applied during droplet screening with (1). Similar observations were made for pH, with pH 8.0 being the optimal pH observed for all candidates. In addition, the melting temperature was also investigated, showing a mesophilic curve for all tested metagenomic hits. The results are shown in Figure 4.

[0294] The catalytic promiscuity of metagenomic hits was also investigated using a series of substrates with p-nitrophenol as the leaving group, as follows:

[0295]

[0296]

[0297] Table 4.

[0298] As expected, all candidates showed activity towards p-NP esters with short chain lengths and also showed activity towards p-NP esters with long chain lengths. In addition, almost all candidates showed thioesterase activity.

[0299] The activity towards the compounds in Table 4 is described for selected enzymes:

[0300] Table 5a

[0301]

[0302] Table 5b

[0303]

[0304] Example 2: Exploring the sequence space around a new enzyme cluster containing RR1102 and N2001 reveals additional enzyme clusters

[0305] For the largest family of each clan, full-length fasta sequences were downloaded from Pfam (Pfam 32.0, https: / / pfam.xfam.org / , April 2019). In order to reduce the number of sequences (nodes) in the network, each family was clustered stepwise to 90%, 60%, and 30% sequence identity using cd-hits and psi-cd-hits. The representative sequences of each cluster were combined with the esterase hit sequences into a single database, which was used for all-versus-all alignments (protein-protein BLAST2.6.0+). Each line in the output file defines an edge (alignment) connecting two nodes (representative sequences) of the network. Duplicate edges, self-loops, and edges above a certain e-value were removed using a custom python script. The simplified network was then imported into CytoScape 3.7.1 for visualization.

[0306] join Figure 5 The enzyme CI5En2 was identified as part of a cluster between known PETases and the newly identified RR1102.

[0307] The cl5en2 gene was amplified by PCR using Phusion high-fidelity DNA polymerase (Thermo Fisher Scientific, F530L) using forward 5'-GAAAACCTGTACTTCCAGGGTATGGCGGATTATGCGAAAG-3' and reverse 5'-TGACACTATAGAATACTCAAGCTTACACCACAAAACGGCTAAATTC-3' primers. The amplified fragment was cloned into the pExp vector series previously digested with BsaI and HindIII via slic cloning. The clone was confirmed by DNA sequencing, and the corresponding plasmid was used to transform Escherichia coli BL21 (DE3). The transformed cells were grown at 37°C for 16 hours in 5mL LB medium containing 100μg mL-1 ampicillin, and the culture obtained was used to inoculate 250 or 500mL LB (100μg mL-1 ampicillin). Cells were grown at 37°C until OD600 nm reached 0.5-0.6, and protein expression was induced by adding 400 μM IPTG at 20°C for 20 hours. After expression, cells were harvested by centrifugation (4000xg for 20 minutes at 10°C) and resuspended in Tris-HCl (35mL, 50mM, pH 8.0). Cell lysis was performed in Emulsiflex (Owestin). The extract was taken to 50mM Tris-HCl pH 8.0, 250mM NaCl, 10mM imidazole, 10mM β-mercaptoethanol and 5% (v / v) glycerol, and centrifuged at 4°C for 45 minutes at 8,000xg to remove cell debris. The supernatant was loaded onto 3 mL of Ni-NTA resin (Qiagen) pre-equilibrated with purification buffer [50 mM Tris-HCl pH 8.0, 250 mM NaCl, 10 mM imidazole and 5% (v / v) glycerol], and the recombinant protein was eluted using a stepwise imidazole gradient. The soluble expression of the recombinant protein was analyzed by SDS-PAGE gel, and the selected elution fractions from the column purification were combined and concentrated by centrifugation with an Amicon Ultra-15 filter (Merck Millipore) using an appropriate cutoff value based on its molecular weight. In order to eliminate possible contaminants, additional protein purification steps were performed by size exclusion chromatography at 4 ° C using a column HiLoad 16 / 60 Superdex 75 or 200 (GE Healthcare). For samples without obvious contaminants, buffer exchange was performed using a Sephadex G-25PD10 column (Amersham Biosciences) following the manufacturer's protocol.All recombinant proteins were stored in 50 mM Tris-HCl pH 8.0, 100 mM NaCl, and 2.5% (v / v) glycerol, and the concentration of purified proteins was determined by measuring the absorbance at 280 nm using a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Inc.).

[0308] result:

[0309] CL5En2 exhibited an activity comparable to IsPETase and higher than that of LCC at 30° C. Cl5En2 also showed activity against PET nanoparticles with different crystallinity.

[0310] Example 3: Production of plastic nanoparticles

[0311] False positives were identified using the screening method of Example 1 above because some of the identified esterases did not have high activity on plastics despite having esterase activity. Therefore, the inventors developed a high-throughput method that can more selectively select esterases with plastic degradation activity and can also be used to select optimized mutant enzymes via directed evolution.

[0312] The method uses plastic nanoparticles prepared as follows:

[0313] 50 mg of freeze-ground crystalline PET particles or amorphous PET film (product code ES303015, Goodfellow GmbH, London, UK) were dissolved in 1,1,3,3,3,-hexafluoro-2-propanol (5 mL) for at least one hour. This solution was added dropwise (1 mL / min) to deionized H2O (50 mL, cooled in an ice bath) until accumulation of aggregated particles on the water surface was observed. At the same time, the water was stirred using an Ultra The suspension was stirred vigorously at 8000 rpm using a stirrer (IKA, Germany). The suspension was then filtered using Whatman filter paper (8 μm diameter). Afterwards, the remaining solvent was evaporated.

[0314] Use the following analytical methods to characterize the synthesized nanoparticles:

[0315] (i) Particle size distribution was assessed by measuring hydrodynamic diameter by dynamic light scattering on a Zetasizer NanoZS (Malvern, UK).

[0316] (ii) To directly measure nanoparticle size, particle size, size distribution and morphology transmission electron microscopy (TEM) was used.

[0317] (ii) Determine the degree of crystallinity by differential scanning calorimetry (DSC) (1.5.).

[0318] (iii) The particle concentration of the final suspension was determined by weighing the precipitate obtained from a 4 mL aliquot of the plastic nanoparticle suspension, which was generated by centrifugation and drying at 95°C for at least 1 hour.

[0319] To generate more concentrated nanoparticle solutions, the suspension was incubated at 37 °C in an open tube until the desired density was reached.

[0320] To stabilize the PET in the droplets, Tween-80 was used at a concentration of 0.1%-0.5%, providing stable particles even in the presence of buffers and enzymes or cell lysates.

[0321] Additional plastic nanoparticles have been formed from nylon. These were prepared as follows: 50 mg of nylon 6 or nylon 66 was dissolved in 1,1,3,3,3,-hexafluoro-2-propanol (5 mL) for at least one hour. This solution was added dropwise (1 mL / min) to double distilled H2O (50 mL, cooled in an ice bath) supplemented with 0.05% or 0.1% SDS until aggregated particles were observed to accumulate on the surface of the water. At the same time, the water was heated using an Ultra The suspension was stirred vigorously at 8000 rpm using a stirrer (IKA, Germany). The suspension was then filtered using Whatman filter paper (8 μm diameter). Afterwards, the remaining solvent was evaporated.

[0322] result:

[0323] The results are shown in Figure 15. When nanoparticles were used, no sedimentation was observed in the microfluidic droplets, even in droplet measurements taken weeks later. Tween-80 was found to be a useful stabilizer (preventing aggregation between nanoparticles and biomolecules in the droplets).

[0324] Nylon nanoparticles are shown in Fig.18 middle.

[0325] Example 4: Method for selecting and / or optimizing PETase activity using detection of light scattering from plastic nanoparticles

[0326] Generation of error-prone PCR libraries

[0327] Two ep-PCR libraries of Cl5En2, named library 1 and library 2, were generated using the GeneMorph II random mutagenesis kit (Agilent, catalog N 200550) for the first round of directed evolution. The cl5en2 gene was amplified and randomly mutated by error-prone PCR following the manufacturer's instructions. The ePCR reaction mixture consisted of the following: forward 5'GGTACCGAAAACCTGTACTTCCAG 3' primer and reverse 5'CTGGGATTTAGGTGACACTATAGAATACTC 3' primer (0.5 μM each), dNTPs (0.2 mM each), mutzyme II DNA polymerase (1 μL, 2.5 U / μl), 5 μL 10× Mutazyme II reaction buffer, and 3.5 μg and 699 ng of DNA template (for the first and second libraries, respectively). Amplification was performed using a PCR program [60s95°C, 25x(30s95°C, 30s59°C, 60s72°C), 600s72°C, and finally maintained at 4°C]. The resulting PCR product was purified using the Clean&Concentrator Kit-5 (Zymogen, catalog number D4003), quantified via Nanodrop, and then ligated into the pExp-bla vector at the BamHI and HindIII sites via slic cloning as described above. The ligation product was purified again using the Clean&Concentrator Kit-5, and the purified product obtained was transformed into electrocompetent Escherichia coli 10G Elite cells (Lucigen). Cloning was confirmed via DNA sequencing and mutation frequencies were calculated. 50ng from each ep-PCR library was transformed into Escherichia coli to produce 187 and 119 variants, which were used for 10 clones of library 1 and library 2 on LB agar plates (containing 100mg / mL ampicillin), respectively. -3 The serial dilutions covered 89 and 93.25 times the library size of library 1 and library 2, respectively.

[0328] Preparation of bacterial suspension for droplet encapsulation

[0329] The transformed bacteria were grown overnight at 37°C and then incubated at room temperature for 1 day. Subsequently, the colonies were scraped off from the agar plates and the manufacturer's instructions were followed to isolate the plasmid using a DNA extraction kit (GeneJet plasmid mini kit). 30 ng of the extracted plasmid DNA was transformed into E. coli BL21 (DE3) cells and plated on LB agar (containing 100 mg / mL ampicillin), then incubated overnight at 37°C and incubated at room temperature for 1 day. The colonies were gently scraped off from the plates using LB culture medium containing 100 mg / mL ampicillin, and the obtained cultures were incubated for three hours at 37°C, induced with IPTG to obtain a final concentration of 0.4 μM and incubated overnight at 20°C. The cultures were centrifuged at 4000 x g for 6 minutes and washed 3 times with buffer (100 mM Tris-HCl, 100 mM NaCl buffer, pH 8). The cell density was adjusted by dilution to obtain the required cell / droplet ratio after compartmentalization. Assuming a Poisson distribution for bacterial encapsulation (Huebner Chem Commun 2007), for 150 pL droplets, a cell density OD600nm 0.01 should result in 20% of the droplets having a single cell.

[0330] Formation of water-in-oil picoliter droplets

[0331] Water-in-oil droplets (volume 150 pL) were generated using an 80 μm deep and 50 μm wide flow focusing device with a 25 μm nozzle with three inlets. Two inlets delivered aqueous solutions prepared in GF buffer (50 mM Tris-HCl, 100 mM NaCl, 2.5% glycerol, pH 8.0). The flow from these inlets supplied (i) the cell suspension (OD 600nm The cells were then lysed (i) in 4% 4% dl (v / v, 1% dl) and (ii) a mixture of the cell lysis reagents BugBuster (0.2% v / v, Novagen), Tween-80 (0.2% v / v, Merck), rlysozyme (96 U / mL; Merck) and plastic nanoparticles (approximately 1 mg / mL). Fluorinated oil HFE-7500 (3 M) containing 008-fluorosurfactant (2%, w / w, RAN Biotech, USA) was injected through the third inlet. The aqueous and oil phases were injected using a gas-tight syringe (Hamilton; 0.5, 1 or 2.5 ml) at a rate of 4, 4 and 32 μl min-1, respectively, using a neMesys syringe pump (Cetoni, Germany). The droplets were collected in a storage chamber made of an inverted 0.5 mL Eppendorf tube.

[0332] Droplet sorting and electronics

[0333] A custom-made scattering-activated droplet sorter (SADS), based on the system of a previously used fluorescence-activated droplet sorter, was used to sort droplets based on the intensity of the scattered light. Droplets were injected into the sorting chip at 1-4 μL min-1, depending on the quality of the emulsion after long-term incubation, and spaced apart with 20-50 μL min-1 of oil (2% w / w 008-fluorosurfactant in HFE7500). As a result, droplets were sorted at a frequency of 100-350 Hz. It is important to note that the chemical composition of the spacing oil and the oil in the emulsion should be the same, otherwise the level of signal may fluctuate with various fillings of the emulsion. We assume that the surfactant micelles present in the oil contribute to the level of scattered light, so it is useful to keep the surfactant concentration stable during the sorting process. The intensity of the scattered light is measured by providing an incident light of λ=488nm (Fault Tolerance Laser, 488nm, 25mW, Vortran, USA) and using a photomultiplier tube (PMT, PM002, Thor Labs) to detect the scattered light of the same wavelength (nm). Field programmable gate array (FPGA, PCIe-7841R, National Instruments) is used for sorting, wherein custom LabVIEW software is used to monitor and record signals. The whole process is monitored on an inverted microscope (IX73, Olympus Corporation).

[0334] DNA recovery

[0335] The sorting droplets were collected into a 1.5 mL low DNA retention reaction tube (DNA LoBind, Eppendorf) and de-emulsified by adding 100 μL 1H,1H,2H,2H-perfluorooctanol (97%, Alfa Aesar). 100 μL of 2 ng / μL salmon sperm DNA solution (Catalog No. 15632-011, Invitrogen) was added to the collected droplets. The tube was vortexed briefly and centrifuged at 1,000 x g for 1 min. The aqueous layer was transferred to a new reaction tube and the extraction was repeated twice. The aqueous phase was concentrated using Clean&Concentrator Kit-5 (Zymogen) following the manufacturer's instructions. Elution was performed with 12 μL deionized water. Using the pExp-F / R (for:) primer pair, PCR amplification was performed using 5 μL of aqueous phase [30s 98°C, 25x (10s 98°C, 30s 55°C, 30s 72°C), 300s 72°C, and finally kept at 4°C]. The PCR product was purified by agarose gel electrophoresis and recovered by using the Clean&Concentrator Kit-5. The isolated DNA was subcloned into the pExp-bla plasmid by SLIC technology, and the ligation product was purified again by the Clean&Concentrator Kit-5. The purified product was transformed into electrocompetent E. coli 10G cells.

[0336] Secondary screening

[0337] Cell lysis

[0338] Each bacterium colony of the Cl5En2 variant transformed into Escherichia coli strain BL21 (DE3) was picked and inoculated in a 96-deep-well plate containing 1 mL of LB medium with 100 μg mL-1 ampicillin. The cells were grown for 3 hours at 37°C, 200 rpm, and then 400 μM of IPTG was added to provide protein expression, which was carried out at 20°C, 200 rpm for 20 hours. After expression, cells were harvested by centrifugation at 4000 x g for 45 minutes at 10°C, and the supernatant was discarded. 100 μL of lysis buffer [(100 mM Tris-HCl pH 8.0, 100 mM NaCl, 1x BugBuster and lysing enzyme (Merck Millipore, catalog number 71230-4)] was added to the cells, and the plate was vortexed until the cells were completely resuspended, and then incubated at 37°C for 30 minutes to better provide cell lysis.

[0339] Validation by hydrolysis of p-NP acyl esters

[0340] We also verified the kinetic parameters of the Cl5En2 variants by measuring the formation of p-nitrophenol after hydrolysis of the p-NP acyl ester. The reaction after the enzyme-free blank was measured to subtract the autohydrolysis, and the The released p-nitrophenol was monitored at 405 nm (εpNP=18.300M-1.cm-1) by spectrophotometric quantification in an M3 microplate reader (Molecular Devices). We used p-NP acyl dodecanoate (C12) and p-NP acyl dodecanoate (C16) as substrates and reacted by using 10 μL of cell lysate and 90 μL of p-NP acyl ester (1.11 mM). All assays were performed in 96-well microplates (Thermo Fisher Scientific, catalog number 260836) in a buffer (final volume of 100 μL) containing 50 mM Tris-HCl pH 8.0 and 0.3% triton X-100 (v / v) at 22°C.

[0341] Validation of hits using PET NPs

[0342] The enzymatic hydrolysis of PETNP using cell lysate was analyzed by monitoring the turbidity change of the suspension at 600nm in the microtiter plate. In each well, 0.29mg / mL PET nanoparticles made from frozen ground powder were incubated with 0.5% Tween-80 and 10 μL of cell lysate prepared as described above. The assay was carried out at room temperature in a buffer (final volume of 100 μL) containing 50mM Tris-HCl, 100mM NaCl and 2.5% glycerol (pH 8.0). The change of turbidity was monitored over a few days of incubation.

[0343] Biochemical characterization

[0344] To calculate the thermal stability of Cl5En2 wild-type, Cl5En2 variants and IsPET enzymes, 2 M of purified enzyme was mixed with Sypro Orange protein gel stain (Invitrogen, catalog number S6650). The assay was performed in 50 mM Tris-HCl pH 8.0, and enzyme denaturation was monitored in a CFX Connect real-time PCR detection system (Bio-Rad) by increasing the temperature from 25°C to 95°C (0.5°C / 30s). The fluorescence of SYPRO Orange (λ 激发 =410nm,λ 发射 =610 nm), and the melting temperature (Tm) was calculated using KaleidaGraph 4.1.3 (Synergy). The melting temperature was defined as the temperature at which half of the enzyme was denatured and was calculated as the first derivative of each temperature-fluorescence curve.

[0345] result:

[0346] The results are shown in FIG9 .

[0347]

[0348]

[0349] Wherein = indicates silent mutation.

[0350]

[0351] Example 5: Enzyme identified from Example 1: RR1102

[0352] The metagenomic hit identified here in this work is RR1102. Although RR1102 was identified as an esterase in functional assays, it has very low sequence conservation with other known esterases. The closest sequence similarity is 38% to a hypothetical protein from the hydrocarbon metagenome (NCBI accession number KUG22667.1).

[0353] Nucleic acid and amino acid sequences of RR11O2. RR11O2 was cloned into pHAT and pHAT3 vectors for expression, and the complete construct of RR11O2 pHAT is represented here. The nucleic acid and amino acid sequences of pHAT are highlighted (first 13 amino acids in grey) as well as the nucleic acid of RR11O2, which was optimized for E. coli based on its codon usage (red). The catalytic triad of RR11O2 (S149, D311, and H308) is also highlighted.

[0354]

[0355] The enzyme activity of purified RR11O2, Bla-Cl5En2 and IsPETase was tested for different p-NP acyl esters [acetate (C2), butyrate (C4), hexanoate (C6), octanoate (C8), decanoate (C10), dodecanoate (C12) and myristate (C14)]. The final enzyme concentration of the enzyme in the reaction depends on the p-NP acyl ester used as substrate. The kinetics were measured at enzyme concentrations between 31.25 μM and 23.2 μM for RR11O2, between 2.5 nM and 50 nM for Bla-Cl5En2 and between 50 nM and 4.8 μM for IsPETase, respectively. The p-NP acyl ester substrate was used in a concentration range between 0 and 4 mM. The kinetic parameters Vmax and K were calculated using a Kaleidagraph by nonlinear least squares fitting of the initial rate to the Michaelis–Menten equation. M According to equation k cat = Vmax / [E], catalytic rate constant k is calculated from the initial steady-state velocitycat (mM-1), and all enzyme assays were performed in a buffer containing 50 mM Tris-HCl pH 8.0 and 0.3% Triton-X 100 (final volume 100 μL) at 22°C. The time points were taken at 20 s intervals. The released p-nitrophenol was monitored spectrophotometrically at 405 nm (εpNP = 18.300 M-1.cm-1) in an M3 microplate reader (Molecular Devices).

[0356] result:

[0357] The results are shown in Figure 8 middle.

[0358] RR1102 also exhibited promiscuous activity against PET.

[0359] Example 7: Enzyme Characterization of Enzymes

[0360] To examine the release of TPA, MHET and BHET in the presence of various enzymes, aliquots were removed from the reaction mixture, turnover was terminated by adding an equal volume of methanol containing 0.5% formic acid, centrifuged (16,100 x g, 15 min) and analyzed by HPLC (1260 Infinity II, Agilent; Nucleodur C18 analytical EC standard column (5 μm, 4 x 125 mm, Macherey-Nagel, Germany). A mixture of buffer A (0.1% formic acid in distilled water) and buffer C (distilled water) and buffer D (acetonitrile) was used as mobile phase at a flow rate of 1 mL / min. Buffer A was maintained at 20% throughout the run. After 5 min, the mobile phase was gradually changed from 72% C and 8% D to 50% C and 30% D until 13 min, then to 30% C and 50% D until 17 min, and then to 10% C and 70% D at 18 min. D. The latter conditions were maintained until 25 minutes and changed back to the starting conditions of 72% C and 8% D until 30 minutes to start another run (see graph below). TPA, MHET and BHET were detected at 250 nm by comparison with authentic samples and quantified by comparison with calibration curves.

[0361] Scanning electron microscopy (SEM) analysis of PET film morphology

[0362] SEM of surface structural changes of treated PET films were observed with a Tescan MIRA3 FEG-SEM (Brno, Czech Republic) using a SE detector. The operating voltage and distance were 5 kV and 6 mm, respectively. After incubation for up to one month with 18 μM enzyme in 100 mM Tris-HCl and 100 mM NaCl buffer (pH 8.0), the PET samples were washed with 1% SDS solution, deionized water, ethanol and air-dried. The PET samples were mounted on aluminum short shafts using carbon tape sputter-coated with 10 nm platinum. Electron micrographs of PET films were recorded by SEM at the desired magnification.

[0363] Weight loss of PCL film and PET film

[0364] PCL film (about 24 mg) and PET film (about 15 mg) were incubated with 1 or 2 μM enzyme in 500 μL 100 mM Tris-HCl, 100 mM NaCl buffer (pH 8.0). Hydrolysis was performed for up to one week at 37 ° C and 300 rpm. A control was also performed by using only buffer solution without enzyme. After treatment, the PCL film was thoroughly washed three times with deionized water and dried until constant weight was obtained. The plastic degradation activity was evaluated by measuring the weight loss of PCL film and PET film, respectively. The weight loss (%) of the plastic film was calculated by the following equation (1):

[0365] Weight loss (%) = 100 × (W (film before degradation) - W (film after degradation)) / W (film before degradation), where W is the weight of the PCL film or PET film.

[0366] Enzyme assays with PET nanoparticles and membranes

[0367] Amorphous or crystalline PET nanoparticles (approximately 0.3 mg of dry powder) or homemade crystalline PET films (approximately 10-20 mg) were incubated with 6 μM purified and TEV-cleaved proteins in Tris-HCl and 100 mM NaCl buffer (pH 8) at 37°C. The reaction was terminated at different time points (t0, t2h and t12h for amorphous particles and t0, t1d and t3d for crystalline particles) by adding an equal volume of methanol containing 0.5% formic acid. The supernatant obtained by centrifugation (16,100×g, 15 min) was analyzed by HPLC.

[0368] Enzymatic hydrolysis of polyester nanoparticles in microplates and microdroplets

[0369] The enzymatic hydrolysis of polyester was analyzed by monitoring the turbidity change of polyester nanoparticle suspension at 600 nm. Enzymatic hydrolysis was performed at room temperature in microtiter plates (Nunc, Thermo Fisher Scientific, USA) with 0.23 mg / mL PCL nanoparticles and 0.29 mg / mL PET nanoparticles prepared from cryo-ground powder in each well. The change in turbidity was monitored over an incubation period of several days.

[0370] We also tested the activity of pure enzymes using microdroplets and scattered light measurements. Samples were prepared by mixing nanoparticles with enzyme solutions before encapsulation. Plastic nanoparticles of the desired density range of 0.5 to 2 mg / mL were stabilized using 0.1%-0.5% (v / v) Tween-80 in a buffer (50 mM Tris-HCl, 100 mM NaCl, 2.5% glycerol, pH 8), after which purified and TEV-cleaved enzymes (500 nM to 2 μM) were added. Afterwards, the solution was divided into two equal volumes, which were injected into the droplet generation chip using two aqueous inlets. The flow rate was the same as that for generating droplets with a single cell.

[0371] result

[0372] The results are shown in Figure 5 C.

[0373] Example 8: Structural characterization of RR1102

[0374] However, the enzyme clearly exhibits esterase activity, so it is important to understand from the crystal structure how the function is conserved without conserving the sequence.

[0375] Initially, truncated constructs of RR1102 were designed to have different lengths and N-terminal flexibility for protein crystallization.

[0376] Data were collected on beamline 103 of the Diamond light source, and structure determination was performed using data from the Diamond automated data processing pipeline with a dashboard. Structure determination and correction were performed using software from the CCP4 package and Phenix. Data collection and correction statistics are shown in Table 6. Coordinates have been deposited in the Protein Data Bank (PDB) with accession number PDB6ZZV.

[0377] Four truncated constructs (M1_L9del, M1_N16del, M1_F27del and M1_Y33del) were designed. B- SDS-PAGE of solubility tests of full-length RR11O2 cloned into pHAT3 and four truncated constructs (M1_L9del, M1_N16del, M1_F27del and M1_Y33del) cloned into pHAT. All constructs were grown at 37°C and induced with 0.4mM IPTG at 20°C or 37°C. Abbreviations refer to M: protein ladder (Thermo Fisher Scientific, catalog number 26619), T0: no induction, TON: after induction overnight, S: soluble fraction, I: insoluble fraction. C - Melting temperature of Δ10D in: 100 mM citrate pH 4.0, 200 mM NaCl and 10% glycerol (-); 100 mM Tris pH 8.0 and 100 mM NaCl (x); and 100 mM hepes pH 7.0 and 100 mM sodium formate (·). D - Crystallization of M1_L9del in JCSG well F2 [0.1 M sodium citrate pH 5.0, 3.2 M (NH4)2SO4] after incubation for 8 and 21 days at 18°C, abbreviations: bright field (BF) and ultraviolet light (UV). The obtained crystals (upper part of D) were submitted to the beamline and further processed at (lower part of D) diffraction pattern.

[0378] Table 6.

[0379]

[0380]

[0381]

[0382] Modeling of the predicted binding mode of substrate to RR1102 was performed using the GOLD software package (CCDC) using the structure deposited in the PDB (PDB code 6ZZV) as the target. The substrate structure was generated using the Grade web server. The target site was defined as the region around Ser149. sphere. Ligand files were generated using grade (Global Phasing). Initial studies of p-NP hexanoate (C6) indicated that in order to have a productive binding mode with the resulting product, the aromatic ring would have to bind in pocket A (productive binding mode = ester binding at Ser149). Therefore, a pharmacophore constraint was introduced to place the aromatic ring of the substrate in pocket A in order to investigate the productive binding mode.

[0383] result

[0384] The structure of RR1102 is shown in Figure 7 , 8 a and 11-14. The atomic coordinates are listed in Fig.16 middle.

[0385] exist The crystal structure of RR11O2 was determined at high resolution using space group P1 21 1 and two molecules in the unit cell. The structure of RR11O2 exhibits an α / β fold with a catalytic triad consisting of S149, D311, and H308 ( Figure 6 B), which is surrounded by the inner cavity, pocket volume = 275.101 volume SA ( Fig.11 ), close to two flexible rings ( Fig.14 ), which seems to correlate with the catalytic efficiency exhibited by RR11O2 towards p-NP esters of different lengths. Surface analysis of RR11O2 revealed a large hollow portion that provided access to the active site for the substrate and a catalytic triad located at the bottom of the hollow portion ( Fig.11 A and 14C).

[0386] To investigate the degree of structural similarity with other α / β hydrolases, a structural alignment was performed using the Dali server. Although RR1102 has very low sequence similarity with other members of the α / β family, it was possible to observe the classical α / β fold in RR1102 as well as other conserved features of α / β hydrolases ( Fig.12 ).

[0387] Although there are significant differences in the outer loops of RR1102, the core of RR1102 and the β-sheet of RR1102 are similar to the β-sheet of proteins displaying the traditional α / β hydrolase fold (PDB code 4VFO). In brief, the β-strands of RR1102 form a smaller β-sheet that aligns with the central β-sheet of the α / β hydrolase fold ( Fig.12 ). As with the α / β hydrolase fold, the central β-sheet of RR11O2 is surrounded by many α-helices, but only 5 of the 9 β-strands and 4 of the 9 α-helices are common to RR11O2 and other hydrolases.

[0388] Due to the conservation of key parts of the core structure, the positioning of residues in the catalytic triad is conserved between RR1102 and the α / β hydrolase fold ( Fig.13 ). The catalytic serine (Ser149) and basic His308 were aligned with the catalytic triad of hydrolases exhibiting an α / β fold identified in the DALI alignment. Indeed, the average RMSD between Ser149 and His308 from RR1102 and the equivalent residues in the top 20 hits from the DALI server is Ser149 of RR1102 is in the conserved motif GXSXG. The third component of the catalytic triad is usually an acid (e.g. Asp183 in PDB code 1UFO). However, comparison of the catalytic triad of RR1102 with the structure from the DALI alignment showed that, despite the presence of a conserved acidic residue (Glu212) in the correct position, this residue is not correctly oriented. It is likely that this residue can be rotated to participate in the catalytic mechanism. However, in order to do this, it must break its interaction with Arg278.

[0389] Identification of the catalytic serine and binding site allows the interesting selectivity profile of RR1102 for hydrolysis of esters to be rationalized. The binding pocket consists of 2 different pockets (A and B) on either side of the catalytic triad. First, there is a covered hydrophobic pocket (pocket A), terminated by the conserved hydrophobic clamp W108. In the structure presented here, pocket A is occupied by 1 glycerol molecule. This indicates that this site is likely to bind small molecules. The second pocket (pocket B) is a deep but open pocket. This is terminated by a flexible loop. The mouth of pocket A can be considered too narrow to allow small molecules to enter. However, an examination of the normalized B factor from the structure (PDB code 6ZZV) indicates that the loop covering pocket A is extremely flexible. Therefore, there may be a large amount of air delivery, which will allow pocket A to be opened so that ligands can enter.

[0390] To better understand how these substrates bind and how the selectivity of RR1102 occurs, modeling studies were performed to allow analysis of the binding mode. Figure 8 The linear esters tested in b were docked to the binding site of RR1102. From these results, binding postures that were judged to be productive in the reaction mechanism were selected. These productive binding modes were defined as those whereby the carbonyl carbon of the substrate was predicted to be close to Ser149 (in ), and is oriented relative to the nucleophilic Ser149 such that it will allow nucleophilic attack on the substrate carbonyl. For shorter substrates, GOLD can generate a number of productive binding modes in which the p-nitrophenol group is located in either pocket A or pocket B. However, for longer substrates (e.g., p-NP hexanoate, C6), p-nitrophenol must bind in pocket A in order to generate a productive binding mode. Since the binding modes are likely to be similar for all substrates, it was decided that the correct binding mode was one in which p-nitrophenol binds in pocket A (see Figure 8 A). The selectivity data generated showed high levels of hydrolysis for substrates containing 2 to 8 carbons in the alkoxy chain. Among them, the activity dropped significantly for p-nitrophenol esters with chains longer than eight carbons. Analysis of the predicted binding mode indicated that esters with alkoxy chain lengths longer than eight carbons reach outside the pocket identified by PRANK.

[0391] Example 9: Structural characterization of C15En2-A9S

[0392] Crystallization of Cl5En2

[0393] 600 units of TEV protease (Sigma Aldrich, catalog number T4455-1KU) were added to the purified recombinant protein pExp-bla Cl5En2-A9S (9.3 mg protein) to cleave the β-lactamase fusion tag. The cleavage was performed at 4°C for 16 hours and confirmed by SDS-Page gel, where the fusion tag was removed by nickel purification.

[0394] After purification, the cleaved and pure Cl5En2-A9S protein was submitted to initial crystallization trials at a final concentration of 6.7 mg / mL in a buffer containing 100 mM hepes pH 7.0, 100 mM sodium formate, by using the following commercial kits: JCSG kit (Qiagen, Hilden, Germany), Wizard I and II (Emerald Biosystems, Bainbridge Island, Washington, USA) and Classics (Jena Bioscience, Germany). The first crystals were obtained in 0.8 M disodium succinate (commercial kit JCSG, well F7), and they were further optimized by varying the salt and protein concentrations.

[0395] We also co-crystallized Cl5En2-A9S in the presence of PCL nanoparticles. To this end, plates were prepared manually by vapor diffusion technique using 1 μL:1 μL and 1 μL:0.5 μL ratios of protein and stock solution. All crystallization plates were incubated at 18°C.

[0396] Data collection and structure determination of Apo-Cl5En2-A9S

[0397] Crystals were submitted to the beamline I03 of the Diamond Light Source from Oxfordshire, England for diffraction, and images were recorded using a Pilatus 6M detector. Apo forms Cl5En2-A9S and data sets co-crystallized with PCL were indexed and integrated using XDS (KABSCH, 2010). All structures were resolved by molecular replacement using the Phaser program in the CCP4 package. The structural coordinates of the brown thermophilic spore (Thermobifida fusca) cutinase (PDB code 5ZOA) sharing 36.39% amino acid sequence identity with Cl5En2 were used as models. COOT was used to manually correct the structure, and then the program REFMAC5 was used to perform rigid body correction and restricted correction cycles. Protein validation parameters were evaluated according to the Ramachandran diagram. Analysis of the structure and the diagram was performed with Pymol. All statistical data obtained by data collection and correction are shown in the following table:

[0398]

[0399]

[0400] The data for the composite structures of CI5En2 with PCL and BHET are provided in the table below:

[0401]

[0402]

[0403]

[0404] PDB Deposit

[0405] The structures of Apo-Cl5En2-A9S, PCL-Cl5En2-A9S and BHET-Cl5En2-A9S have been deposited at the PDB and can be accessed using PDB codes 7NCQ, 7ZJA and 7ZJ9, respectively.

[0406] result:

[0407] The structure of CI5En2-A9S is shown in Fig.10 The atomic coordinates are listed in Fig.17 middle.

[0408] The project leading to this application has received funding from the European Research Council (ERC) under grant agreements No. 695669 and 685474, within the European Union's Horizon 2020 research and innovation programme.

[0409] Example 10: Production of lignin nanoparticles

[0410] Lignin nanoparticles were prepared following the precipitation and solvent evaporation technique as previously described for PET. 1 Briefly, 250 mg of lignin powder was dissolved in 1,1,3,3,3,-hexafluoro-2-propanol (5 mL) for at least one hour. This solution was added dropwise (1 mL / min) to double distilled H2O (50 mL, cooled in an ice bath) until the accumulation of aggregated particles on the water surface was observed. Meanwhile, water was heated using an Ultra The suspension was stirred vigorously at 8000 rpm using a stirrer (IKA, Germany). The suspension was then filtered using Whatman filter paper (8 μm diameter). Afterwards, the remaining solvent was evaporated. No surfactant was required to prevent sedimentation.

[0411] Results: The results are shown in Figure 20. A) The hydrodynamic diameter was measured by dynamic light scattering on a Zetasizer NanoZS (Malvern, UK) to assess the particle size distribution. DLS measurements showed a narrow size distribution of lignin nanoparticles around 138 nm and monodispersity (PdI: 0.3). B) No sedimentation was observed in the microfluidic droplets when nanoparticles were used, even in droplet measurements performed several days later. No surfactant was required for stabilization.

[0412] Example 11: New enzyme for nylon depolymerization

[0413] Sequence space exploration was used for the initial discovery of new nylonases. Homologs of NylC were extracted from the MGnify database (NCBI accession code: Q1EPR5.2) and used to generate a sequence network consisting of 1583 node and 69291 edge sequences. The first connection of MGYP000645618208 (sequence retrieved from MGnify under the listed code) was identified and the sequence space was divided into clusters (from 1 to 3). Potential nylonase candidates were selected from each cluster, including: Nyl5 (MGnify code: MGYP000544655629, from cluster 1) and Nyl9 (MGnify code: MGYP000403660814, from cluster 3).

[0414] Enzyme Assays with Nylon Nanoparticles

[0415] Nylon nanoparticles (approximately 0.3 mg of dry powder) were incubated at 37°C with 10 μM purified and TEV-cleaved proteins in Tris-HCl and 100 mM NaCl buffer (pH 8). The reaction was terminated at different time points (t0, t3d and t7d) by thermal denaturation. The supernatant obtained by centrifugation (16,100 × g, 10 min) was analyzed by HPLC (1260 Infinity II, Agilent; Nucleodur C18 analytical EC standard column (5 μm, 4 x 125 mm, Marcherey-Naco, Germany)) to detect monomeric 6-aminohexanoic acid (Ahx). Buffer A (distilled water) and buffer B (acetonitrile) with a flow rate of 1 mL / min were used as mobile phases. At the beginning, buffer A was maintained at 100%. After 5 minutes, the mobile phase gradually changed to 100% B until 10 minutes, and then returned to 100% A until 15 minutes. Ahx was detected at 220 nm by comparison with authentic samples and quantified by comparison with a calibration curve.

[0416] Results: The results are shown in Figure 21-28 middle.

[0417] The following new nylonases were discovered:

[0418]

[0419]

[0420] Figure 24 shows various enzymes described above tested on PA6 nanoparticles (NP) (a) or a depleted tights sample containing 85% nylon (b). HPLC measurements confirmed the production of the nylon monomer 6-aminohexanoic acid (Ahx).

[0421] Fig.25 The discovery of some of the new nylonases listed in the table above is shown. In particular, these new nylonases are Nyl-10 (Uniprot code A0A1C6V3K0), Nyl-11 (Uniprot code A0A138ZXG5), Nyl-12 (Uniprot code A0A1M7HAK8) and Nyl-14 (Uniprot code WP243569406.1). Nyl-10, Nyl-11, Nyl-12 and Nyl14 are far away from the known nylonases in sequence space, sharing 49%, 33%, 30% and 56% sequence identity with NylC, respectively.

[0422] Fig.26The discovery of some other novel nylonases mentioned above is shown. In particular, the novel nylonases are Nyl 18-FL (MGnify code MGYP000370831902 / 2-317), 20-FL (MGnify code MGYP000123679597 / 3-313), 24-FL (MGnify code MGYP000614730541 / 11-353) and 25-FL (MGYP000554001943 / 18-373), which share 38%, 41%, 30% and 33% sequence identity with NylC, respectively.

[0423] Fig. 27 The discovery of the new nylonase Soil 1 described in the above list is shown. Soil 1 (MGnify code MGYP000120183263 / 1-286) shares 20% sequence identity with NylC.

[0424] Fig.28 The discovery of the new nylonase Ocean 2 described in the above list is shown. Ocean 2 (MGnify code MGYP000645432643 / 3-305) shares 19% sequence identity with NylC.

Claims

1. A method for screening an optimized plastic degrading enzyme, the method comprising: a) encapsulating a gene library having variant gene sequences of the plastic degrading enzyme into a plurality of microfluidic droplets, each microfluidic droplet comprising at least one variant gene sequence of the plastic degrading enzyme, and each microfluidic droplet further comprising: i) an expression system for expressing the gene; and ii) plastic particles; b) detecting degradation of the plastic particles in the microfluidic droplets; and c) Selecting a microfluidic droplet in which plastic degradation has been detected.

2. A method for identifying a plastic degrading enzyme, the method comprising: a) encapsulating the gene library into a plurality of microfluidic droplets, each microfluidic droplet comprising at least one gene, and each microfluidic droplet further comprising: i) an expression system for expressing the gene; and ii) plastic particles; b) detecting degradation of the plastic particles in the microfluidic droplets; and c) Selecting a microfluidic droplet in which plastic degradation has been detected. 3.a) The method of claim 1, wherein The gene library is a directed evolution library; or b) The method of claim 2, wherein the gene library is a metagenomic library; and / or c) The method of claim 2, wherein the method further comprises preparing a gene library having a variant gene sequence of the identified plastic degrading enzyme, and performing the method of claim 1.

4. The method of claims 1-3, wherein the degradation is detected by detecting a decrease in light scattering caused by the plastic particles.

5. The method of any one of claims 1 to 4, wherein the plastic particles comprise polyester, polyamide, polyurethane or polyolefin, optionally wherein the plastic particles comprise any one or more of polyethylene terephthalate (PET), polytrimethylene terephthalate (PTT), polybutylene terephthalate (PBT), polyethylene isosorbide terephthalate (PEIT), polylactic acid (PLA), polyhydroxyalkanoate (PHA), polybutylene succinate (PBS), polybutylene succinate adipate (PBSA), polybutylene terephthalate adipate (PBAT), polyethylene furanoate (PEF), polycaprolactone (PCL), poly(ethylene adipate) (PEA), polyethylene naphthalate (PEN), polyethylene (PE), polystyrene (PS), polypropylene (PP), polyvinyl chloride (PVC), polyurethane (PUR), polyamide (PA), polycarbonate (PC).

6. The method according to any one of claims 1, wherein the method is performed before a screening method for identifying a gene sequence of a plastic degrading enzyme, wherein the screening method comprises: a) encapsulating the gene library into a plurality of microfluidic droplets, each microfluidic droplet comprising at least one gene, and each microfluidic droplet further comprising: i) an expression system for expressing the gene; and ii) soluble plastic simulants; b) detecting cleavage of the soluble plastic simulant in the microfluidic droplets; and c) selecting a microfluidic droplet in which lysis has been detected, optionally wherein the gene library is a metagenomic library.

7. A hydrolase, optionally an esterase, having at least 70% or more sequence identity with: a) SEQ ID NO.2, optionally wherein the enzyme comprises any one or more of the following mutations of SEQ ID NO.2: i) A9S; and / or ii) A118E; and / or iii) A19T; or b) SEQ ID NO.4; or c) SEQ ID NO.

6.

8. The hydrolase, optionally an esterase, of claim 7a), wherein the enzyme comprises any one or more of the following mutations of SEQ ID NO. 2: a) A118E and / or F221S and / or S235G; and / or b) A118E and / or F221S; and / or c) A19T and / or A118E and / or F221S; and / or c)F221S.

9. A polypeptide having 100% sequence identity to SEQ ID NO. 2, 4 or 6, optionally 100% sequence identity to SEQ ID NO. 2, except for the following mutations: a) A9S; and / or b) A118E; and / or c) A19T; or d) A118E and / or F221S and / or S235G; and / or e) A118E and / or F221S; and / or f) A19T and / or A118E and / or F221S; and / or g) F221S.

10. A hydrolase having at least 70% identity to SEQ ID NO. 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32, or a polypeptide having 100% identity to SEQ ID NO. 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32.

11. An isolated and / or recombinant nucleic acid encoding the hydrolase or polypeptide of any one of claims 7-10.

12. An expression cassette or vector comprising the nucleic acid of claim 11.

13. A host cell comprising the nucleic acid of claim 11 or the expression cassette or vector of claim 12.

14. Use of any of the hydrolases or polypeptides according to claims 7 to 10 or the host cell according to claim 13 for degrading plastics.

15. A crystal of an esterase, wherein the esterase has: a) having at least 70% sequence identity to SEQ ID NO. 2, or being a biologically active fragment thereof, optionally: i) wherein the crystal diffracts X-rays to at least resolution; and / or ii) wherein the crystals have a space group of P6222; and / or iii) wherein the unit cell parameters are a=122b=122c=218α=90β=90γ=120; and / or iv) wherein the crystals are obtainable under the following crystallization conditions: sodium succinate; LiSO4; or PEG MME 5K and (NH4)2SO4, or b) having at least 70% sequence identity to SEQ ID NO. 4, or being a biologically active fragment thereof, optionally: i) wherein the crystal diffracts X-rays to at least resolution; and / or ii) wherein the crystal has a space group of P1211; and / or iii) wherein the unit cell parameters are a=60.6b=53.3c=100.6α=90β=100.3γ=90; and / or iv) wherein the crystals are obtainable under the following crystallization conditions: sodium citrate and (NH4)2SO4.

16. A computer readable data storage medium encoded with the atomic coordinates of a residue in Table 2 or 3, or the atomic coordinates in Figure 16 or 17.

17. The root mean square deviation of the main chain atoms of the residues in Table 2 or Table 3 is less than Or the root mean square deviation from the atomic coordinates in Figure 16 is less than The atomic coordinates of, optionally the coordinates of amino acids 12-325 of Figure 16 or Figure 17, optionally the coordinates of amino acids 2-267 of Figure 17 are used for the following purposes: a) Optimizing the plastic degradation activity of proteins through computational design; b) Optimizing protein thermal stability through computational design; c) Design of plastic hydrolases; or d) Phase the structural biology data obtained from the protein.

Images