Recombinant type VII collagen with whitening effect, preparation method and application thereof

Abstract

The present invention provides recombinant type VII collagen with whitening efficacy, a preparation method, and applications thereof, and belongs to the field of bioengineering technology. The present invention has discovered recombinant type VII collagen with whitening efficacy through research, and uses genetic engineering technology as a means to increase the expression level of recombinant type VII collagen, and uses a eukaryotic Pichia pastoris expression system to express and produce the recombinant type VII collagen. The recombinant type VII collagen of the present invention is expressed in Pichia pastoris, can be efficiently secreted and expressed extracellularly, is not easily degraded during the purification stage, and reduces the difficulty of purification. The recombinant type VII collagen has excellent whitening efficacy and is suitable for sensitive skin, does not cause skin irritation, itching, or burning, and has good practicality.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and in particular relates to recombinant type VII collagen with whitening effect, and a preparation method and application thereof. Background Art

[0002] Collagen, a major component of the human body, possesses numerous benefits, including diverse biological functions, biocompatibility, and biodegradability. With a molecular weight exceeding 300,000, and three peptide chains firmly bonded together, it is difficult for the human body to digest and absorb directly. Proteases in the digestive tract break it down into simple, small-molecule amino acids before it can be absorbed by the intestines. Compared to collagen, collagen peptides have a smaller molecular weight, exhibiting superior biofunctionality and high transdermal permeability, with an absorption rate of 95% to 100%. They are widely used in cosmetics, medicine, and food.

[0003] Collagen peptides are easily absorbed and have good transdermal permeability. They help maintain skin elasticity and moisture, promote skin cell renewal and repair, and thus improve skin texture and reduce wrinkles and fine lines. They offer significant antioxidant, anti-aging, soothing, and whitening benefits. The skin is the body's largest organ, covering its entire surface. Besides receiving sensory stimuli, it also serves as an insulator and protector. With aging, cell renewal slows, and hormonal changes are directly reflected in the skin. The formation of free radicals influences the rate of normal skin aging by attacking the skin's structure, destroying collagen and elastic fibers, and impairing hydration, resulting in poor complexion, sagging skin, and wrinkles. Skin color is primarily related to melanin content. Melanin deposition within cells is related to melanosome structure, transport, enzymes, and transcription. Whitening products that target the formation of melanin work by: 1) reducing exogenous stimuli; 2) inhibiting tyrosinase activity; 3) inhibiting the melanin synthesis signaling pathway; 4) inhibiting melanosome maturation; and 5) inhibiting melanosome transport. Traditional medications, including glucocorticoids, hydroquinone, and aminomercuric chloride, inhibit melanocyte maturation or interfere with the melanogenesis process by brightening the skin. However, these medications can have significant adverse reactions, including stinging, contact dermatitis, irritation, high toxicity, and sensitivity. New whitening skincare ingredients competitively bind to the MC1-R and MC4-R receptors on melanocytes, inhibiting α-MSH melanocyte-stimulating hormone (MSH), further blocking tyrosinase production and thus reducing excessive melanin production and deposits. Alternatively, they selectively inhibit tyrosinase (TYR) activity to reduce pigmentation while avoiding cytotoxicity.

[0004] In the field of skincare, the capsaicin receptor (TRPV1) is closely linked to skin burning, irritation, sensitivity, and pain. As an irritant target, it plays a key role in sensitive skin and inflammatory responses. TRPV1 activates sensory nerve endings, causing burning and itching sensations while also delaying skin barrier repair, making it a key pathway for skin discomfort. It is present in sensory nerve endings and skin cells, such as keratinocytes, fibroblasts, mast cells, and the endothelial cells of dermal capillaries, and is sensitive to a variety of physical and chemical irritants. TRPV1 receptor antagonists, used to alleviate skin discomfort caused by TRPV1 activation, are currently a hot topic for development of cosmetic raw materials and products. Ingredients that inhibit the TRPV1 receptor are currently under extensive research. Palmitoyl tripeptide-8 and palmitoyl tetrapeptide-7, products for sensitive skin, both have anti-allergic and soothing effects. However, in vitro synthesized peptides have low immunogenicity, high production costs, and slow onset of effect. Therefore, there is a need to develop safe and effective collagen peptides.

[0005] Anchoring fibrils are attachment structures that mediate epidermal adhesion in human skin, with type VII collagen (Col7) being the primary component of anchoring fibrils (AFs). Type VII collagen connects the basal layer to underlying tissues by interacting with other collagen types and portions of the extracellular matrix. In the absence of Col7, secretion of ECM-related proteins is reduced, while endoplasmic reticulum stress associated with Col1 is increased and TGFβ signaling is elevated. Alterations in Col7 structure and expression may disrupt the functional interaction with ECM components, leading to epidermal-dermal separation and the dystrophic epidermolysis bullosa (DEB), which is associated with persistent wound nonhealing. Col7 is required for the re-epithelialization of laminin 332 at the dermal-epidermal junction. Its absence disrupts laminin 332 organization during wound healing, thereby impairing integrin α6β4 expression in basal keratinocytes and negatively impacting the laminin 332 / integrin pathway. Loss of a single structural Col7 protein can lead to cellular inflammation and promote progressive keratinocyte-driven fibrosis. The organic matrix of mature tooth enamel (DEJ) contains macromolecular Col7. Col7 fibers embedded within the enamel not only contribute to the structural elasticity of the enamel but may also play a role in the bonding between enamel and dentin. Currently, there are few existing expression systems for type VII collagen due to the high cost of mammalian cell culture, slow growth cycles, and low expression levels of 15-20 mg / L. Although secreted into the supernatant, the system requires numerous purification steps and results in significant product losses, making industrial production unsuitable. Yields have been improved in large intestine expression systems, but have not yet reached commercial production scale. Both expression systems exhibit low yields, poor protein stability, and susceptibility to degradation, limiting them to laboratory research. Patent CN 118324898 A uses a recombinant Pichia pastoris strain to express type VII collagen. The expressed type VII is a macromolecular protein that promotes cell proliferation, migration, and differentiation, but has not demonstrated efficacy in skincare products or in combination with bioactive molecules.

[0006] Therefore, there is a need to develop recombinant small molecule collagen with whitening, anti-aging, anti-wrinkle and soothing effects. Summary of the Invention

[0007] In response to some deficiencies in the prior art, the present invention provides a recombinant type VII collagen with whitening efficacy, a preparation method thereof, and an application thereof. The present invention discovered a recombinant type VII collagen with whitening efficacy through research, and used genetic engineering technology as a means to increase the expression level of the recombinant type VII collagen, and used a eukaryotic Pichia pastoris expression system to express and produce the recombinant type VII collagen. The recombinant type VII collagen of the present invention is expressed in Pichia pastoris, can be efficiently secreted and expressed extracellularly, is not easily degraded during the purification stage, and reduces the difficulty of purification. The recombinant type VII collagen has excellent whitening, anti-aging, anti-wrinkle or soothing effects, is suitable for sensitive skin, does not cause skin irritation, itching, or burning, and has good practicality.

[0008] In order to achieve the above technical objectives, the present invention adopts the following technical means:

[0009] The present invention first provides a recombinant type VII collagen with whitening efficacy, wherein the recombinant type VII collagen comprises a binding site for a whitening action site; the whitening action site comprises one or more of MC1-R, MC4-R, GRM6, TRPM1 or MET.

[0010] Preferably, the recombinant type VII collagen further comprises a binding site for one or more action sites of anti-aging, anti-wrinkle or soothing effects;

[0011] The action sites of anti-aging, anti-wrinkle or soothing effects include one or more of TRPV1, IL1R1, and MT-CO2.

[0012] Preferably, the sequence of the recombinant type VII collagen is as shown in i or ii:

[0013] i. The amino acid sequence is shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 or SEQ ID No. 4;

[0014] ii. A protein derived from i, wherein the amino acid sequence in i is substituted, deleted or added with one or more amino acids and has human collagen activity.

[0015] The present invention also provides a nucleic acid encoding the recombinant type VII collagen with whitening effect, and the nucleic acid sequence is shown as SEQ ID No. 5 to SEQ ID No. 8.

[0016] The present invention also provides a recombinant expression vector comprising the above nucleic acid.

[0017] The present invention also provides a recombinant engineered bacterium, comprising the above-mentioned nucleic acid molecule or the above-mentioned recombinant expression vector.

[0018] Preferably, the host bacteria of the recombinant engineered bacteria include one of Pichia pastoris, Saccharomyces cerevisiae, and Hansenula.

[0019] Preferably, the host cell is Pichia pastoris, more preferably GS115-HCPB PPKEX2, with a deposit number of CGMCC No. 25815.

[0020] Preferably, the recombinant engineered bacteria are deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with the deposit numbers CGMCC No.31991 and CGMCC No.31992.

[0021] The present invention also provides a method for preparing the above-mentioned recombinant type VII collagen with whitening effect, the preparation method comprising:

[0022] (1) selecting and designing the sequence of recombinant type VII collagen, and then constructing a collagen tandem sequence using the recombinant type VII collagen as the basic unit tandem repeat;

[0023] (2) constructing a recombinant plasmid expressing the collagen tandem sequence, and linearizing the recombinant plasmid to obtain a linearized plasmid;

[0024] (3) electroporating the linearized plasmid into a host bacterium, screening, and verifying to obtain a high-copy recombinant engineered bacterium;

[0025] (4) fermenting and inducing expression of the high-copy recombinant engineered bacteria, and then purifying to obtain recombinant type VII collagen;

[0026] Preferably, in step (1), the recombinant type VII collagen comprises a binding site for a whitening action site; the whitening action site comprises one or more of MC1-R, MC4-R, GRM6, TRPM1 or MET.

[0027] Preferably, the recombinant type VII collagen further comprises a binding site for one or more action sites of anti-aging, anti-wrinkle or soothing effects;

[0028] The action sites of anti-aging, anti-wrinkle or soothing effects include one or more of TRPV1, IL1R1, and MT-CO2.

[0029] Preferably, in step (1), the sequence of the recombinant type VII collagen is as shown in i or ii:

[0030] i. The amino acid sequence is shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 or SEQ ID No. 4;

[0031] ii. A protein derived from i, wherein the amino acid sequence in i is substituted, deleted or added with one or more amino acids and has human collagen activity.

[0032] Preferably, in step (1), the collagen tandem sequence comprises 8 to 10 basic unit recombinant type VII collagens; and there is a site for recognition and cleavage by Kex2 enzyme or Ste13 enzyme between two adjacent basic units.

[0033] Preferably, the recognition and cleavage sites include KR or RR dibasic amino acid residues, followed by EA, EAEA or other amino acid residues that facilitate cleavage by Kex2 enzyme or Ste 13 enzyme.

[0034] Preferably, in step (1), the nucleic acid of the collagen tandem sequence comprises a nucleotide sequence as shown in SEQ ID No. 6 or SEQ ID No. 8, or a degenerate sequence thereof.

[0035] Preferably, in step (2), the vector of the recombinant plasmid includes pPICZαB, pFLDα, and pPIC9K, and the connection site is between XhoI and NotI.

[0036] Preferably, the vector is pPIC9K.

[0037] Preferably, in step (3), the host bacteria includes one of Pichia pastoris, Saccharomyces cerevisiae, and Hansenula.

[0038] Preferably, in step (3), the recombinant engineered bacteria are deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with the deposit numbers of CGMCC No.31991 and CGMCC No.31992.

[0039] The present invention also provides recombinant type VII collagen prepared according to the above method.

[0040] The present invention also provides the use of the recombinant type VII collagen in whitening, anti-aging, anti-wrinkle or soothing products.

[0041] The present invention also provides a whitening, anti-aging, anti-wrinkle or soothing product, which comprises the above-mentioned recombinant type VII collagen, or the type VII collagen encoded by the nucleic acid, or the recombinant vector, or the type VII collagen obtained by the method.

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] (1) The recombinant type VII collagen of the present invention contains one or more sites for whitening, anti-aging, anti-wrinkle and soothing effects. The recombinant type VII collagen has excellent skin care effects and is suitable for sensitive skin without causing skin irritation, itching or burning. The recombinant type VII collagen of the present invention competitively binds to the MC1-R and / or MC4-R receptors of melanocytes, inhibits α-MSH melanocyte-stimulating hormone, and further prevents the production of tyrosinase, thereby reducing excessive melanin production and deposition; the recombinant type VII collagen of SEQ ID No. 1 and SEQ ID No. 3 simultaneously contain binding sites for both MC1-R and MC4-R, two whitening sites.

[0044] (2) The recombinant type VII collagen described in the present invention is expressed in Pichia pastoris, can be efficiently secreted and expressed extracellularly, has a clear amino acid sequence, a single band, no degradation, and is easily absorbed. The transdermal properties, cell adhesion activity, cell migration activity and cell proliferation promoting activity of the small molecule collagen are tested. The results show that the transdermal properties are good while retaining the biological activity, and the cell adhesion and cell migration activities are not inferior to those of natural macromolecular collagen. The tandem expression of small molecules increases the expression level, solves the product shortage of recombinant small molecule type VII collagen, and provides an optional raw material for cosmetics.

[0045] (3) The present invention adopts a small molecule tandem expression method to express recombinant type VII collagen, which greatly improves the yield of recombinant type VII collagen. The technical solution of the present invention does not introduce exogenous proteins and does not use any in vitro enzymatic cleavage methods. During the process of intracellular secretion of recombinant type VII collagen, the residual amino acid residues of the enzymatic cleavage sites during the repeated tandem design will be removed to obtain recombinant type VII collagen without non-collagen sequences or with 100% homology to the corresponding region of natural collagen. The entire expression system avoids the cost and risk of exogenous protein residues caused by the use of protease cleavage in vitro, and can also shorten the time and cost of the subsequent purification process. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 These are agarose gel verification images of the recombinant engineered strains; a is GS115-HCPB-kex2-pPIC9K-715, and b is GS115-HCPB-kex2-pPIC9K-719.

[0047] Figure 2 This is the supernatant of recombinant type VII collagen expression in a shake flask after 72 hours of induction; a in the figure is 715 and b is 719.

[0048] Figure 3The results of protein spectrum detection of recombinant type VII collagen; in the figure, a is the protein list, b is the peptide coverage of 715 compared with the amino acid database, and c is the peptide coverage of 719 compared with the amino acid database.

[0049] Figure 4 This is the electrophoresis detection diagram of recombinant type VII collagen.

[0050] Figure 5 This is the electrophoresis detection diagram of purified recombinant type VII collagen.

[0051] Figure 6 This is a diagram of cell adhesion activity detection.

[0052] Figure 7 This is the result of cell migration area ratio detection.

[0053] Figure 8 This is a picture of cell migration.

[0054] Figure 9 This is a graph showing the inhibition rate of sample 719 on tyrosinase activity.

[0055] Figure 10 This is a graph showing the inhibition rate of melanin synthesis; in the graph, a is 715 and b is 719.

[0056] Figure 11 This is the result of cell viability test. DETAILED DESCRIPTION

[0057] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto. In the embodiments of the present invention, all that is not explained in detail is accomplished using conventional experimental methods, and the processes involved in the embodiments are understood and easily implemented by those skilled in the art based on the product instructions or basic knowledge in the art, and therefore will not be described in detail.

[0058] Example 1:

[0059] S1. Design of the amino acid sequence of recombinant type VII collagen:

[0060] A sequence of about 50 amino acids from the triple helix region of human type VII collagen (Q02388 CO7A1_HUMAN) was selected, KR was added to the C-terminus, EA was added to the N-terminus, and 6-10 copies were connected in series to make the target sequence size about 50KD to adapt to the optimal expression range of Pichia pastoris. After expression in Pichia pastoris, kex2 contained in Pichia pastoris itself cuts the KR carboxyl terminus in the amino acid junction KREA, ste13 cuts the nitrogen-terminal EA, and the overexpressed HCPB cuts the LinkerKR residue at the carboxyl terminus, cutting the tandem proteins into monomers, which are secreted outside the cell through the secretory signal peptide.

[0061] (1) An amino acid sequence containing multiple binding sites for whitening, anti-aging and soothing effects was selected, wherein the whitening effects included MC1-R and MC4-R, and the anti-aging and soothing effects included TRPV1 and IL1R1, i.e., 2731-2778AA of Q02388.CO7A1-HUMAN, LE was added to the C-terminus, and the obtained sequence was named 715, and the sequence is shown in SEQ ID No. 1.

[0062] On the basis of SEQ ID No. 1, EA was added to the N-terminus and KR was added to the C-terminus to form a basic unit, and the basic unit was repeated 8 times to form the amino acid sequence shown in SEQ ID No. 2, i.e., the collagen tandem sequence.

[0063] SEQ ID No. 1:

[0064] GPRGDPGERGPRGPKGEPGAPGQVIGGEGPGLPGRKGDPGPSGPPGPRGPLGDPGPRG PPGLPGLE;

[0065] SEQ ID No. 2:

[0066] *.

[0067] (2) An amino acid sequence containing multiple binding sites for whitening, anti-aging and soothing effects was selected, wherein the whitening sites included binding sites such as MC1-R, MC4-R and GRM6; the anti-aging and soothing effects included binding sites such as TRPV1, IL1R1 and MT-CO2, i.e., 1619-1667AA of Q02388.CO7A1-HUMAN, with LA added to the C-terminus, and the obtained sequence was named 719, and the sequence is shown in SEQ ID No. 3.

[0068] On the basis of SEQ ID No. 3, EA was added to the N-terminus and KR was added to the C-terminus to form a basic unit, and the basic unit was repeated 10 times to form the amino acid sequence shown in SEQ ID No. 4, i.e., the collagen tandem sequence.

[0069] SEQ ID NO.3:

[0070] GRPGPPGPVGPRGRDGEVGEKGDEGPPGDPGLPGKAGERGLRGAPGVRGLA;

[0071] SEQ ID NO.4:

[0072] *.

[0073] S2. Synthesis of DNA sequences and construction of recombinant plasmids:

[0074] Nanjing GenScript Biotech Co., Ltd. was commissioned to synthesize the nucleic acid sequences encoding the above-mentioned amino acid sequences SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4, and the corresponding nucleic acid sequences are shown in SEQ ID No.5 to SEQ ID No.8, respectively.

[0075] The synthesized gene fragments shown in SEQ ID No. 6 and SEQ ID No. 8 were cloned into pPIC9K, respectively. The exogenous target protein sequences were cloned using XhoI and NotI restriction sites, so that the target fragments were accurately inserted into the reading frame of the secretory vector containing the secretion signal α-factor, and recombinant plasmids expressing SEQ ID No. 1 and SEQ ID No. 3 were obtained and named pPIC9K-715 and pPIC9K-719.

[0076] SEQ ID No. 5 to SEQ ID No. 8 are shown below, wherein "CTCGAG" is an XhoⅠ restriction site and "GCGGCCGC" is a NotⅠ restriction site.

[0077] SEQ ID NO.5:

[0078] GGCCCCGCGGCGATCCGGGAGAGCGGGGCCCCCGTGGACCTAAGGGTGAGCCTGGCGCTCCAGGACAGGTGATAGGTGGGGAGGGTCCCGGACTGCCGGGGCGAAAAGGTGATCCTGGCCCGAGCGGTCCTCCTGGACCACGAGGGCCTTTGGGAGATCCCGGGCCTAGAGGACCGCCGGGACTGCCGGGCCTAGAA;

[0079] SEQ ID NO.6:

[0080]

[0081] SEQ ID NO.7:

[0082] GGCGCCCCGGTCCCCCTGGGCCTGTAGGTCCTCGTGGCCGAGACGGGGAGGTCGG

[0083] TGAAAAGGGCGACGAGGGACCACCTGGTGATCCTGGTCTACCGGGTAAAGCGGTGAG

[0084] AGAGGTTTACGTGGCGCCCCAGGAGTGAGAGGCCTAGCCAAGAGGGAGGCAGGAAGG

[0085] CCGGGACCCCCCGGCCCAGTAGGCCCTCGCGGGAGAGATGGAGAGGTTGGCGAGAAA

[0086] GGCGACGAAGGTCCGCCCGGCGATCCAGGGCTGCCCGGGAAGGCGGGGGAACGGGGTTTACGTGGGGCTCGGGCGTCCGCGGGCTAGCA;

[0087] SEQ ID NO.8:

[0088] CTCGAGAAAACGTGAAGCCGGGGGCCCCCGGTCCCCCTGGGCCTGTAGGTCCTCCGTG

[0089] GCCGAGACGGGGAGGTCGGTGAAAGGGCGACGAGGGACCACCTGGTGATCCTGGTCT

[0090] ACCGGGTAAAGCGGGTGAGAGAGGTTTACGTGGCGCCCCAGGAGTGAGAGGCCTAGCC

[0091] AAGAGGGAGGCAGGAAGGCCGGGACCCCCCGGCCCAGTAGGCCCTCGCGGGAGAGAT

[0092] GGAGAGGTTGGCGAGAAAGGCGACGAAGGTCCGCCCGGCGATCCAGGGCTGCCCGGG

[0093] AAGGCGGGGGAACGGGGTTTACGTGGGGCTCCGGGCGTCCGCGGGCTAGCAAAGAGA

[0094] GAGGCGGGTCGTCCAGGGCCCCCCGGGCCGGTGGGACCGCGAGGTCGCGATGGCGAG

[0095] GTCGGGGAAAAAGGAGACGAGGGCCCGCCCGGGGACCCAGGGTTGCCTGGCAAAGCA

[0096] GGTGAACGAGGGTTAAGGGGAGCACCTGGCGTAAGAGGCCTAGCGAAGCGTGAAGCA

[0097] GGGCGGCCTGGACCGCCGGGCCCAGTAGGTCCAAGAGGACGCGACGGTGAAGTAGGC

[0098] GAGAAGGGGGACGAGGGTCCTCCAGGCGATCCAGGACTGCCAGGCAAAGCCGGCGAA

[0099] CGAGGTTTACGGGGTGCACCAGGAGTCCGAGGCCTCGCAAAGCGCGAGGCCGGCAGA

[0100] CCTGGCCCGCCAGGGCCCGTGGGGCCCCGCGGTCGTGATGGTGAAGTCGGGGAGAAGG

[0101] GTGATGAAGGCCCACCCGGTGATCCTGGCCTCCCAGGCAAAGCAGGGGAACGGGGGTT

[0102] GAGAGGGGCGCCAGGGGTAAGGGGATTGGCCAAGCGAGAGGCCGGTCGTCCTGGCCCT

[0103] CCTGGACCAGTGGGTCCAAGAGGAAGGGACGGTGAAGTTGGAGAGAAGGGCGATGAA

[0104] GGGCCACCGGGCGATCCCGGATTACCCGGAAAAGCAGGCGAGCGGGGCTTGCGGGGTG

[0105] CTCCCGGAGTTCGGGGACTAGCGAAGAGGGAAGCAGGGCGCCCTGGCCCCCCCGGCCC

[0106] AGTTGGACCCAGGGGACGGGACGGCGAGGTGGGTGAAAAGGGGGACGAGGGGCCTCC

[0107] AGGGGACCCGGGGCTCCCTGGGAAGGCGGGGGAACGAGGTCTTAGGGGTGCGCCAGG

[0108] CGTCAGGGGGCTGGCCAAACGCGAAGCGGGTCGGCCTGGTCCTCCTGGTCCGGTTGGG

[0109] CCCCGAGGAAGGGACGGTGAGGTGGGAGAAAAGGGGGATGAGGGGCCACCGGGTGAT

[0110] CCTGGATTGCCGGGCAAAGCTGGGGAAAGGGGCCTTCGTGGTGCGCCGGGGGTCAGAG

[0111] GACTTGCTAAACGCGAGGCTGGTCGTCCAGGTCCTCCTGGGCCCGTCGGACCTCGTGGT

[0112] CGGGATGGCGAAGTAGGAGAGAAAGGAGATGAGGGGCCCCCGGGTGATCCGGGACTG

[0113] CCTGGAAAAGCTGGAGAGCGGGGACTTCGCGGAGCCCCCGGAGTTCGAGGATTAGCTA

[0114] AACGTGAAGCCGGTCGCCCCGGACCCCCAGGCCCGGTTGGTCCGCGTGGGAGGGATGG

[0115] AGAAGTGGGTGAGAAGGGAGACGAAGGACCCCCGGGGGACCCGGGCTTACCTGGAAA

[0116] AGCTGGTGAACGAGGGCTGCGTGGTGCTCCGGGTGTGCGGGGTTTAGCTAAGAGATGAGCGGCCGC。

[0117] S3. Construction of recombinant engineering strains and screening of strains:

[0118] 10 μg of the recombinant plasmid obtained in step 2 was linearized with Sal I (Dalian TaKaRa) enzyme, digested in a metal bath at 37°C for 30 min, and the linearized plasmid was collected by ethanol precipitation to control the volume to about 20 μL.

[0119] The linearized plasmid was electroporated into the host strain Pichia pastoris GS115-HCPB-PPKEX2 (from strain number: CGMCC No. 25815) competent cells, and the electroporated bacterial solution was spread on MD plates to screen His-positive bacteria. Theoretically, 1-10% of His+ transformants will have more than one insertion. If the frequency of multi-copy insertion is 1%, then 1000 His+ transformants will be screened to obtain 10 Resistant colonies, so a large number of single colonies need to be selected for verification and screening.

[0120] The screening steps are:

[0121] Take 200 μL and spread it on MD plate, and culture it in biochemical incubator at 30℃ for 2 days. The cells growing on MD plate are His+ transformants by default. Wash the cells on MD plate with sterile water and collect them in sterile EP tube. After measuring OD600, take 5*10 5 Individual strains were plated onto YPDG (500 μg / mL, 1 mg / mL, G418) plates, incubated at room temperature for 10 minutes, and inverted at 30°C for 2-5 days until single colonies (positive transformants) appeared. The number of single colonies growing on plates with high antibiotic concentrations was higher than on plates with low antibiotic concentrations, resulting in high-copy recombinant engineered strains designated GS115-HCPB-PPKEX2 / pPIC9K-715 and GS115-HCPB-PPKEX2 / pPIC9K-719.

[0122] The high-copy recombinant engineered bacteria were sent to the General Microbiology Center of the China General Culture Collection Administration, with the culture collection numbers: CGMCC No. 31991 and CGMCC No. 31992. The address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the deposit date is: September 18, 2024; the taxonomic name is: Pichia pastoris Komagataella phaffii.

[0123] For each sequence, 16 single colonies were picked and placed in 200 mL of YPD medium in a 96-well plate. The plates were cultured in a 30°C biochemical incubator for 24 h. 80 μL of the bacterial solution was used to extract the template. 2 μL of the extracted template was added to a PCR tube for polymerase chain reaction (PCR). After the reaction, the target bands were verified by nucleic acid electrophoresis.

[0124] The primers used in the above PCR reaction are:

[0125] 5'AOX:GACTGGTTCCAATTGACAAGC (SEQ ID No. 9);

[0126] 3'AOX:GCAAATGGCATTCTGACATCC (SEQ ID No. 10);

[0127] The PCR reaction conditions were as follows: 94°C for 5 min; 94°C for 30 s, 55°C for 30 s, and 72°C for 2 min 15 s, 30 cycles.

[0128] The results of nucleic acid electrophoresis verification are as follows Figure 1 As shown, from Figure 1 It can be seen that the product size is 1900-2200bp, and there are two close target bands for the 719 target sequences. Some of them do not have target bands in the figure. The positive strains with correct target bands in the nucleic acid electrophoresis diagram are selected for the next experiment.

[0129] S4. Inducible expression and identification of recombinant collagen:

[0130] The GS115-HCPB-PPKEX2 / pPIC9K-715 and GS115-HCPB-PPKEX2 / pPIC9K-719 engineered bacteria, verified by colony PCR, were inoculated into 15 mL of BMGY medium and cultured at 28-30°C and 220 rpm until the OD600 was 2-15 (16-24 h). The cells were collected by centrifugation at 1500-3000 g for 5 min at room temperature, and the cells were resuspended in BMMY medium to an OD600 of approximately 10. The cells were cultured in a biochemical incubator at 28-30°C and 220 rpm for 3 days. 0.5% of the final volume of methanol was added every 24 h. Samples were taken after 72 h of induction and the supernatant was collected by centrifugation at 9000 g for 5 min at room temperature. The collected expression supernatant was added with 2× loading buffer (Coomassie brilliant blue, denaturant DTT, SDS buffer), heated in a 100°C metal bath for 5 minutes, and then subjected to GLASS gel precast gel Tricine protein gel detection. The test results were as follows: Figure 2 The results showed that the target band could be efficiently secreted and expressed outside the cell, and its molecular weight was consistent with the apparent migration characteristics of collagen, without degradation.

[0131] The expected target bands of 715 and 719 on the GLASS gel precast gel Tricine were cut out and digested with trypsin. The peptide fragments of the recombinant collagen after trypsin digestion were detected by Nano-HPLC-MS / MS mass spectrometry (completed by Suzhou Putai Biotechnology Co., Ltd.), and the detected peptide fragments were compared with the theoretical sequence. The test results are as follows: Figure 3 The target band was identified by protein gel mass spectrometry, and the mass spectrometry results showed that the similarity with the theoretical amino acid sequence of protein gel was more than 85%.

[0132] S5. High-density fermentation and purification test:

[0133] (1) The recombinant engineered bacteria selected in step 3 are subjected to a high-density fermentation test to express and produce 715 and 719 collagens on a large scale to obtain a fermentation broth containing recombinant collagen.

[0134] Among them, seed culture medium YPG: yeast powder 10g / L, peptone 20g / L, glycerol 10g / L;

[0135] Fermentation medium: NH4H2PO4 190.4 g / L, KH2PO4 10.06 g / L, CaSO4·2H2O 1.18 g / L, K2SO4 18.2 g / L, MgSO4·7H2O 14.9 g / L, glycerol 40 g / L; after high-temperature sterilization of the fermentation medium, PTM1 was added when the temperature dropped to room temperature, and the pH was adjusted to 5.0 with aqueous ammonia.

[0136] Feed medium: 50% w / v glycerol, plus 12 mL PTM1 trace elements per liter;

[0137] Induction medium: 100% methanol, 12 mL of PTM1 trace elements per liter;

[0138] PTM1: Sterilize by filtration using a 0.22 μm filter and store at 4°C.

[0139] The batch culture conditions and induced expression conditions of the engineered strains are as follows: the batch fed culture method is adopted, and the culture temperature is 30°C. The engineered bacteria are inoculated into a 1L shake flask containing 200mL of seed culture medium YPG, and cultured at 220rpm and 30°C for 18-20h to OD600=2~10. A 5L fermenter (Baoxing Bio) is used, with a liquid volume of 2L of fermentation medium and 2% glycerol sterilized separately. Before inoculation, the speed is adjusted to 300rpm, the ventilation volume is 4L / min, and the temperature is 30°C. The pH is adjusted with an alkaline solution prepared with concentrated ammonia water, and the pH is set to 4.5. Then 0.9mL of PTM1 is first inoculated, and then the prepared 200mL seed liquid is inoculated into the tank (flame circle inoculation), and then the dissolved oxygen electrode is clicked for calibration, and fermentation is started after calibration. When the dissolved oxygen drops to 30% for the first time during growth, the dissolved oxygen cascade speed function is used to maintain 30%; wait for the glycerol to be consumed, the dissolved oxygen rebounds, and the dissolved oxygen is greater than 70% (OD 600 Value of about 20), cancel the dissolved oxygen cascade speed, increase the stirring to 650rpm, and use 30% linkage feeding of glycerol, feeding 80mL. Stop feeding glycerol, after the dissolved oxygen rebounds to above 70%, set the pH to 4 and the temperature to 29℃, and induce culture with a mixed carbon source of methanol and glycerol (methanol: 50% glycerol = 7:3). Manually add 5mL, wait for the dissolved oxygen to rebound to above 70%, set the feeding rate to 8mL / h, increase it to 10mL / h after one hour, and increase it again to 20mL / h after one hour. When the dissolved oxygen value is lower than 30%, stop feeding and wait for the dissolved oxygen to rebound. After the dissolved oxygen returns to 30%, linkage feeding is resumed. After 40-60h of induction, the protein concentration measured by UV measurement does not increase significantly or decreases, and the tank can be released.

[0140] UV protein quantification formula: C (mg / mL) = 0.144*(A215-A225), A215<1.5.

[0141] The fermentation supernatant was collected and subjected to protein electrophoresis using GLASS gel precast gel Tricine (16.5%, Shanghai Wansheng Haotian). The sample volume was 5 μL. The test results were as follows: Figure 4 As shown in the figure, under high-density fermentation conditions, the collagen proteins of each sequence almost only had the target band after induction, and the main band proportion of optical density analysis exceeded 85%.

[0142] (2) Purification:

[0143] Buffer A: 20 mM KH2PO4, pH 4.0;

[0144] Buffer B: 20 mM KH2PO4, 1 M NaCl, pH 4.0.

[0145] The fermentation broth in step (1) was collected and centrifuged at 2000g, 30min, and 4°C to separate the bacterial cells and the fermentation supernatant. The cation exchange medium was balanced with buffer A (the chromatography filler was UniGel-80sp produced by Suzhou Nano Micro, loaded on an XK50 / 30 chromatography column produced by Lisui Technology, and a GE AKTA Pure protein separation chromatography purification system was used) until the A215 absorbance and conductivity values remained unchanged. The sample was loaded at a flow rate of 100us / cm, with a sample volume of 0.5L / time. The ultraviolet A215 absorbance was detected. When it rose, the sample was started. When the A215 absorbance dropped, the sample was stopped until the ultraviolet and conductivity dropped to the lowest and no longer changed. After the sample loading was completed, the sample was closed and the cationic chromatography medium was balanced with buffer A again. The eluate was collected, and after the components were detected and determined, dialyzed (the dialysate was ultrapure water), then concentrated and freeze-dried to collect the freeze-dried collagen sponge, i.e., 715 and 719.

[0146] Take the purified freeze-dried sponge and dissolve it in ultrapure water, and perform protein electrophoresis. Figure 5 As shown in the figure, it can be seen that bands 715 and 719 are clear and the content of the target band is high.

[0147] Example 2: Recombinant collagen cell adhesion activity experiment

[0148] In this example, natural collagen was used as a control, and collagen 715 and 719 (recombinant type VII collagen with amino acid sequences as shown in SEQ ID No. 1 and SEQ ID No. 3) were used as examples to investigate the cell adhesion activity of the recombinant type VII collagen of the present invention.

[0149] The specific steps are as follows:

[0150] (1) Material preparation: Mouse embryonic fibroblast NIH / 3T3 cells (cell line obtained from the Chinese Academy of Sciences Cell Bank (SCSP-515), culture and passaging methods were performed according to the cell instructions). 715 and 719 collagen freeze-dried sponges and positive native collagen (Sigma, catalog number C7774-5MG) were obtained.

[0151] Among them, the processing method of positive control natural collagen is as follows: weigh a 5mL sterile centrifuge tube, add human collagen in a clean bench and weigh it, reduce the weight to get the sample amount, dissolve it with ultrapure water and add acetic acid to pH 3.0 (concentration 5mg / mL), and a milky white solution can be obtained. The protein concentration is determined by the UV protein quantitative empirical formula: C (mg / mL) = 0.144*(A215-A225). When used, dilute the concentration to 0.5mg / mL with serum-free DMEM culture medium and filter sterilize with a 0.22μm sterile filter. (2) Coating preparation:

[0152] 100 μL of sample (standard / test sample / blank control) was added to each well of a 96-well plate. Standard: positive control native collagen 0.5 mg / mL (Sigma, Cat. No. C7774-5MG); Test sample: 715 and 719 collagen 0.5 mg / mL; Blank: D-PBS phosphate buffer.

[0153] Four wells were prepared for each sample coating, and the cells were incubated in a 37°C, 5% CO2 (v / v) incubator for 1-4 hours. Excess coating solution was removed from the wells, and 100 μL of 1% BSA-PBS solution was added. The cells were incubated in a 37°C, 5% CO2 incubator for 1 hour. After removing the liquid from the wells, the cells were washed three times with D-PBS, and the washing solution was discarded. Hoechst-33342 fluorescent dye (10%) was premixed with complete culture medium, and the NIH / 3T3 cells were diluted to 5×10 4 100 μL of cells were added to the wells, covered with aluminum foil, and incubated at 37°C, 5% CO2 for 1 h.

[0154] The specific detection steps are:

[0155] Use an inverted microscope to capture at least 4×4 digital tile images (fluorescence) of each of the 3 wells. Each well is filled with D-PBS to form a "reverse meniscus", purged of bubbles and covered with sealing film. Centrifuge the plate (inverted) at a relative centrifugal force (RCF) of 300g at 22°C for 5 minutes. After centrifugation, discard the sealing film, remove the supernatant from the well, wash once with D-PBS, and add 100μL D-PBS. For each of the 3 wells, a total of 25 fluorescent tile digital images are taken (at least 4×4 matrix is recommended, with 10% tile overlap), and approximately 2400 to 3600 cells are counted for each sample (800-1200 cells / well × 3 wells). 3 replicate samples are measured. The fourth well is used to adjust the microscope parameters and its measurement values are not used. The measurement results are shown in Figure 2. Figure 6 shown.

[0156] Adhesion experiments of NIH / 3T3 and HaCat cells Figure 6 It can be seen that the sample has stronger adhesion after coating and is better than the blank control group. In NIH / 3T3 cells, the experimental group is more obviously better than the blank control group. This is because the 715 sequence contains active binding sites such as whitening sites and active binding sites of complement C1s. Complement C1s is a catalytically active subunit in the classical activation pathway and has a significant effect in promoting cell adhesion. The adhesion experiment results show that 719 has a good promoting effect on cell adhesion.

[0157] The 719 sequence has similar efficacy to 715 and possesses a binding site for matrix metalloproteinase-12, a key enzyme involved in extracellular matrix degradation. By degrading matrix proteins, it enables white blood cells, fibroblasts, and tumor cells to penetrate the matrix and participate in inflammatory responses and tissue repair. Using matrix metalloproteinases (MMPs) as therapeutic targets, the design and search for antagonists targeting MMPs, particularly those that selectively inhibit or competitively bind to MMPs, has been a hot topic in cancer treatment in recent years. The active binding site contained in the 719 polypeptide can competitively bind to matrix metalloproteinase-12, thereby inhibiting the penetration of white blood cells, fibroblasts, and tumor cells into the matrix. This indicates that the recombinant type VII collagen described herein exhibits cell adhesion properties similar to those of native collagen.

[0158] Example 3: Recombinant collagen cell migration experiment

[0159] In this example, NIH / 3T3 cells consistent with those in Example 2 were used to examine the cell migration ability of 715 and 719 collagen freeze-dried sponges and a positive control, natural collagen (Sigma, catalog number C7774-5MG).

[0160] (1) Experimental preparation: First, use a marker pen to draw horizontal lines evenly on the back of a 6-well plate, using a ruler. Draw lines every 0.5 cm to 1 cm across the holes, with 3 lines drawn across each hole. Add about 5 × 10 5 cells.

[0161] (2) Scratch test: On the second day of cell culture, use the tip of a pipette to scratch the cells perpendicular to the horizontal line on the back of the pipette. The pipette tip should be vertical and not tilted. Then, rinse the cells three times with PBS to remove the scratched cells. Serum-free medium containing the test sample is added as the experimental group at a concentration of 0.05% (mass to volume ratio). Incubate the cells at 37°C, 5% CO2 in an incubator. Samples are taken at 0 and 24 hours of culture and photographed.

[0162] (3) Data processing: The scratch area of each picture was calculated using ImageJ image processing software, and the migration rate of each group of cells was calculated by dividing the total area of the migrating cells in the fixed scratch area by the initial area of the fixed scratch area. The time was used as the horizontal axis and the migration area ratio was used as the vertical axis (unit %). The photos of the experimental group and the control group at the initial time 0 and the end of the experiment were compared. The data differences of each experimental group were analyzed using one-way variance and chi-square test. The experimental results are shown in Figure 2. Figure 7 and Figure 8 shown.

[0163] Combine Figure 7 and Figure 8As can be seen, after 24 hours of NIH / 3T3 and HaCat cell migration experiments, sample group 715 showed a higher migration rate, while sample group 719 exhibited a migration-promoting effect superior to the blank control group and similar to that of the positive control group. This suggests that as cells continue to grow over time, the cell migration-promoting effect of the experimental group samples becomes more pronounced under physiological conditions, effectively promoting cell migration on biomaterials.

[0164] Example 4: Investigation of the ability to inhibit cell tyrosinase activity

[0165] Melanin is a high molecular weight biological pigment synthesized by melanocytes, distributed in the dermis of the skin. The quantity and quality of melanin in the skin are the important factors determining skin color. The synthesis of melanin is mainly regulated by tyrosinase, which is the rate-limiting enzyme for the initial reaction of melanin synthesis in an organism. The present embodiment is based on mouse melanoma cell B16 (derived from C57BL / 6J mouse melanoma, article number: CM3076) as research object, and the inhibition rate of recombinant type VII collagen of the present invention to intracellular tyrosinase activity is measured to evaluate the whitening effect of the recombinant type VII collagen.

[0166] The specific steps are as follows:

[0167] In this example, the blank control was cell culture medium and cells without sample, the positive control was 100 μg / mL α-arbutin, and the experimental groups were 0.01%, 0.03% and 0.1% recombinant type VII collagen 715 and 719.

[0168] B16 cells were cultured at a rate of 1 × 10 4 / well density plated 96-well cell culture plates, after 24 hours of PBS washing and replacement with 1640 medium diluted experimental group samples, the blank control group added the same volume of 1640 medium, the positive control group added 100μg / mL α-arbutin and 1640 medium, each concentration set three replicates. After 72 hours of incubation in the cell culture incubator, the supernatant was discarded, and the cells were rinsed once with PBS. Then, 100μL of PBS containing 1% TritonX-100 was added to each well, placed at -80℃ for 30 minutes, incubated at 37℃ to completely rupture the cells, and after 20 minutes, 50μL of 1×10 -2 mol / L L-DOPA, incubate at 37°C for 30 min, and measure the absorbance at 492 nm.

[0169] Wherein, tyrosinase activity inhibition rate = (1-absorbance of sample group / absorbance of control group)*100%.

[0170] Significant difference P value analysis was performed using GraphPad Prism software. The tyrosinase activity inhibition rate of the positive control was 11.43% ± 3.57%, which was significantly different from that of the blank control (P value 0.00516), indicating that the experimental system was effective. Recombinant type VII collagen 715 had no inhibitory effect on tyrosinase activity at the tested concentrations of 0.01%, 0.03%, and 0.1%. 719 had an inhibitory effect on tyrosinase activity at the tested concentrations of 0.01%, 0.03%, and 0.1%.

[0171] from Figure 9 As can be seen, the tyrosinase activity inhibition rate in the positive control group was 46.12% ± 6.61%, significantly different from the blank control (P value < 0.001), indicating the effectiveness of the test system. The tyrosinase activity inhibition rates of 719 at a test concentration of 0.01% were 24.42% ± 9.08%, at a test concentration of 0.03% were 34.50% ± 4.08%, and at a test concentration of 0.1% were 42.64% ± 6.40%, all higher than those in the blank control. Using GraphPad Prism software, a t-test was performed to analyze the tyrosinase activity inhibition rates of the blank control, positive control, and test samples, demonstrating that 719 had a significant inhibitory effect on tyrosinase.

[0172] In summary, the recombinant type VII collagen of the present invention can reduce excessive melanin production and deposition by inhibiting the activity of tyrosinase, thereby achieving a whitening effect, and can be used to prepare products with whitening function.

[0173] Example 5: Investigation of Melanin Synthesis Inhibition Rate

[0174] In this example, mouse melanoma cells B16 were used as the research subjects to determine the inhibitory effect of the recombinant type VII collagen of the present invention on melanin synthesis, thereby evaluating the whitening efficacy of the recombinant type VII collagen of the present invention.

[0175] The specific steps are as follows:

[0176] Blank control: cell culture medium and cells without sample;

[0177] Positive control: 100 μg / mL α-arbutin;

[0178] Experimental groups: 0.01%, 0.03% and 0.1% recombinant type VII collagen 715 and 719.

[0179] B16 cells were cultured at a rate of 1 × 10 4The cells were plated in 6-well cell culture plates at a density of 1 / 4 t / well and cultured for 24 h. After removing the culture medium, the cells were rinsed with PBS and replaced with samples of different concentrations diluted with 1640 culture medium (containing 2% serum). Three replicates were set for each concentration. After 72 h of culture in a cell culture incubator, the supernatant was discarded, 500 μL of trypsin was added to each well for 1-2 min, and complete culture medium was added to terminate the digestion. The cells were then pipetted and mixed. The cell suspension was collected in a centrifuge tube, and a small amount was taken for cell counting. The blank control group, the positive control group, and the experimental group were confirmed to have similar cell numbers to eliminate the difference in melanin content caused by the difference in background cell number, so that each component of the experiment was compared at the same or similar cell number level for melanin content.

[0180] Centrifuge 1 mL of cells collected after trypsin digestion at 3000 rpm for 10 minutes, discard the supernatant, add 1 mL of 1 mol / L NaOH aqueous solution containing 10% (volume fraction) DMSO, seal the tube with parafilm, heat in an 80°C water bath for 30 minutes, and measure absorbance at 405 nm. Melanin synthesis inhibition rate = (1 - absorbance of sample group / absorbance of control group) * 100%.

[0181] The significant difference P value was analyzed by GraphPad Prism software. The melanin synthesis inhibition rate of blank control, positive control and test sample was analyzed by t test method using GraphPad Prism software. Figure 10 shown.

[0182] from Figure 10 As can be seen from a, the melanin synthesis inhibition rate of the positive control is 36.58% ± 4.72%, which is significantly different from that of the blank control (P value 0.00017), indicating that the experimental system is effective. The melanin synthesis inhibition rate of recombinant type VII collagen 715 at a test concentration of 0.01% is 27.63% ± 9.64%, the melanin synthesis inhibition rate at a test concentration of 0.03% is 35.41% ± 10.28%, and the melanin synthesis inhibition rate at a test concentration of 0.1% is 45.33% ± 5.30%, all of which are higher than the blank control.

[0183] from Figure 10 As shown in Figure 2, the positive control (100 μg / mL α-arbutin) showed a melanin synthesis inhibition rate of 17.92% ± 10.37%, significantly different from the blank control (P value 0.04022), indicating the effectiveness of the experimental system. Recombinant type VII collagen 719 showed melanin synthesis inhibition rates of 12.37% ± 6.45% at a test concentration of 0.03% and 27.06% ± 7.02% at a test concentration of 0.1%, both higher than the blank control. However, at a test concentration of 0.01%, there was no inhibitory effect on melanin synthesis.

[0184] Therefore, the recombinant type VII collagen 715 described in the invention can inhibit melanin synthesis at the tested concentrations of 0.01%, 0.03% and 0.1% to achieve whitening effect, and significant differences are marked in the figure, among which the 0.1% concentration has the best inhibitory effect; 719 has an inhibitory effect on melanin synthesis at the tested concentrations of 0.03% and 0.1%, and the 0.1% concentration has a significant inhibitory effect on melanin compared with the blank control group. The 715 and 719 collagens can inhibit melanin synthesis to achieve whitening effect, and can be used to prepare products with whitening function.

[0185] Example 6: Detection of the antioxidant capacity of recombinant type VII collagen

[0186] The DPPH free radical is a very stable nitrogen-centered free radical with a single electron. Its alcohol solution is purple and has strong absorption at 515nm. When an antioxidant is present, the DPPH free radical is scavenged, the solution color becomes lighter, and the absorbance at 515nm decreases. Within a certain range, the change in its absorbance is proportional to the degree to which the free radical is scavenged. The DPPH free radical is one of the important indicators of antioxidant capacity. This example investigates the DPPH free radical scavenging rate of recombinant type VII collagen to assess its antioxidant capacity. The specific investigation steps are as follows:

[0187] (1) Preparation of samples and reagents:

[0188] Prepare reagents using the DPPH Free Radical Scavenging Ability Assay Kit (colorimetric method, purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number D799007-0050). Use the extract provided with the kit to prepare recombinant type VII collagen 715 and 719 to concentrations of 5 mg / mL and 10 mg / mL, respectively.

[0189] Reagent 1: anhydrous ethanol.

[0190] Reagent 2: (0.6mL EP tube placed in 8mL reagent bottle) Add 6.08mL of reagent 1 and shake to dissolve before use.

[0191] Working solution: Before use, prepare the working solution according to the ratio of Reagent 2: Reagent 1 (V:V) = 4:21 according to the required amount of the test, and use it immediately after preparation.

[0192] Reagent 3: 10 mg vitamin C, stored at 4°C. Add 1 mL of extract immediately before use and shake thoroughly to dissolve; prepare a 10 mg / mL vitamin C solution for use as a positive control.

[0193] (2) Reagent addition:

[0194] Blank tube: 25 μL of extract plus 975 μL of working solution;

[0195] Experimental group: 25 μL sample solution was added with 975 μL working solution to obtain experimental groups with different concentrations of recombinant type VII collagen 715 and 719;

[0196] Positive control group: 5 mg / mL and 1 mg / mL vitamin C solution plus 975 μL working solution;

[0197] Standard groups: Use the extract to prepare vitamin C solutions at concentrations of 0.3, 0.25, 0.125, 0.0625, 0.03125, and 0.015625 mg / mL. Take 25 μL of each vitamin C solution and mix it with 975 μL of the working solution to obtain the standard group.

[0198] (3) Detection:

[0199] Preheat the spectrophotometer for at least 30 minutes and adjust the wavelength to 515 nm. Completely add the solution to the test wells and mix thoroughly. Incubate at room temperature, protected from light, for 30 minutes. Measure the absorbance at 515 nm. Zero the sample with anhydrous ethanol before measurement. Only one to two blank tubes need to be measured. The results are shown in Table 1.

[0200] Table 1. DPPH free radical scavenging rate of recombinant type VII collagen

[0201]

[0202] As can be seen from Table 1, the main function of sequences 715 and 719 is whitening, and the antioxidant effect is not obvious. Compared with the existing antioxidant vitamin C, small molecule collagen peptides are more multifunctional and are synthesized in vitro using biotechnology, with better biosafety and immunity.

[0203] Example 7:

[0204] Under the experimental conditions of this example, recombinant collagen 715 and 719 were used as samples to investigate the cytotoxicity of the recombinant type VII collagen described herein. The biological function of the recombinant type VII collagen was tested using mouse melanoma B16 cells (derived from C57BL / 6J mouse melanoma, catalog number: CM3076) according to the method provided in standard YY / T 1849-2022 Recombinant Collagen.

[0205] The specific inspection steps are as follows:

[0206] Blank control: cell culture medium and cells without sample;

[0207] Positive control: 100 μg / mL α-arbutin;

[0208] Experimental groups: 0.01%, 0.03% and 0.1% recombinant type VII collagen 715 and 719.

[0209] (1) Test equipment and consumables

[0210] B16 (mouse melanoma cells), 1640 medium

[0211] 96-well cell culture plates, 6-well cell culture plates, microplate reader, CCK-8 kit

[0212] (2) Test method

[0213] Cytotoxicity assay: B16 cells were cultured at a rate of 1×10 4 / well density plate 96-well cell culture plate, after 24 hours of PBS washing and replacing with 1640 medium diluted with different concentrations of samples, each concentration set 3 replicates. After 72 hours of cell culture incubator, add CCK-8, and use microplate reader to detect cytotoxicity at 450nm wavelength. The test results are as follows Figure 11 shown.

[0214] CCK-8 test results: Cell viability (%) = (As-Ab) / (Ac-Ab) × 100%

[0215] As is the absorbance of the sample to be tested, Ab is the absorbance of the blank sample group, and Ac is the absorbance of the negative sample group.

[0216] from Figure 11 It can be seen that 715 and 719 had no effect on cell activity at concentrations of 0.1%, 0.03% and 0.01%, and the absorbance values were similar to those of the positive control group, indicating that they had no cytotoxicity. Concentrations of 0.03% and 0.01% promoted cell growth.

[0217] In summary, the present invention has discovered recombinant type VII collagen with whitening effect through research, and used genetic engineering technology as a means to increase the expression level of recombinant type VII collagen, and used the eukaryotic Pichia pastoris expression system to express and produce recombinant type VII collagen; the recombinant type VII collagen of the present invention is expressed in Pichia pastoris, can be efficiently secreted and expressed extracellularly, is not easily degraded during the purification stage, and reduces the difficulty of purification; the recombinant type VII collagen has excellent whitening effect and is suitable for sensitive skin, does not cause skin irritation, itching, or burning, and has good practicality.

[0218] The embodiments described are preferred implementations of the present invention, but the present invention is not limited to the above implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention are within the scope of protection of the present invention.

Claims

1. Recombinant type VII collagen with whitening effect, characterized in that: The amino acid sequence of the recombinant type VII collagen is shown as SEQ ID No. 1 or SEQ ID No.

3.

2. The nucleic acid encoding the recombinant type VII collagen with whitening effect according to claim 1, characterized in that: The nucleic acid sequence is shown as SEQ ID No.5 or SEQ ID No.

7.

3. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the nucleic acid according to claim 2.

4. A recombinant engineered bacterium, characterized in that: Comprising the nucleic acid according to claim 2 or the recombinant expression vector according to claim 3.

5. The recombinant engineered bacterium according to claim 4, characterized in that The host bacteria of the recombinant engineering bacteria include one of Pichia pastoris, Saccharomyces cerevisiae and Hansenula.

6. The recombinant engineered bacterium according to claim 5, characterized in that The host bacteria is Pichia pastoris.

7. The recombinant engineered bacterium according to claim 6, characterized in that The host bacteria is GS115-HCPBPPKEX2, and its deposit number is CGMCC No. 25815.

8. The recombinant engineered bacterium according to claim 4, characterized in that The recombinant engineered bacteria are deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with the deposit numbers of CGMCC No.31991 and CGMCC No.31992.

9. The method for preparing the recombinant type VII collagen with whitening effect according to claim 1, characterized in that: The preparation method comprises: (1) Select and design the sequence of recombinant type VII collagen, and then construct a collagen tandem sequence based on the tandem repeats of recombinant type VII collagen; (2) constructing a recombinant plasmid expressing the collagen tandem sequence and linearizing the recombinant plasmid to obtain a linearized plasmid; (3) electroporating the linearized plasmid into the host bacteria, screening and verifying to obtain high-copy recombinant engineered bacteria; (4) The high-copy recombinant engineered bacteria are fermented and induced to express, and then purified to obtain recombinant type VII collagen.

10. The preparation method according to claim 9, characterized in that In step (1), the recombinant type VII collagen contains a binding site for a whitening action site; the whitening action site includes one or more of MC1-R, MC4-R, GRM6, TRPM1 or MET.

11. The preparation method according to claim 10, characterized in that: The recombinant type VII collagen also comprises a binding site for one or more action sites of anti-aging, anti-wrinkle or soothing effects; The action sites of anti-aging, anti-wrinkle or soothing effects include one or more of TRPV1, IL1R1, and MT-CO2.

12. The preparation method according to claim 10 or 11, characterized in that The amino acid sequence of the recombinant type VII collagen is shown as SEQ ID No. 1 or SEQ ID No.

3.

13. The preparation method according to claim 9, wherein In step (1), the collagen tandem sequence comprises 8 to 10 basic unit recombinant type VII collagens; and there is a site for recognition and cleavage by Kex2 enzyme or Ste13 enzyme between two adjacent basic units.

14. The preparation method according to claim 13, wherein The recognition and cleavage sites include KR or RR dibasic amino acid residues, followed by EA, EAEA or other amino acid residues that facilitate cleavage by Kex2 enzyme or Ste13 enzyme.

15. The preparation method according to claim 9, wherein In step (1), the nucleic acid of the collagen tandem sequence includes a nucleotide sequence as shown in SEQ ID No. 6 or SEQ ID No. 8, or a degenerate sequence thereof.

16. The preparation method according to claim 9, characterized in that In step (2), the recombinant plasmid vector includes pPICZαB, pFLDα, and pPIC9K, and the connection site is between XhoI and NotI.

17. The preparation method according to claim 16, characterized in that The vector is pPIC9K.

18. The preparation method according to claim 9, characterized in that In step (3), the host bacteria includes one of Pichia pastoris, Saccharomyces cerevisiae, and Hansenula.

19. The preparation method according to claim 9, characterized in that In step (3), the recombinant engineered bacteria are deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with the deposit numbers of CGMCC No. 31991 and CGMCC No. 31992.

20. Recombinant type VII collagen prepared by the method according to any one of claims 9 to 19.

21. Use of the recombinant type VII collagen according to claim 1 or the recombinant type VII collagen prepared by the method according to any one of claims 9 to 19 in whitening, anti-aging, anti-wrinkle or soothing products.

22. A whitening, anti-aging, anti-wrinkle or soothing product, characterized in that: The product comprises the recombinant type VII collagen according to claim 1, or the type VII collagen encoded by the nucleic acid according to claim 2, or the recombinant vector according to claim 3, or the type VII collagen obtained by the method according to any one of claims 9 to 19.

Images