Foot-and-mouth disease virus plaque purification method and foot-and-mouth disease virus thereof

Abstract

The invention belongs to the field of virus purification, and particularly relates to a foot-and-mouth disease virus plaque purification method and a foot-and-mouth disease virus thereof. The high-quality foot-and-mouth disease virus is obtained by screening and purifying the foot-and-mouth disease virus through a specific 1 * cell culture medium, a 2 * cell culture medium, a cell maintenance medium and a culture solution which are prepared by the method and through a virus plaque purification technology. The seed virus screening and purifying method is low in cost, the problems that an existing seed virus screening method is high in cost, complex in operation and the like are solved, and high-quality foot and mouth disease viruses can be obtained through virus plaque purification. According to the method, the virus titer of the conventional foot-and-mouth disease virus seed virus is increased by more than 3 times, and the content of antigen 146S is increased by 40%.

Description

Technical Field

[0001] The invention belongs to the field of virus purification, and specifically relates to a method for purifying foot-and-mouth disease virus plaques and the foot-and-mouth disease virus. Background Art

[0002] Foot-and-Mouth Disease Virus (FMDV) is a small RNA virus belonging to the genus Foot-and-Mouth Disease Virus of the family MicroRNA Viridae. The virus mainly infects even-toed ungulates, such as cattle, pigs, sheep, etc., and can cause an acute, febrile, highly contagious disease, namely foot-and-mouth disease. Foot-and-mouth disease is characterized by rapid spread and high incidence, causing serious economic losses to animal husbandry production. Foot-and-mouth disease virus particles are spherical, without an envelope, and have an icosahedral symmetrical structure. Its genome is a single-stranded positive-strand RNA consisting of approximately 8,500 nucleotides. The virus particle is composed of four structural proteins: VP1, VP2, VP3, and VP4, of which the VP1 protein is the main antigenic site that induces the body to produce neutralizing antibodies.

[0003] In recent years, with the rapid development of modern biopharmaceutical technology, high-quality viral antigens, as an important basic substance, have been widely used in various fields of cell biology and medical research. At the same time, in order to achieve scale and industrialization, precisely control the production process, reduce production costs, facilitate upstream work, and improve the quality and safety of biological products, it is particularly important to continuously optimize viral plaque purification technology and optimize and select high-quality viral antigens as the basis for research.

[0004] Traditional vaccine antigens have many shortcomings during use: insufficient immunogenicity, safety issues, poor immune persistence, complex production process and high cost. It is precisely because of these shortcomings that it has become a major obstacle to optimizing the production level of biological products and achieving economic goals. Improving vaccine efficacy and antigen specificity, optimizing antigens aims to improve their specific recognition ability for target pathogens, ensure that the vaccine can accurately stimulate the body to produce an immune response against the pathogen, and reduce the side effects caused by non-specific reactions. Optimizing antigens through viral plaque purification technology, such as improving antigen immunogenicity and enhancing antigen specificity, can significantly improve vaccine efficacy.

[0005] How to develop a high-quality foot-and-mouth disease virus with high purity as an antigen has always been a problem. Summary of the invention

[0006] In order to solve the technical problems in the above-mentioned background technology, the present invention provides a method for purifying foot-and-mouth disease virus plaques and foot-and-mouth disease virus.

[0007] The technical solution adopted by the present invention is as follows:

[0008] The first aspect of the present invention provides a method for purifying foot-and-mouth disease virus plaques, comprising the following steps:

[0009] Step S1, preparing 1× cell culture medium, 2× cell culture medium, cell maintenance solution and culture solution, wherein:

[0010] The 1× cell culture medium includes MEM dry powder culture medium, L-glutamine, ultra-pure HEPES, NaHCO3, sodium pyruvate and the rest water;

[0011] The 2× cell culture medium includes MEM dry powder culture medium, L-glutamine, ultra-pure HEPES, NaHCO3, sodium pyruvate and the rest water;

[0012] The cell maintenance solution includes fetal bovine serum and the 1× cell culture medium;

[0013] The culture solution comprises the 2× cell culture medium, low melting point agarose and fetal bovine serum;

[0014] Step S2, taking cells inoculated with foot-and-mouth disease virus and washing them with the 1× cell culture medium described in step 1, then adding the culture solution described in step S1, and then picking plaques after culture;

[0015] Step S3, adding the cell maintenance solution in step S1 to the plaques in step S2, then mixing and freezing and thawing, then thawing and centrifuging, taking the supernatant to obtain the purified foot-and-mouth disease virus.

[0016] The beneficial effects of the present invention are: through the specific 1× cell culture medium, 2× cell culture medium, cell maintenance solution and culture solution configured by the present invention,

[0017] The foot-and-mouth disease virus is screened and purified by virus plaque purification technology, thereby obtaining high-quality foot-and-mouth disease virus. The seed virus screening and purification method of the present invention is not only low-cost, but also avoids the problems of high cost and complicated operation of the existing seed virus screening method, and can also obtain high-quality foot-and-mouth disease virus by virus plaque purification. The method increases the titer of conventional foot-and-mouth disease virus seed virus by more than 3 times, and increases the antigen 146S content by 40%.

[0018] Based on the above technical solution, the present invention can also be improved as follows.

[0019] Further, in step S1, the 1× cell culture medium includes 0.8-1.0 g of MEM dry powder culture medium, 0.02-0.03 g of L-glutamine, 0.45-0.50 g of ultra-pure HEPES, 0.05-0.10 g of NaHCO3, 0.010-0.015 g of sodium pyruvate, and 95 mL of water for injection, which is fully mixed, the pH is adjusted to 6.8, and the volume is fixed to 100 ml.

[0020] The beneficial effect of adopting the above further scheme is that the 1× cell culture medium in the determined dosage range of the present invention can effectively achieve the functions of washing and cell maintenance and stabilization, and effectively ensure the purification effect.

[0021] Further, in step S1, the 1× cell culture medium includes 0.8 g of MEM dry powder medium, 0.02 g of L-glutamine, 0.45 g of ultra-pure HEPES, 0.05 g of NaHCO3, 0.010 g of sodium pyruvate, and 95 mL of water for injection, which are fully mixed, the pH is adjusted to 6.8, and the volume is fixed to 100 ml.

[0022] The beneficial effect of adopting the above further scheme is that the determined amount of 1× cell culture medium can achieve a better purification effect.

[0023] Further, in step S1, the 2× cell culture medium includes 0.16-2.0 g of MEM dry powder culture medium, 0.04-0.06 g of L-glutamine, 0.90-1.00 g of ultra-pure HEPES, 0.10-0.10 g of NaHCO3, 0.020-0.030 g of sodium pyruvate, and 95 mL of water for injection, which are fully mixed, the pH is adjusted to 6.8, and the volume is fixed to 100 ml.

[0024] The beneficial effect of adopting the above further scheme is that the 2× cell culture medium in the determined dosage range of the present invention can effectively realize the formation of foot-and-mouth disease virus plaques, thereby ensuring the purification effect.

[0025] Further, in step S1, the 2× cell culture medium includes 0.16 g of MEM dry powder medium, 0.04 g of L-glutamine, 0.90 g of ultra-pure HEPES, 0.10 g of NaHCO3, 0.020 g of sodium pyruvate, and 95 mL of water for injection, which are fully mixed, the pH is adjusted to 6.8, and the volume is fixed to 100 ml.

[0026] The beneficial effect of adopting the above further scheme is that the determined amount of 2× cell culture medium can achieve a better purification effect.

[0027] Furthermore, in step S1, the volume ratio of the 2× cell culture medium, the low melting point agarose and the fetal bovine serum in the culture solution is 1:1:0.04.

[0028] The beneficial effect of adopting the above further scheme is that the specific culture medium of the present invention can allow the foot-and-mouth disease virus to grow plaques smoothly, achieve preliminary purification, and ensure the stability of the foot-and-mouth disease virus.

[0029] Furthermore, the cell maintenance medium includes 2% of the fetal bovine serum and 98% of the 1× cell culture medium.

[0030] The beneficial effect of adopting the above further scheme is that the specific cell maintenance solution of the present invention can effectively ensure the stability of plaques for further separation and purification.

[0031] Furthermore, in step S3, the freeze-thaw temperature is -80°C.

[0032] The beneficial effect of adopting the above further scheme is that the freezing and thawing temperature is conducive to storage and purification.

[0033] Further, steps S2 and S3 are repeated 2 to 3 times.

[0034] The beneficial effect of adopting the above further scheme is that foot-and-mouth disease virus with better purity can be obtained by repeating the purification steps.

[0035] The second aspect of the present invention provides a foot-and-mouth disease virus, which is prepared by the foot-and-mouth disease virus plaque purification method as described above.

[0036] The beneficial effects of the present invention are that the foot-and-mouth disease virus plaques obtained by the foot-and-mouth disease virus plaque purification method have high purity, simple operation and low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The figure is the gel electrophoresis diagram of the present invention; wherein, lane 1: Marker 2000; lane 3: positive control 1; lane 4: positive control 2; lane 5: O2023007; lane 6: O2023019; lane 7: O2023022; lane 8: O2023048.

[0038] Figure 2 The fluorescence quantitative PCR detection diagram of the present invention; wherein, 1: original virus control; 2: fluorescence quantitative PCR result of plaque number O2023007; 3: fluorescence quantitative PCR result of plaque number O2023019; 4: fluorescence quantitative PCR result of plaque number O2023022; 5: fluorescence quantitative PCR result of plaque number O2023048; 6: fluorescence quantitative PCR result of negative control

[0039] Figure 3 It is a graph of 146S antigen content of the plaque numbered O2023007 of the present invention;

[0040] Figure 4 It is a graph of 146S antigen content of the plaque numbered O2023019 of the present invention;

[0041] Figure 5 It is a graph of 146S antigen content of the plaque numbered O2023022 of the present invention;

[0042] Figure 6It is a graph of 146S antigen content of the plaque numbered O2023048 of the present invention;

[0043] Figure 7 It is a graph of 146S antigen content of the original virus control of the present invention. DETAILED DESCRIPTION

[0044] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0045] Virus plaque purification technology is mainly used in the following two aspects: First, scientific research: drug research and development, such as new drug screening, research and development of vaccines, genetic engineering drugs, cell engineering drugs, monoclonal antibody preparation, etc.; basic research such as drug action mechanism, gene function, disease mechanism, etc. Second, biopharmaceuticals: products produced using biotechnology such as viral vaccines (hepatitis virus vaccines, AIDS vaccines, etc.), peptide vaccines (tumor vaccines), EPO, antibody drugs, gene therapy drugs, some biologically active peptides in biological cells, biologically active substances, etc. have been widely used.

[0046] Unless otherwise defined, all terms used to disclose the present invention, including technical and scientific terms, have the meanings as commonly understood by one of ordinary skill in the art to which the present invention belongs. By way of further guidance, term definitions are included to better understand the teachings of the present invention.

[0047] All references cited in this specification are hereby deemed to be incorporated by reference in their entirety.

[0048] As used herein, the following terms have the following meanings:

[0049] Unless the context clearly dictates otherwise, as used herein, "a / an," and "the" refer to both singular and plural referents. By way of example, "a compartment" means one or more than one compartment.

[0050] As used herein, "comprise", "comprising", "comprises" and "comprised of" are synonymous with "including", "includes" or "contain", "containing", "contains", and are inclusive or open-ended terms that specify the presence of the following matters (e.g., components) and do not exclude or inhibit the presence of additional unrecited components, features, elements, components, steps known in the art or disclosed herein.

[0051] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within that range as well as the recited endpoints.

[0052] Unless defined otherwise, the expressions "weight percent", "wt%" or "weight %" here and throughout the specification refer to the relative weight of the respective component based on the total weight of the formulation.

[0053] Herein, sec represents the time unit "second", min represents the time unit "minute", and ~13,400×g represents approximately 13,400 times the gravitational acceleration.

[0054] Example 1: Preparation of test reagents

[0055] Preparation of 1× cell culture medium: MEM dry powder medium 0.8g, L-glutamine 0.02g, extra pure HEPES 0.45g, NaHCO3 0.05g, sodium pyruvate 0.010g, 95mL water for injection, mix thoroughly, adjust pH to 6.8, and make up to 100ml.

[0056] Preparation of 2× cell culture medium: MEM dry powder medium 0.16g, L-glutamine 0.04g, extra pure HEPES 0.90g, NaHCO3 0.10g, sodium pyruvate 0.020g, 95mL water for injection, mix thoroughly, adjust pH to 6.8, and make up to 100ml.

[0057] Preparation of low melting point agar: Weigh 4 g of low melting point agarose, dissolve it in 100 ml of water for injection, sterilize it at 121°C for 15 minutes, and store it at room temperature. The shelf life is 1 month.

[0058] Preparation of cell growth medium: 10% fetal bovine serum + 90% 1× cell culture medium, stored at room temperature.

[0059] Preparation of cell maintenance medium: 2% fetal bovine serum + 98% 1× cell culture medium, stored at room temperature.

[0060] Example 2: Purification and acquisition of foot-and-mouth disease virus plaques

[0061] 1. Preparation of Monolayer Cells in Six-well Plates

[0062] 1.1 BHK-21 cells (Jinhai Biotechnology production cells) were cultured in square flasks. When the monolayer of cells was full, trypsin (Hyclone Trypsin, SH30042.02) was added for digestion three times. The first two times, 10 ml was used for rinsing and discarded. The third time, 2 ml was used for trypsin digestion for about 1 to 2 minutes, and the cell digestion was observed.

[0063] 1.2 After the cells are loosened, tap the square bottle gently with your hands to make the cells detach from the bottle wall, add 8 ml of cell growth medium to resuspend the cells, use a pipette to blow and disperse the cells, use a pipette to take samples, dilute the cells 10 times and count them with a counting plate, and adjust the cell density to 1.5-2.0×10 5 cells / ml, add 2 ml of cell solution to each well using a pipette.

[0064] 1.3 Place the 6-well plate in a 37°C 5% CO2 constant temperature incubator and culture for 20 hours.

[0065] 2. Sample Dilution

[0066] 2.1 In a biosafety cabinet, take 9 sterile 1.5 ml centrifuge tubes and add 0.9 ml of the 1× cell culture medium in Example 1 to each tube. Arrange them in order on a centrifuge tube rack. Cover the centrifuge tubes and mark the dilution multiples on the lids. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 and blank control C.

[0067] 2.2 Mix the sample virus (Yangling Jinhai Biotechnology Co., Ltd.) on a vortex mixer for 8 seconds.

[0068] 2.3 Pipette 0.1ml of virus stock solution and add 10 -1 1.5 ml centrifuge tube, vortex mixer for 8 seconds, from 10 -1 Take 0.1ml and add 10 -2 Mix on a vortex mixer for 8 seconds, and continue mixing until the dilution ratio reaches 10. -8 , C was reserved as blank control solution.

[0069] 2.4 The dilution factor can be changed according to the virus titer.

[0070] 3. Drug

[0071] 3.1 Take the 6-well plate with cultured cells, discard the original culture medium, and add 1 ml of 1× cell culture medium in Example 1 to each well for two washes. When washing, be sure to add liquid quickly to prevent the cells from drying out.

[0072] 3.2 After discarding the liquid, use a 1000 μl pipette to quickly add 500 μl of the diluted venom (the dilution ratio can be determined according to the virus titer, and the blank control is added with 500 μl of the 1× cell culture medium in Example 1).

[0073] 3.3 Shake gently and place in a 37℃ 5% CO2 constant temperature incubator for 1 hour. Shake the 6-well plate once every 15 minutes during the incubation process.

[0074] 4. Preparation of Culture Medium

[0075] 4.1 The low melting point agarose in Example 1 was heated in a microwave oven to melt, and then placed in a water bath at 56°C to keep warm.

[0076] 4.2 Take the 2× cell culture medium in Example 1, the low melting point agarose in step 4.1 and fetal bovine serum (Gibco, A5256701) at a ratio of 1:1:0.04 and mix them evenly to obtain a culture medium.

[0077] 5. Addition of culture medium

[0078] 5.1 In a biosafety cabinet, discard the virus solution in the 6-well plate and wash it once with the 1× cell culture medium in Example 1.

[0079] 5.2 Use a 10 ml pipette to add 1.5 ml of the culture medium from step 4.2 to each well. Be careful to avoid bubbles when adding.

[0080] 5.3 Place the 6-well plate with culture medium in a 2-8℃ freezer to cool for a few minutes. After the culture medium solidifies, seal the 6-well plate with sealing film and invert it in a CO2 incubator for culture.

[0081] 6. Plaque Picking and Purification

[0082] 6.1 After 12 hours of culture, start observing the growth of plaques. When a single independent plaque is generated, pick it.

[0083] 6.2 Take sterile 1.5 ml centrifuge tubes in a biosafety cabinet. The number depends on the number of plaques and they are clearly labeled. Add 1 ml of the cell maintenance solution in Example 1 to each centrifuge tube for later use.

[0084] 6.3 Use a pipette tip to pick up a single independent plaque and add the picked virus into a 1.5 ml centrifuge tube containing the cell maintenance medium in Example 1.

[0085] 6.4 After the spot picking is completed, mix the centrifuge tube on a vortex mixer for 8 seconds and freeze and thaw once in a -80℃ refrigerator.

[0086] 6.5 After thawing, centrifuge at 2000 rpm for 10 minutes.

[0087] 6.6 In a biosafety cabinet, collect the supernatant, label it, and store it at -80°C to obtain the purified foot-and-mouth disease virus.

[0088] 7. Repeat purification

[0089] The above operation is repeated 2 to 3 times to obtain the obtained virus solution, and a further purified foot-and-mouth disease virus sample can be obtained.

[0090] Example 3: Virus purity verification of purified foot-and-mouth disease virus

[0091] 1. Virus Culture and TCID 50 Determination of

[0092] The OHM / 02 strain virus purified by plaque in Example 2 was propagated on well-growing BHK-21 cells. When the virus CPE reached 90%, the virus was harvested and the virus TCID 50 TCID of purified virus monoclonal 50 The test results are shown in Table 1 below. The virus titer increased by at least 0.6 titers, and the purification effect was significantly improved.

[0093]

[0094]

[0095] 2. Viral RNA Extraction and cDNA Synthesis

[0096] 2.1. RNA extraction (using TIANGEN RNAsimple total RNA extraction kit (DP419)):

[0097] a. Sample processing: Add the virus supernatant of the OHM / 02 strain virus purified by plaque in Example 2 into a test tube, add 1 ml of lysis solution RZ (kit) to each tube, and place at room temperature for 5 minutes to completely separate the nucleic acid-protein complex;

[0098] b. Add 200 μl of chloroform, cover the tube, shake vigorously for 15 seconds, and leave at room temperature for 3 minutes;

[0099] c. Centrifuge at 12,000 rpm (~13,400 × g) at 4°C for 10 min, transfer the aqueous phase to a new tube, and proceed to the next step;

[0100] d. Slowly add 0.5 times the volume of anhydrous ethanol and mix well. Transfer the obtained solution and precipitate into the adsorption column, centrifuge at 4℃12000rpm (~13,400×g) for 30 seconds, and discard the waste liquid in the collection tube;

[0101] f. Add 500 μl of deproteinized solution (containing ethanol) to the adsorption column, centrifuge at 12,000 rpm at 4°C for 30 seconds, discard the waste liquid, and place the adsorption column in a collection tube;

[0102] g. Repeat step f;

[0103] h. Place the adsorption column into a 2 ml collection tube and centrifuge at 12000 rpm for 2 min at 4°C to remove the residual liquid;

[0104] i. Transfer the adsorption column into a new 1.5 ml centrifuge tube, add 50 μl RNase-Free ddH2O, leave at room temperature for 2 min, and centrifuge at 12,000 rpm at 4°C for 2 min.

[0105] 2.2 Reverse transcription

[0106] a. First-strand cDNA synthesis, using an externally purchased kit ( Reverse Transcriptase [M-MLV, RNaseH-]) was synthesized, and the synthesis components are shown in Table 2:

[0107]

[0108] b. Mix gently, incubate at 25°C for 5 min, and then incubate at 42°C for 30 min to obtain the cDNA template.

[0109] 3. Fluorescence quantitative PCR detection

[0110] a. Fluorescence quantitative PCR primers and probes are shown in Table 3 below

[0111]

[0112] b. Fluorescence quantitative PCR reaction system is as shown in Table 4

[0113]

[0114]

[0115] c. Fluorescence quantitative PCR reaction procedure is as shown in Table 5

[0116]

[0117] The results of fluorescence quantitative PCR analysis were as follows Figure 2 As shown, after fluorescence quantitative PCR analysis, the original virus control result showed FMDV positive, the negative control result was FMDV negative, and the screened 4 virus plaques (O2023007, O2023019, O2023022, O2023048) were all FMDV positive.

[0118] 4. PCR amplification and VP1 sequencing

[0119] a. The universal primer sequences for PCR reaction are shown in Table 6

[0120]

[0121] b. PCR reaction system is as shown in Table 7:

[0122]

[0123]

[0124] c. PCR reaction procedure is as shown in Table 8:

[0125]

[0126] The four virus plaques (O2023007, O2023019, O2023022, and O2023048) screened out were detected by gel electrophoresis according to the above PCR amplification results, and the following results were obtained: Figure 1 As shown, the results showed that the target band was amplified.

[0127] The above PCR products were sent to Qingke Biotechnology for sequencing, and the VP1 sequencing results of O2023007, O2023019, O2023022, and O2023048 strains were compared with the VP1 sequence of the original seed virus. The results showed that the VP1 base sequence of O2023007, O2023019, O2023022, and O2023048 strains was 100% consistent with the VP1 base sequence of the original seed virus, indicating that the strains after plaque purification had not mutated.

[0128] OHM / 02 strain VP1 base sequence:

[0129] ACCACCTCCACGGGTGAGTCGGCTGACCCCGTAACTGCCACTGTTGAGAACTACGGTGGTGAGACACAGGTCCAGAGACGCCAACACACAGATGTCTCGTTTATATTAGACAGATTTGTGAAAGTAACACCAAAAGACCAAACTAATGTGTTGGACCTG ATGCAAACCCCTGCACACACTTTGGTAGGTGCGCTCCTCCGTACTGCCACCTACTACTTCGCAGATCTAGAAGTGGCAGTGAAACACGAGGGAAACCTTACCTGGGTCCCGAATGGGGCGCCTGAGACAGCGTTGGATAACACCACCAACCCAACGGCTT ACCACAAGGCACCGCTCACCCGGCTTGCACTGCCCTACACGGCACCACACCGTGTCTTGGCTACTGTTTACAACGGGGACTGCAAGTACGGCGGGAGCCCCGTGACCAATGTGAGAGGTGACCTGCAAGTATTGGCCCAGAAGGCGGCGAGAACGCTGCC TACCTCCTTCAATTACGGTGCCATCAAAGCCACTCGGGTGACTGAACTGCTCTACCGCATGAAGAGGGCCGAAACATACTGCCCTCGGCCTCTTTTGGCCATTCACCCAAGTGAAGCTAGACACAAACAAAAGATTGTGGCGCCTGTGAAACAGCTTCTG

[0130] Example 4: Detection of 146S content of plaque-purified virus by HPLC

[0131] 4.1 Sample pretreatment

[0132] Add 7 ml of chloroform to 7 ml of sample (adjust the sample amount as needed, the volume ratio of sample to chloroform is 1:1), and shake vigorously for more than 5 minutes. Centrifuge: 4°C, 5000 rpm, centrifuge for 10 minutes. Collect the supernatant into a new centrifuge tube, add an equal amount of chloroform, repeat the above operation, collect the supernatant after the second centrifugation, and set aside.

[0133] 4.2 Nuclease digestion

[0134] Thaw high-concentration standard and low-concentration standard, vortex nuclease for 1 minute. Take 1 ml of each standard and pre-treated sample, add 20 μl nuclease (1.25 U / ml, 25 U per sample). Digest at 37°C, 1400 rpm, constant temperature shaking for 60 minutes. Centrifuge at 4°C, 13200 rpm for 10 minutes. Transfer 900 μl of supernatant to HPLC vial. Use a needle to pierce the rubber stopper 2-3 times to prevent the vial from generating vacuum after cooling.

[0135] 4.3 Chromatographic analysis

[0136] Chromatographic column: special chromatographic column; mobile phase: GPC1; injection volume: 100 μl for both standard and sample; flow rate: 0.5 ml / min; maximum system pressure: 40 bar; wavelength: 254 nm; retention time: 15-16 minutes; cycle time (sample detection time): 50 minutes.

[0137] 4.4. Observation results:

[0138] Observe the sample chromatograms, including the chromatogram of the standard, to see if there are deviations in the peak shape and retention time, whether the nuclease digestion is thorough, and whether there are any abnormal peaks that intersect with the 146S peak.

[0139] 4.5 Calculation results

[0140] Content = (area × 10 × 1.02) / (120 × 72 × sample amount)

[0141] The test results are as follows Figures 3 to 7 As shown, after calculation, the 146S content is as shown in Table 9:

[0142]

[0143]

[0144] Therefore, according to Table 9, the plaque purification method of the present invention greatly improves the purity of the foot-and-mouth disease virus. The method increases the titer of the conventional foot-and-mouth disease virus seed virus by more than 3 times and increases the antigen 146S content by more than 40%.

[0145] In the description of this specification, the description of the terms "one embodiment", "some embodiments", "specific embodiments", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0146] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for purifying foot-and-mouth disease virus plaques, characterized in that: The steps include: Step S1, preparing 1× cell culture medium, 2× cell culture medium, cell maintenance solution and culture solution, wherein: The 1× cell culture medium includes MEM dry powder culture medium, L-glutamine, ultra-pure HEPES, NaHCO3, sodium pyruvate and the rest water; The 2× cell culture medium includes MEM dry powder culture medium, L-glutamine, ultra-pure HEPES, NaHCO3, sodium pyruvate and the rest water; The cell maintenance solution includes fetal bovine serum and the 1× cell culture medium; The culture solution comprises the 2× cell culture medium, low melting point agarose and fetal bovine serum; Step S2, taking cells inoculated with foot-and-mouth disease virus and washing them with the 1× cell culture medium described in step 1, then adding the culture solution described in step S1, and then picking plaques after culture; Step S3, adding the cell maintenance solution in step S1 to the plaque in step S2, then mixing and freezing and thawing, then thawing and centrifuging, taking the supernatant to obtain the purified foot-and-mouth disease virus.

2. The method for purifying foot-and-mouth disease virus plaques according to claim 1, characterized in that: In step S1, the 1× cell culture medium includes 0.8-1.0 g of MEM dry powder culture medium, 0.02-0.03 g of L-glutamine, 0.45-0.50 g of ultra-pure HEPES, 0.05-0.10 g of NaHCO3, and 0.010-0.015 g of sodium pyruvate, which is fully mixed with 95 mL of water for injection, the pH is adjusted to 6.8, and the volume is fixed to 100 ml.

3. The method for purifying foot-and-mouth disease virus plaques according to claim 2, characterized in that: In step S1, the 1× cell culture medium includes 0.8 g of MEM dry powder medium, 0.02 g of L-glutamine, 0.45 g of ultra-pure HEPES, 0.05 g of NaHCO3, and 0.010 g of sodium pyruvate, which is fully mixed with 95 mL of water for injection, the pH is adjusted to 6.8, and the volume is fixed to 100 ml.

4. The method for purifying foot-and-mouth disease virus plaques according to claim 1, characterized in that: In step S1, the 2× cell culture medium includes MEM dry powder medium 0.16-2.0 g, L-glutamine 0.04-0.06 g, ultra-pure HEPES 0.90-1.00 g, NaHCO3 0.10-0.10 g, sodium pyruvate 0.020-0.030 g, 95 mL of injection water, fully mixed, adjusted to pH 6.8, and fixed to 100 ml.

5. The method for purifying foot-and-mouth disease virus plaques according to claim 4, characterized in that: In step S1, the 2× cell culture medium includes 0.16 g of MEM dry powder medium, 0.04 g of L-glutamine, 0.90 g of ultra-pure HEPES, 0.10 g of NaHCO3, 0.020 g of sodium pyruvate, and 95 mL of water for injection, which are fully mixed, the pH is adjusted to 6.8, and the volume is fixed to 100 ml.

6. The method for purifying foot-and-mouth disease virus plaques according to claim 1, characterized in that: In step S1, the volume ratio of the 2× cell culture medium, the low melting point agarose and the fetal bovine serum in the culture solution is 1:1:0.

04.

7. The method for purifying foot-and-mouth disease virus plaques according to any one of claims 1 to 6, characterized in that: In step S1, the cell maintenance medium includes 2% of the fetal bovine serum and 98% of the 1× cell culture medium.

8. The method for purifying foot-and-mouth disease virus plaques according to any one of claims 1 to 6, characterized in that: In step S3, the freeze-thaw temperature is -80°C.

9. The method for purifying foot-and-mouth disease virus plaques according to any one of claims 1 to 6, characterized in that: Steps S2 and S3 are repeated 2 to 3 times.

10. A foot-and-mouth disease virus, characterized in that The method for purifying foot-and-mouth disease virus plaques according to any one of claims 1 to 9 is used for preparation.

Images