Construction method and application of recombinant Singaslope grouper iridovirus with miR-122 target gene SGIV163 deletion

Abstract

The invention discloses a construction method and an application of a recombinant Singaslope grouper iridovirus with miR-122 target gene SGIV163 deletion. Specifically, the invention discloses a recombinant virus vector plasmid 163-SGIV, and the recombinant virus vector plasmid 163-SGIV is obtained by recombining an SGIV162L-EGFP-ICP18pro moter-SGIV1L combined gene to a pDsRed-C1 vector, so that the recombinant virus vector plasmid 163-SGIV is obtained. The 163-SGIV is transfected to healthy grouper spleen cells, and the 163-SGIV is mixed with Singapore grouper iridovirus liquid for incubation to obtain the 163-SGIV recombinant virus. According to the invention, the effect of miRNA on a direct target of Singapore grouper iridovirus is researched for the first time, and the effect of miR-122 in the SGIV virus pathogenesis can be more directly understood by constructing a recombinant virus with SGIV163 gene deletion.

Description

Technical Field

[0001] The present invention relates to the fields of biochemistry and molecular biology, and in particular to a construction method and application of a recombinant Singapore grouper iridovirus lacking a miR-122 target gene SGIV163. Background Art

[0002] Grouper is an important and valuable economic marine aquaculture fish in the southern coastal areas of China and Southeast Asian countries. It is highly sought after by consumers because of its delicious meat and rich nutritional value. However, intensive farming and lack of management methods have led to frequent diseases of grouper, which not only caused serious losses to the industry, but also seriously restricted the sustainable development of grouper farming. Singapore grouper iridovirus (SGIV) is a highly pathogenic iridovirus isolated from the spleen of sick grouper in Singapore by Qin et al. in 2003. The main symptoms of sick fish are hemorrhage and enlargement of the spleen, and the mortality rate of grouper within one week of infection is higher than 90%. Since the virus is highly infectious and has a very high mortality rate, it is urgent to find an efficient prevention and treatment method.

[0003] The existing aquatic animal DNA virus vector systems all have defects to varying degrees, which are mainly manifested in the complicated construction steps, long time consumption or low efficiency. Some of them introduce unnecessary exogenous sequences into the recombinant virus, which has brought different degrees of impact to the subsequent research. Traditionally, the construction of aquatic animal DNA viruses is mainly constructed by using homologous recombination method in combination with effective gradient screening method, or using lactose operon to restrict the expression of a certain viral gene, thereby reducing the expression of the viral gene to achieve the effect of recombinant virus. However, the construction of homologous recombination method in combination with effective gradient screening method often introduces an exogenous drug resistance gene, and the drug resistance gene is used for screening. The homologous recombination vector construction is cumbersome, and the effective gradient screening method is inefficient. Although the lactose operon has an inhibitory effect on the expression of specific viral genes, the inhibitory effect is not particularly significant. In addition, in recent years, new biological characteristics of different aquatic DNA viruses have been continuously discovered. Therefore, there is a great demand in this field for a more convenient and efficient construction process and a method for constructing aquatic DNA recombinant viruses with high efficiency and flexibility.

[0004] MicroRNAs (miRNAs) are a class of small non-coding RNAs of about 18-25 nucleotides in length. They participate in gene expression regulation after transcription by complementary binding to target gene sequences. At present, the effect of miRNA on the function of SGIV virus only exists in the verification of the body, and the mechanism of how miRNA directly acts on SGIV is still unclear. It is reported that miR-122 can promote the replication of SGIV virus in vitro and inhibit SGIV-induced cell apoptosis in vitro. MiR-122 can also inhibit the expression of inflammatory factors in the body when SGIV infects the body. However, the mechanism of how miR-122 directly acts on SGIV is still unclear. Summary of the invention

[0005] The first object of the present invention is to provide a Singapore grouper iridovirus SGIV163 gene, the nucleotide sequence of which is shown in SEQ ID NO.5.

[0006] The second object of the present invention is to provide an application of SGIV163 gene deletion in reducing the replication ability of Singapore grouper iridovirus.

[0007] The third object of the present invention is to provide an application of SGIV163 gene deletion in inhibiting grouper miR-122 to enhance the expression of SGIV virus protein MCP.

[0008] The fourth object of the present invention is to provide a recombinant viral vector plasmid for inducing SGIV163 gene deletion, which includes an SGIV viral gene fragment SGIV162L, a green fluorescent protein gene EGFP, an SGIV viral ICP18 promoter and an SGIV viral gene fragment SGIV1, the nucleotide sequence of the SGIV162L is shown in SEQ ID NO.1, the nucleotide sequence of the EGFP is shown in SEQ ID NO.2, the nucleotide sequence of the ICP18 promoter is shown in SEQ ID NO.3, and the nucleotide sequence of the SGIV1 is shown in SEQ ID NO.4.

[0009] Preferably, the nucleotide sequences shown in SEQ ID NO. 1-4 are sequentially inserted into the pDsRed2-C1 vector.

[0010] The fifth object of the present invention is to provide a method for constructing a recombinant Singapore grouper iridovirus lacking the miR-122 target gene SGIV163, which comprises the following steps: transfecting the above-mentioned recombinant viral vector plasmid into GS or FHM cells, mixing and incubating with the Singapore grouper iridovirus liquid, and collecting cells with green fluorescence to obtain the recombinant Singapore grouper iridovirus lacking SGIV163.

[0011] Preferably, the specific steps are as follows:

[0012] (1) Design primers as shown in Table 1:

[0013] Table 1 Primer sequences

[0014]

[0015] (2) Obtaining amplification template:

[0016] The template for viral gene amplification comes from cells infected with SGIV. Total RNA is extracted from cells infected with the virus, and then the cDNA obtained by reverse transcription of the extracted and purified RNA is used as a template. The green fluorescent gene template comes from plasmid pE GFP-C1.

[0017] (3) Target gene amplification and double enzyme digestion:

[0018] The primers in step (1) and the template in step (2) are subjected to polymerase chain reaction amplification and purification to obtain an amplified product; the obtained recombinant gene and pDsRed2-C1 are then double-digested with endonucleases XhoI and BamHI, and the digested fragments are recovered and purified;

[0019] (4) Recombinant fragment ligation and transformation:

[0020] Use T4 DNA ligase to connect the digested fragments, and finally transform the connected fragments into competent E. coli cells; resuscitate the competent E. coli cells containing the recombinant fragments in a shaking incubator at 37°C for 1 hour, then centrifuge the bacterial solution and evenly spread it on LB medium containing kanamycin resistance using a coating rod;

[0021] (5) Plasmid identification and extraction:

[0022] Positive clones were picked on the kanamycin selection medium, and the positive clones were detected by polymerase amplification reaction. The plasmids of the positive clones that were successfully detected were extracted to obtain the △SGIV163 recombinant virus vector plasmids;

[0023] (6) Recombinant virus screening:

[0024] The recombinant plasmid was transfected into healthy grouper spleen cells using the transfection reagent Lipofectamine 2000 liposome, and then the cells were screened using G418 resistance. The screened cells were infected with wild-type SGIV, and the green fluorescence expression was observed 3 days after infection, and the progeny viruses were collected to obtain the recombinant Singapore grouper iridovirus with SGIV163 deletion.

[0025] The sixth object of the present invention is to provide a recombinant Singapore grouper iridovirus obtained by the above-mentioned construction method.

[0026] The seventh object of the present invention is to provide the use of the above-mentioned recombinant Singapore grouper iridovirus in studying the mechanism of action of miR-122 on Singapore grouper iridovirus.

[0027] The eighth objective of the present invention is to provide the use of the above-mentioned recombinant Singapore grouper iridovirus in antiviral immunity of Singapore grouper.

[0028] Advantages of the present invention:

[0029] In the present invention, we found that there is a target sequence of miR-122 on the SGIV virus, and named the sequence SGIV163. By constructing a recombinant virus △163-SGIV with a missing SGIV163 gene, it will help to more intuitively understand the role of miR-122 in the pathogenesis of the SGIV virus.

[0030] The present invention constructs the △163-SGIV recombinant virus of the spleen cells of the coiform grouper, mediates the low expression of the viral gene SGIV163, and provides a good experimental basis and basis for studying the direct effects of miR-122 on the Singaporean grouper iridovirus, including virus infection, invasion and replication. In addition, the pDsRed2-C1 vector, pEGFP vector, pcDNA-3.1-3HA vector, pmiR-RB-Report vector, DNA polymerase, DNA ligase, nucleic acid extraction kit, and restriction endonuclease and other reagents used in this experiment are easy to purchase, simple to operate, and short in time. The efficiency of recombinant knockdown of the target gene is high, and the recombinant virus is stable. In addition, the present invention is the first to explore the role of miRNA in the direct target of the Singaporean grouper iridovirus, which can provide a reference for future in-depth research. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the map of the pDsRed2-C1 overexpression vector.

[0032] Figure 2 This is the sequence structure diagram of the recombinant △163-SGIV.

[0033] Figure 3 This is the fluorescence display result of spleen cells of Epinephelus coioides after infection with the recombinant virus △163-SGIV overexpressing the △SGIV163 vector.

[0034] Figure 4 These are the relative expression results of the viral gene MCP of the SGIV163 gene in spleen cells of healthy Epinephelus coioides infected with wild-type SGIV (wt-SGIV) and recombinant virus △163-SGIV.

[0035] Figure 5 These are the results of Western blot detection of the protein of the viral gene MCP after the spleen cells of healthy Epinephelus coioides were infected with wild-type SGIV (wt-SGIV) and recombinant virus △163-SGIV.

[0036] Figure 6 These are the viral titer results after healthy Epinephelus coito spleen cells were infected with wild-type SGIV (wt-SGIV) and recombinant virus △163-SGIV.

[0037] Figure 7 This is the prediction result diagram of miR-122 targeting SGIV163.

[0038] Figure 8 The relative expression level of SGIV163 in spleen cells of healthy Epinephelus coioides after co-transfection of miR-122 mimics and SGIV163 overexpression vector.

[0039] Fig. 9 This is a graph showing the results of dual luciferase activity detection after healthy Epinephelus coioides spleen cells were co-transfected with miR-122 mimics and fluorescent vectors carrying the SGIV163 wild-type target gene sequence or mutant target sequence.

[0040] Fig.10 These are the relative mRNA expression results of the viral gene MCP in spleen cells of healthy Epinephelus coioides transfected with miR-122 and then infected with wild-type SGIV (wt-SGIV) and recombinant virus △163-SGIV.

[0041] Fig.11 These are the results of Western blot detection of the viral gene MCP protein in spleen cells of healthy Epinephelus coioides transfected with miR-122 and then infected with wild-type SGIV (wt-SGIV) and recombinant virus △163-SGIV. DETAILED DESCRIPTION

[0042] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0043] Example:

[0044] 1. Construction and identification of the recombinant viral vector plasmid pDsRed-C1-△163-SGIV

[0045] 1. Amplification of target fragment

[0046] The △163-SGIV recombinant virus vector plasmid consists of four parts, namely the SGIV virus gene fragment SGIV162L (SEQ ID NO.1), the green fluorescent protein gene EGFP (SEQ ID NO.2), the SGIV virus ICP18 promoter (SEQ ID NO.3) and the SGIV virus gene fragment SGIV1 (SEQ ID NO.4). The structure is shown in the figure Figure 2 Primers (Table 1) were designed to amplify the above four gene fragments. The templates were derived from cells infected with SGIV. Total RNA was extracted from virus-infected cells, and then the cDNA obtained by reverse transcription of the extracted and purified RNA was used as a template. The green fluorescent gene template was derived from plasmid pEGFP-C1.

[0047] The amplification system and procedures are as follows:

[0048] system: 100μL PrimeSTARHS(Premix) 50μL <![CDATA[ddH2O]]> 38μL Forward / Rewardprime 4μL each Vector plasmid / cDNA template 4μL

[0049]

[0050] 2. Rubber recovery and purification

[0051] Refer to the Omega Gel Recovery Kit ( Gel Extraction Kit) for gel recovery and purification, catalog number D2500010000L20W094, the specific steps are as follows:

[0052] (1) After DNA electrophoresis, use a clean blade to cut out the corresponding fragments under ultraviolet light and place them in a 1.5 mL centrifuge tube.

[0053] (2) Add 400 μL Binding Buffer to the centrifuge tube and heat in a 60°C water bath for 5-10 min until the gel is completely dissolved.

[0054] (3) Add the gel liquid into a centrifuge column with a cannula, centrifuge at 10,000 × g for 1 min, and discard the waste liquid.

[0055] (4) Add 700 μL DNA Wash Buffer to the centrifuge column and centrifuge at 13,400 × g for 1 min. Discard the waste liquid.

[0056] (5) Repeat step (4).

[0057] (6) Transfer the centrifuge column to a new sleeve, centrifuge at 13,400 × g for 2 min, discard the waste liquid, and then transfer the centrifuge column to a new 1.5 mL centrifuge tube. Open the centrifuge column lid and let it stand at room temperature for 2 min.

[0058] (7) Add 30 μL of 65°C preheated nuclease-free ddH2O to the centrifuge column, let stand at room temperature for 2 min, and then centrifuge at 13,400 × g for 1 min. Collect the liquid and measure the nucleic acid concentration on a Nanodrop 1000 spectrophotometer.

[0059] 3. Enzyme digestion of target gene and vector plasmid

[0060] BamHI and XhoI were used as insertion sites, and the pDsRed2-C1 vector ( Figure 1 ) and the recombinant fragment gene were double-digested with endonucleases BamHI and XhoI, and the digestion system was as follows:

[0061] 10×Buffer 2μL B H 1μL HindIII 1μL Target gene / vector plasmid 1 μg <![CDATA[ddH2O]]> Up to 20 μL

[0062] 20 μL system, constant temperature at 37°C for 15 min.

[0063] 4. Recycling of enzyme-digested fragments

[0064] Refer to Omega DNA purification and recovery kit ( Cycle-Pure Kit) to recover DNA fragments, catalog number D6492010000L18W096, the specific steps are as follows:

[0065] (1) Transfer the digested product to a 1.5 mL centrifuge tube, add 5 times the volume of CP Buffer, vortex the liquid to mix well, transfer it to a centrifuge column, centrifuge at 10,000 × g for 1 min, and discard the waste liquid.

[0066] (2) Add 700 μL SPW Wash Buffer to the centrifuge column and centrifuge at 13,400 × g for 1 min. Discard the waste liquid.

[0067] (3) Repeat step (2).

[0068] (4) Transfer the centrifuge column to a new sleeve, centrifuge at 13,400 × g for 2 min, discard the waste liquid, and then transfer the centrifuge column to a new 1.5 mL centrifuge tube. Open the centrifuge column lid and let it stand at room temperature for 2 min.

[0069] (5) Add 30 μL of 65°C preheated nucleic acid-free ddH2O to the centrifuge column, let stand at room temperature for 2 min, and then centrifuge at 13,400 × g for 1 min. Collect the liquid and measure the nucleic acid concentration on a Nanodrop spectrophotometer.

[0070] 5. Connect the recombinant fragments recovered by enzyme digestion in step 4 with the vector plasmid at 16°C overnight. The reaction system is:

[0071] 20μL system: Recombinant fragments after enzyme digestion 400ng Vector plasmid after enzyme digestion 100ng 10×T4 DNA Ligase Buffer 2μL T4 DNA ligase 1μL <![CDATA[ddH2O]]> Up to 20 μL

[0072] 6. Transformation and Identification

[0073] (1) Take 100 μL of DH5α E. coli competent cells and thaw them on ice for 5-10 min.

[0074] (2) Immediately after thawing, add 10 μL of the ligation product from step 5 to the competent cells, mix gently, and incubate on ice for 30 min.

[0075] (3) Place the competent cells in a 42°C water bath for 90 seconds and then immediately place on ice for 2-3 minutes.

[0076] (4) Add 900 μL of resistance-free LB medium to the competent cells and activate them in a shaking incubator at 37°C for 1 h.

[0077] (5) Centrifuge the activated bacterial solution at 6,500 rpm for 5 min, discard the supernatant until about 100 μL is left, resuspend the precipitate with a pipette, mix well, and apply an appropriate amount of the resuspended bacterial solution evenly on a kanamycin-resistant (0.05 ng / mL) LB medium plate. Place the plate in an incubator at 37°C and incubate overnight.

[0078] (6) Add 1 mL of LB liquid culture medium containing 100 μg / mL kanamycin to a 1.5 mL centrifuge tube. Use a pipette tip to pick up the monoclonal clone cultured on the plate and inoculate it into the culture medium in the centrifuge tube in an ultra-clean workbench. Incubate at 37°C and 200 rpm for 6 h.

[0079] (7) The bacterial solution was subjected to PCR identification. The PCR product of the recombinant sequence was about 1800 bp. The positive clone bacterial solution was sequenced. The primers used for positive clone identification in this experiment were universal primers of the vector pDsRed2-C1 (F: CGCAAATGGGCGGTAGGCGTG; R: GAAATTTGTGATGCTATTGC).

[0080] 2. Extraction of recombinant viral plasmid pDsRed-C1-△163-SGIV

[0081] 1. Take 2 mL of the recombinant plasmid bacterial solution in the logarithmic growth phase and add it to 200 mL of liquid LB medium containing 100 μg / mL kanamycin, and culture it in a 37°C shaking incubator overnight.

[0082] 2. Divide the bacterial solution evenly into 50mL centrifuge tubes, centrifuge at 5,000×g for 10 min, and discard the supernatant.

[0083] 3. Plasmid Extraction

[0084] Refer to Omega plasmid extraction kit ( Endo-free Plasmid Mini Kit II) instructions, product number D6950020000F13W022, the specific steps are as follows:

[0085] (1) Add 1 mL of Solution I to the bacterial pellet at the bottom of a 50 mL centrifuge tube. Use a pipette to fully resuspend the bacterial pellet. Then transfer 500 μL of the resuspended bacterial solution to a 2 mL centrifuge tube.

[0086] (2) Add 500 μL of Solution II, invert the tube several times, and let it stand at room temperature for 2 min.

[0087] (3) Add 250 μL N3 Buffer, invert the tube several times until the white flocs are fully separated, and centrifuge at 13,400 × g for 10 min.

[0088] (4) Transfer the supernatant to a 1.5 mL centrifuge tube, add 100 μL of ETR Solution, turn the centrifuge tube upside down and place it on ice for 5 min, then place it in a 42°C water bath for 5 min. When the solution becomes clear, centrifuge at 13,400 × g for 3 min.

[0089] (5) Transfer the supernatant to a 2 mL centrifuge tube containing 2 times the volume of anhydrous ethanol as the supernatant. Invert the centrifuge tube several times and let it stand at room temperature for 2 min. Transfer the supernatant to a centrifuge column with a sleeve and centrifuge at 10,000 × g for 1 min. Discard the waste liquid.

[0090] (6) Transfer the remaining liquid in the 2 mL centrifuge tube to a centrifuge column and centrifuge at 10,000 × g for 1 min. Discard the waste liquid.

[0091] (7) Add 500 μL HBC Buffer, centrifuge at 10,000 × g for 1 min, and discard the waste liquid.

[0092] (8) Add 700 μL DNA Wash Buffer to the centrifuge column, centrifuge at 13,400 × g for 1 min, and discard the waste liquid.

[0093] (9) Repeat step (8).

[0094] (10) Transfer the spin column to a new cartridge and centrifuge at 13,400 × g for 3 min. Discard the waste liquid.

[0095] (11) Transfer the centrifuge column to a 1.5 mL centrifuge tube, open the centrifuge column lid and let it stand at room temperature for 3 min. Add 100 μL of 65°C preheated nuclease-free ddH2O to the centrifuge column, let it stand at room temperature for 5 min, centrifuge at 13,400 × g for 2 min, collect the liquid, measure the concentration of the plasmid on a spectrophotometer, and verify the plasmid extraction by gel electrophoresis.

[0096] III. Packaging, virus collection and amplification of recombinant △163-SGIV virus vector

[0097] 1. Cell Culture

[0098] Cells were cultured using L15 medium supplemented with 10% fetal bovine serum (FBS, Invitrogen). 2 The GS or FHM cells in the culture flask were digested into single cells with 0.25% trypsin digestion solution, transferred into a 24-well cell culture plate, and cultured in a 25°C incubator for about 18-20 hours. The cells were observed under a microscope and the cells were grown to about 90% of the monolayer (about 2х10 5 ) to start transfection.

[0099] 2. Cell Transfection

[0100] To transfect 800 ng of plasmid into each well of a 24-well plate, 2 μL of the transfection reagent Lipofectamine 2000 is required. The transfection steps are as follows:

[0101] (1) Take two sterile 1.5 mL centrifuge tubes, add 50 μL of serum-free Opti-MEM medium to each tube, then add 2 μL of Lipofectamine 2000 and 800 ng of the target plasmid to each tube, mix gently with a pipette, and let stand at room temperature for 5 min;

[0102] (2) Mix the two solutions above, flick to mix, and let stand at room temperature for 25 min;

[0103] (3) Carefully remove the culture medium from the wells of the culture plate, add 300 μL of culture medium to wash once, remove the wash solution, and then add 400 μL of serum-free L15 medium to each well;

[0104] (4) Add the mixture of the above plasmid and Lipofectamine 2000 into the wells of the culture plate and gently shake back and forth to mix;

[0105] (5) Place the cells in a 28°C incubator and culture for 6 h. Then remove the culture medium and add 500 μL of L15 culture medium containing 10% fetal bovine serum. Continue to culture for 12 h. Then carefully remove the culture medium and add 500 μL of L15 culture medium containing 500 μg / mL G418 resistance. Continue to culture for 12 h. Figure 3 As shown, at this time, most of the cells can be seen emitting red fluorescence under a fluorescence microscope.

[0106] 3. Obtaining recombinant virus

[0107] GS cells were infected with wt-SGIV at MOI = 0.1 for 2 h. The pDsRed-C1-△163-SGIV recombinant plasmid was then transfected into the cells (see step 2) to overexpress the △163-SGIV recombinant gene for 24 h. The wt-SGIV virus at MOI = 1 was added to L15 medium with 500 μg / mL G418 resistance and 10% FBS (wt-SGIV virus titer was 10 ^6.5 500μL wells add 5 microliters), turn it upside down until the virus is fully mixed in the culture medium. Use a pipette to gently aspirate the culture medium of the 24-well plate transfected cells in step 2, and add the culture medium and virus mixture to the 24-well plate. Figure 3 As shown, green fluorescence stimulated by the recombinant virus in the cells can be seen under a fluorescence microscope 3 days after infection. The virus solution was fully collected with a pipette, and then placed at -80°C and repeatedly frozen and thawed for at least 3 times, centrifuged at 1,000×g for 2 minutes, and the supernatant was taken for use, which was regarded as the first generation of recombinant virus (Passage 1, P1) P1-△163-SGIV. Next, P1-△163-SGIV was used to infect healthy GS cells cultured in 24-well plates for 2 hours, and then the pDsRed-C1-△163-SGIV recombinant plasmid was transfected into the cells (see step 2), so that the △163-SGIV recombinant gene was overexpressed for 24 hours, and the original culture medium was discarded. P1-△163-SGIV was mixed with a medium containing serum and G418 resistance, and the mixed medium was added to the cells in the 24-well plate. The fluorescence was observed again after 3 days of infection, and the virus solution and cells were collected, placed in -80℃ and repeatedly frozen and thawed 3 times, centrifuged at 1000×g for 2 minutes, and the supernatant was taken to obtain P2-△163-SGIV. This process was repeated until P10-△163-SGIV was screened, thereby obtaining a relatively pure recombinant virus.

[0108] IV. Application

[0109] 1. Real-time fluorescence quantitative PCR detection of SGIV163 gene recombination efficiency in cells

[0110] The wt-SGIV (control group) and the recombinant virus △163-SGIV (experimental group) were used to infect healthy grouper spleen cells, and the infected cells were collected at 12h, 24h, 48h, and 72h after infection. The total RNA of the infected cells was extracted and reversely transcribed into cDNA, and then the cDNA was used as a template for real-time fluorescence quantitative PCR to detect the expression of the SGIV163 gene. The fluorescence quantitative PCR system was prepared according to SYBR fluorescence quantitative enzyme (TOYOBO) (Table 2). The reaction program was: 95℃, 1min; 95℃, 15s; 60℃, 15s; 72℃, 45s; 95℃, 15; 60℃, 15s; 72℃, 45s for 45 cycles, the primers were F: GCTATGGAGCGAATACAA; R: GCACCCTGGAGGCGTTAT, and the internal reference gene was β-actin.

[0111] Table 2 qPCR reaction system

[0112]

[0113]

[0114] One-way ANOVA was performed using Prism 7 statistical software. Figure 4 As shown (* in the figure indicates that the difference is statistically significant), compared with the healthy grouper cells infected with wt-SGIV, the expression level of SGIV163 in the spleen cells of the grouper infected with △163-SGIV was significantly lower than that in the group infected with wt-SGIV at 12h, 24h, 48h, and 72h, and the expression level of SGIV163 was reduced by more than 50 times compared with the control group after 72h of infection, indicating that the recombination efficiency of △163-SGIV was significant (P<0.05).

[0115] 2. Western Blot and virus titer experiments to detect the difference in virus replication between recombinant virus △163-SGIV and wt-SGIV

[0116] (1) The healthy grouper spleen cells were infected with wt-SGIV (control group) and recombinant virus △163-SGIV (experimental group), respectively. The infected cells were collected 24 hours after infection, and protein lysis buffer was added to lyse the cell proteins. Then, the expression of SGIV major capsid protein (MCP) in the samples was detected by Western Blot, and finally, the protein grayscale analysis was performed using ImageJ software. Figure 5 As shown, compared with the control group, the protein expression level of SGIV-MCP in the experimental group was significantly reduced, indicating that the replication ability of the recombinant virus △163-SGIV was significantly reduced.

[0117] (2) wt-SGIV (control group) and recombinant virus △163-SGIV (experimental group) were used to infect healthy grouper spleen cells, and the infected cell suspensions were collected at 12h, 24h, 48h, and 72h after infection. The cell suspension was placed at -80℃ and repeatedly frozen and thawed three times to completely release the virus particles, and then the virus titer (TCID 50 ) experiment. Figure 6 As shown in the figure ("*" in the figure indicates that the difference is statistically significant), compared with the control group, the virus titer of the experimental group was significantly lower than that of the control group, indicating that the virulence of the recombinant virus △163-SGIV was significantly reduced (P<0.05).

[0118] 3. Dual luciferase activity verifies that miR-122 targets the SGIV163 gene

[0119] Sangon Biotech (Shanghai) Co., Ltd. synthesized miR-122 mimics (miR-122), miR-122 mimics control (miR-con), miR-122 inhibitors (in-122) and miR-122 inhibitor control (in-con), with the catalog number R12438. Among them, the miR-122 mimic is a double-stranded RNA, including a sequence consistent with the mature sequence of miR-122, and a sequence complementary to the mature sequence of miRNA. The miR-122 inhibitor is a single-stranded RNA, which is a chemically synthesized complementary single strand of mature miR-122 designed with methoxyl modification. miR-con and in-con are negative controls for miR-122 mimics and miR-122 inhibitors, respectively. The mature sequence of miR-122 and the synthetic sequences of miR-122 are shown in Table 3.

[0120] Table 3 miR-122 related sequences

[0121]

[0122] like Figure 7As shown, the miRNA target site prediction website (https: / / bibiserv.cebitec.uni-bielefeld.de / rnahybrid / ) shows that there is a target site for miR-122 in the SGIV163 gene. In order to verify the target relationship between miR-122 and SGIV163, the SGIV163 gene (SEQ ID NO.5) was cloned into the overexpression vector pcDNA-3.1-3HA (with restriction sites of EcoRI and KpnI), and healthy grouper spleen cells were co-transfected with miR-122 mimics or inhibitors and the pcDNA-3.1-3HA overexpression vector of SGIV163. After 24 hours of transfection, cell samples were collected for real-time fluorescence quantitative PCR to detect the expression level of SGIV163 (the detection method is the same as step four-1). The results are shown in Figure 8 As shown, after co-transfection of miR-122 mimics and SGIV163 overexpression vector, miR-122 can significantly increase the expression of SGIV163 gene (P<0.05). Conversely, after co-transfection of miR-122 inhibitor and SGIV163 overexpression vector, the miR-122 inhibitor can significantly inhibit the expression of SGIV163 gene (P<0.05), which indicates that there is an interaction between miR-122 and SGIV163.

[0123] The restriction sites NotI and XhoI were inserted, and the wild-type and mutant target sequences of SGIV163 (wild-type: 5'AACCATGGACATGGAGACGCTCTC3'; mutant: 5'ATGGTAGGACATGGAGTGTGAGGC3') were cloned into the luciferase vector pmiR-RB-Report. The recombinant vector was co-transfected with miR-122 mimics (miR-122) and miR-122 mimics control (miR-con) into healthy grouper spleen cells. After 24 hours of transfection, the cells were collected and lysed to detect their luciferase activity. The results are shown in Fig. 9 As shown in the figure ("*" indicates statistically significant difference), in cells transfected with SGIV163 wild-type target sequence vector, the luciferase activity of the recombinant vector co-transfected with miR-122 was significantly increased compared with the co-transfected with miR-con group (P<0.05), while in cells transfected with SGIV163 mutant vector, there was no significant difference in luciferase activity when the recombinant vector was co-transfected with miR-122 or miR-con, indicating that the target sequence mutant SGIV163 cannot bind to miR-122 and SGIV163 is a direct target of miR-122.

[0124] 4. Effect of miR-122 on viral replication of wt-SGIV and △163-SGIV

[0125] In order to study the effect of miR-122 on the replication of wt-SGIV and △163-SGIV viruses, miR-122 and miR-con were transfected into the spleen cells of healthy grouper for 24 hours, and then infected with wt-SGIV and △163-SGIV respectively. Samples were collected 24 hours and 48 hours after infection, and the mRNA expression of SGIV-MCP gene was detected by real-time fluorescence quantitative PCR experiment (the method is the same as above). Fig.10 As shown in the figure (*: indicates statistically significant difference), in wt-SGIV infected cells, especially 24h after infection, compared with the miR-con transfection group, the miR-122 transfection group can significantly increase the mRNA level expression of the viral gene MCP of wt-SGIV (P<0.05), but in cells infected with △163-SGIV, the difference in the expression of MCP between the miR-122 and miR-con groups is not obvious, that is, the mRNA expression of MCP generated by the mutant △163-SGIV is no longer affected by miR-122. Cell samples were collected 24h after virus infection for Western Blot experiments to detect the expression of SGIV viral protein MCP, as shown in Figure 2. Fig.11 As shown, in wt-SGIV infected cells, transfection of miR-122 group can significantly increase the expression of viral protein MCP of wt-SGIV, but in △163-SGIV infected cells, transfection of miR-122 has no significant effect on the expression of viral protein MCP generated by them, indicating that the recombinant virus △163-SGIV lacks the target site of miR-122, and the effect of miR-122 on it is not obvious.

[0126] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

[0127] SEQ ID NO.1 (ORF162L)

[0128] AGCTGTGGTCATTCCACGTGGCTCTCAGGCATTTGACGAAAGCTCTCTTGAAGCTTCCGGGAGCTGCAGACCAAGATGATTTTGAAATGTCAAACTTTTTATTTGAGCAAATCATCCATTTGTCATCGTGATAAAACACGTTGACGACAGCTCCTTCAACAGCTGGATACACCAAACAGTCTTTGAGCGCGAGTTCTTTGGGAATCGTCTCGCGCACCAAAGGGTGTGGCAAGCTGCGAAAGATGACGTTCTTTCCGCAGTGTACGAGTCCGCGAACTGCCGGATACCGTTCCACGGCGTCGGCAGACGCGCAAGACATTGTGAGATTTTCTCGCTTGTCTGTGACGAAAGCCATTTTTAAATCTTCCACAAGGGCGATTTTTGTTCCGAGTTTGCGCAAACTCGCTAATCAAGTTTTTTTACACGATATTTTAACCTTTTAAAAGGTTAAAATATCGGAAATGCTCAATTATATTAACTTTTGCAATTTGGACACTGCCAATTGGTGATAGTCTTTSEQ IDNO.2(EGFP)

[0129] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGC CACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAASEQ ID NO.3(ICP18-promoter)

[0130] AAAATCGGAATTTGTTTTTACGTTATCTTCCGTTACCAGAAACGTAAACACTACCAA ACACCCCC

[0131] SEQ ID NO.4(ORF1L)

[0132] GCGCTCTGTTCATTTTTTCTTCAACGGTCACCAGCACCTAACGCGCCACAAGCTCGACACGTTTGAAGGTTCCACCGAGTACAGCGTCGTTTCGATCGCCTTTTTGTTAGCTGCTGCTAACTGCAACATATTTTGGTTAAAACCGGGAAGAACGCCAATTTCTTTCGTAGCCACGAAAACGGTGTGTTTTTTGCCGCAGGACGGAAACTCTTCCGGCCAAATTAGTTTTGCAGCGGGAAACTCTTGTTCAAACATTTTACGAAACGGTTTCCCATTTTTGGGCAATAAGATTGCCCATTCGTGAGGGTCCTTTTCCATGAGCGCGTGCAGTGTGGCGACGTATTTGGATTTGTATTCGGGATTCGCAAATTCTTCAGACACGCGCTGTTGAAGATACGGGTGGATAACACGATCGTTCATCACGAGTTTGGCGTAGCAGAAATGCGGAAAGTATGCCGCGTACGGATTGTTGATGTCCATGTCGGCGATGGCCTCTTCCSEQ ID NO.5 (SGIV163 sequence)

[0133] TTAAACGGTATAATACTCGAGCCAATCTCTGTACTTTATCATTTCGTACTCGCTGTATATTTTGTTGGCTTCCATTTCTGCAAAATCGTACTCTTTCATTTTGAAGAGTACGATGGGAATGCATTGGTCTGTGAGTTTTTCGCACAAATCCAGTTCTTCTTGGTACTCTGAAAGATTCCCTATAGCAATCAAGACCACGTCTGGTAAGGCGTAATTTGGGAGCTCGAGAATCTCTGCGTACGTGCGTACGAGCACGGTTTCTCCGAGTTTGCTGACCGCGTAGTCTTTTTGCGTCTCTGTTTGTACGACTACTACGGCGCAGTCTCGGTCGCGCTCGGCTCTGATTTTGATTGCCGAGAGCAACGAAGATGTCCATTCGGTTCCAAATTCTTGGGTCAGATCGTGTTTGTACTCTGGGCACCAGCGATAAATGCACTCCCTGTAATCGTCAAAAGTGTTGTCAGTCACTGCCATTTCTTCAACGGACTTGGCGGACAGCATGGGAATGGTGTCAGAGTTTTCTTGCATCATCATTTTGACGTAAGCAACATCTGGCCAAAACAGAGACTCTTCTGGAATCTCTCTGCGTTCTCGTACGTTCAAGTAGCATCTGTATTCGCCTGTGAAAACCGCAAATAGGAAACGTTCGCTGGCGCGTGTTTCGTACTCGACGATTTCCGAGACAGACCTGTTGAGCGAGATTACGGGATTGAACGTGGCACGACATTTGCGAGTTTCTATTTTCAGGTTTGTGAACGTTCTTCCCATATAGTACGTCAGTTCCATAAAGTACGTAGAGTTTACGTACCACCAGAGAGAGCACCCTGGAGGCGTTATAAATCTCTTGGAGAGCGTCTCCATGTCCATGGTTTCAATCCACACGAATGACACTGGAAGAGCTGCGGTGTTGATGTTTTGCAACTCTTCGACAGTGTACGCATATTTGTATTCGCTCCATAGCATGTAGCGACGAGCGTCGTTGGTTACAATCAGACACTTGTCGCGTTCGCGAGGAAAGATTTCAGCTTTTAATAACACAAACAGGTCTGCGTCATACTTGTAGCTGAGAATTCCCCCTTTGGGGTGTTTCTTCATCCTGGAGATCAACCATTCTCTCGAAAGCATTTTGTAACACGTATTTGTTCGTGTTGGCGATTTGGCGCTTTTTTTGCACAT

Claims

1. A Singapore grouper iridovirus SGIV163 gene, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

5.

2. Application of SGIV163 gene deletion in reducing the replication ability of Singapore grouper iridovirus.

3. Application of SGIV163 gene deletion in inhibiting grouper miR-122 and enhancing the expression of SGIV viral protein MCP.

4. A recombinant viral vector plasmid for inducing SGIV163 gene deletion, characterized in that: It includes the SGIV virus gene fragment SGIV162L, the green fluorescent protein gene EGFP, the SGIV virus ICP18 promoter and the SGIV virus gene fragment SGIV1, the nucleotide sequence of the SGIV162L is shown in SEQ ID NO.1, the nucleotide sequence of the EGFP is shown in SEQ ID NO.2, the nucleotide sequence of the ICP18 promoter is shown in SEQ ID NO.3, and the nucleotide sequence of the SGIV1 is shown in SEQ ID NO.

4.

5. The recombinant viral vector plasmid according to claim 4, characterized in that: The nucleotide sequences shown in SEQ ID NO.1-4 are sequentially connected and inserted into the pDsRed2-C1 vector.

6. A method for constructing a recombinant Singapore grouper iridovirus lacking the miR-122 target gene SGIV163, characterized in that: The method comprises the following steps: transfecting GS or FHM cells with the recombinant viral vector plasmid described in claim 4 or 5, mixing and incubating with Singapore grouper iridovirus solution, and collecting cells with green fluorescence to obtain recombinant Singapore grouper iridovirus with SGIV163 deletion.

7. The construction method according to claim 6, characterized in that The build process is simple and quick, the steps are summarized as follows: (1) Design primers; (2) obtaining an amplification template; (3) Target gene amplification and double enzyme digestion; (4) Recombinant fragment ligation and transformation; (5) Plasmid identification and extraction; (6) Screening of recombinant viruses.

8. The recombinant Singapore grouper iridovirus obtained by the construction method according to any one of claims 6-7.

9. Use of the recombinant Singapore grouper iridovirus according to claim 8 in studying the mechanism of action of miR-122 on Singapore grouper iridovirus.

10. Use of the recombinant Singapore grouper iridovirus according to claim 8 in antiviral immunity of Singapore grouper.

Images