Recombinant vector containing human astrovirus nucleic acid fragment and application thereof

Abstract

The invention discloses a recombinant vector containing a human astrovirus nucleic acid fragment, which is obtained by inserting an exogenous nucleotide sequence into a prokaryotic expression vector skeleton, and the exogenous nucleotide sequence is formed by sequentially connecting the following gene sequences: an SUMO fusion tag DNA sequence, an SAP gene sequence, an MS2 phage related DNA sequence and a human astrovirus sequence fragment. The tail end of the prepared human astrovirus pseudovirus particle contains a stem-loop structure, so that the human astrovirus pseudovirus particle is not easily degraded by nuclease, and the stability of virus nucleic acid RNA (Ribonucleic Acid) is improved; meanwhile, a human astrovirus conservative RNA gene sequence is wrapped by the phage MS2 coat protein, so that the phage MS2 coat protein has relatively high ribonuclease and deoxyribonuclease resistance, and the long-term stability of virus nucleic acid RNA is enhanced. And the stability problem of the virus RNA quality control product in the production and use processes is solved.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering, and specifically relates to a recombinant vector containing a human astrovirus nucleic acid fragment and an application thereof. Background Art

[0002] Human Astrovirus (HAstV) is a non-enveloped single-stranded positive-strand RNA virus and one of the common foodborne viruses that cause acute gastroenteritis worldwide. Since the virus was first discovered in fecal samples of children with gastroenteritis using electron microscopy in 1975, it has been detected in mammals (cats, cattle, etc.) and poultry (chickens, pigeons, etc.). These results show that HAstV has high diversity and zoonotic characteristics. At present, HAstV is mainly divided into classical HAstV (HAstV-1 to 8) and new HAstV (HAstV-MLB, HAstV-VA / HMO), among which HAstV-1 is the main prevalent strain of HAstV worldwide. HAstV is recognized worldwide as one of the important causes of gastroenteritis, second only to norovirus and rotavirus; it mainly infects children, the elderly and immunocompromised patients. Gastroenteritis caused by HAstV is usually self-limiting, with clinical symptoms such as diarrhea, vomiting, and fever. In addition, the virus can spread to the central nervous system and become a potential pathogen causing encephalitis. Despite the huge socioeconomic waste caused by HAstV epidemics, there is still no approved vaccine or antiviral drug.

[0003] HAstV is mainly transmitted through the "fecal-oral" route, through ingestion of contaminated water or food, close contact with patients, contact with contaminated surfaces, etc. HAstV in water sources mainly comes from virus particles excreted from the bodies of infected people. These virus particles are excreted from the body and enter the urban sewage system, resulting in a higher HAstV positive detection rate in sewage. The main reasons for food contamination by HAstV are contact with contaminated water sources during growth or contamination by infected people during production. Aquatic products (such as shellfish), fruits, vegetables, etc. are most likely to carry HAstV.

[0004] HAstV detection is a key technology in the fields of clinical diagnosis, import and export ports, and food hygiene inspection. Due to the lack of knowledge about the growth and reproduction process of all HAstV in the body, there is no universal cell model. At present, the real-time fluorescence quantitative PCR detection method is the main detection method for HAstV molecular detection; this method has the advantages of high sensitivity, strong specificity, and rapid detection process. It is especially widely used in the field of food detection with low contamination virus content and high potential transmission importance.

[0005] Based on the methods for detecting HAstV at home and abroad, most of them use HAstV positive samples, HAstV RNA nucleic acid samples and HAstV positive plasmids as HAstV quality control products. However, these HAstV quality control products have many shortcomings: (1) The virus content varies greatly between different HAstV positive samples, which cannot be used to evaluate the sensitivity of the detection method and the test results of different laboratories may vary greatly; (2) HAstV positive samples may pose a great biosafety hazard and may easily infect experimental operators and cause large-scale transmission; (3) Viral RNA samples are not easy to preserve, which will lead to deviations in the test results; (4) Although the chemical synthesis method can improve the stability of RNA positive control, the cost of this technology is relatively high and it is not suitable for widespread promotion and use; (5) Positive plasmids are easy to prepare and purify, but because plasmids are closed-loop double-stranded DNA, they can only be used as PCR controls and cannot be used to monitor the entire process of viral RNA extraction and reverse transcription.

[0006] Artificial preparation of pseudovirus particles is to clone specific gene fragments into expression vectors containing phage genes, and produce RNA fragments wrapped by phage capsid proteins by inducing expression. This RNA quality control product preparation technology is also called armored RNA technology. The E. coli expression system is often used as a recombinant vector to express recombinant proteins. Since this system often forms insoluble and non-functional inclusion bodies when overexpressing exogenous proteins, the recombinant proteins have no biological activity. At present, it has been found that adding fusion tags to recombinant vectors can promote the correct folding of exogenous recombinant proteins and improve the solubility of recombinant proteins, such as maltose binding protein MBP, glutathione S-transferase GST, thioredoxin Trx and small molecule ubiquitin-like modifier protein SUMO. Among them, SUMO tag protein is a fusion tag with a powerful solubility-promoting function, which can greatly improve the stability and solubility of proteins, is resistant to heat and external proteases, and has a small molecular weight and will not affect the function of recombinant proteins. Therefore, SUMO tag proteins are increasingly favored by scientific researchers.

[0007] SAP protein is a kind of protein composed of hydrophilic and hydrophobic amino acids. When it is fused to the N-terminus of recombinant proteins, it can significantly improve the transcription and translation efficiency of proteins, thereby increasing the expression of proteins. The structure formed based on SAP protein can protect proteins from interference from the external environment, reduce protein degradation and denaturation, and thus prolong the half-life. At present, there is no report on the application of SAP protein to the construction of pseudovirus particles. Linker will connect two or more proteins in the recombinant protein without affecting their independent spatial structure and function. Among them, the flexible linker can effectively separate the different parts of the recombinant protein through its flexibility and stretchability, avoiding mutual interference during the folding process, thereby ensuring that each domain can form its natural conformation and exert the best biological activity. F-Linker is a common flexible linker sequence [(GGGGS)2]. The small size of these amino acids provides flexibility and enables the connected protein functional domains to have a certain mobility, achieving the proper separation of protein functional domains or maintaining the necessary inter-domain interactions. PT-Linker is a special amino acid sequence composed of proline and threonine. PT-Linker has a certain flexibility, which allows the connected proteins or domains to move freely in space to perform their respective functions; it can also improve the expression and stability of recombinant proteins and reduce problems such as misfolding, low yield or impaired biological activity of recombinant proteins due to direct fusion. Summary of the invention

[0008] The purpose of the present invention is to overcome at least one deficiency of the prior art and provide a recombinant vector containing a human astrovirus nucleic acid fragment and its application.

[0009] The technical solution adopted by the present invention is:

[0010] In a first aspect, the present invention provides a recombinant vector containing a human astrovirus nucleic acid fragment, which is obtained by inserting an exogenous nucleotide sequence into a prokaryotic expression vector backbone, wherein the exogenous nucleotide sequence is formed by sequentially connecting the following gene sequences: a SUMO fusion tag DNA sequence, a SAP gene sequence, an MS2 phage-related DNA sequence, and a human astrovirus sequence fragment.

[0011] In some examples, the human astrovirus sequence fragment is followed by a stem-loop structure DNA sequence.

[0012] In some examples, the human astrovirus sequence fragments include at least two human astrovirus nucleic acid fragments, and the human astrovirus nucleic acid fragments are connected by a flexible F-Linker DNA sequence.

[0013] In some examples, the flexible F-Linker DNA sequence is shown as SEQ ID No.3.

[0014] In some examples, the SAP gene sequence and the MS2 phage-related DNA sequence are connected using a flexible PT-Linker DNA sequence.

[0015] In some examples, the flexible PT-Linker DNA sequence is shown as SEQ ID No.6.

[0016] In some examples, the nucleic acid segment of human astrovirus is a conserved region of human astrovirus, and the cDNA segment corresponding to the nucleic acid segment of human astrovirus is shown as SEQ ID No.1.

[0017] In some examples, the MS2 phage-related DNA sequence contains a gene sequence encoding a mature enzyme protein, a lytic protein gene sequence, a coat protein gene sequence and a replicase protein gene sequence, and the MS2 phage-related DNA sequence is shown as SEQ ID No.2.

[0018] In some examples, the SUMO fusion tag DNA sequence is shown as SEQ ID No.4, and the SAP gene sequence is shown as SEQ ID No.5.

[0019] In some examples, the stem-loop structure DNA sequence is shown as SEQ ID No.7.

[0020] In some examples, the prokaryotic expression vector is pET-32a(+), and the exogenous nucleotide sequence is inserted into the prokaryotic expression vector pET-32a(+).

[0021] The above features can be combined arbitrarily unless they conflict with each other.

[0022] In a second aspect, the present invention provides a target for detecting human astrovirus, which is obtained by transcribing and translating the recombinant vector described in the first aspect in a cell, and then isolating and purifying it.

[0023] The beneficial effects of the present invention are:

[0024] (1) Universality: The human astrovirus pseudovirus particles prepared by the present invention have nucleic acid sequences containing conserved genes of epidemic strains of human astrovirus, and thus the human astrovirus pseudovirus particles can be used as positive quality control products for detecting human astrovirus.

[0025] (2) Stability: The human astrovirus RNA gene sequence in the pseudovirus particles prepared by the present invention contains a stem-loop structure at the end, which is not easily degraded by nucleases, thereby improving the stability of the viral nucleic acid RNA; at the same time, the conserved RNA gene sequence of the human astrovirus is encapsulated by the bacteriophage MS2 capsid protein, which has a high resistance to ribonucleases and deoxyribonucleases, thereby enhancing the long-term stability of the viral nucleic acid RNA. This solves the stability problem of viral RNA quality control products during production and use.

[0026] (3) High concentration: In order to obtain high-concentration, soluble human astrovirus pseudoviral particles, the present invention inserts a SUMO tag sequence and a SAP gene sequence into a recombinant vector, thereby promoting the production of high-concentration and soluble human astrovirus pseudoviral particles; and the prepared pseudoviral particles contain a human astrovirus dimer conserved nucleic acid fragment, which serves as a target for detecting human astrovirus, so that the human astrovirus pseudoviral particles contain more human astrovirus target nucleic acid sequences for detecting human astrovirus.

[0027] (4) Simulation: The RNA-protein complex structure of human astrovirus pseudovirus particles is similar to that of natural viruses. Pseudovirus particles can be equated with viral materials and can be used as a quality control tool for the entire process of human astrovirus detection to ensure the authenticity of the detected virus.

[0028] (5) Safety: Human astrovirus pseudovirus particles have a virus-like shell and encapsulate viral nucleic acid. They are not contagious and have no self-replication ability. Therefore, human astrovirus pseudovirus particles are non-infectious and will not cause harm to experimenters or pollute the environment.

[0029] (6) Easy purification: The prepared human astrovirus pseudovirus is expressed in E. coli BL21 cells and can be quickly released into the supernatant after E. coli BL21 cells are lysed, which can improve the purification efficiency of pseudovirus particles. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is a schematic diagram of the composition of the recombinant plasmid pET-32a(+)-SSP-MS2-HAstV in a specific implementation manner.

[0031] Figure 2 It is a schematic diagram of the composition of the recombinant plasmid pET-32a(+)-MS2-HAstV in a specific implementation manner.

[0032] Figure 3The expression product of the recombinant plasmid in E.coli BL21 cells was analyzed by SDS-PAGE. M: Protein Marker; 1: pET-32a(+)-MS2-HAstV recombinant bacteria without inducer; 2: pET-32a(+)-MS2-HAstV recombinant bacteria after induction; 3: pET-32a(+)-MS2-HAstV recombinant bacteria after preliminary purification; M: Protein Marker; 4: pET-32a(+)-SSP-MS2-HAstV recombinant bacteria without inducer; 5: pET-32a(+)-SSP-MS2-HAstV recombinant bacteria after induction; 6: pET-32a(+)-SSP-MS2-HAstV recombinant bacteria after preliminary purification.

[0033] Figure 4 This is a picture of human astrovirus pseudovirion particles observed by transmission electron microscopy.

[0034] Figure 5 The results of RNase and DNase resistance of human astrovirus pseudovirus are shown in the figure, where M: DNALadder2000; 1: RT-PCR amplification results of pseudovirus particles without human astrovirus nucleic acid fragments after DNase treatment; 2: PCR amplification results of human astrovirus pseudovirus particles after DNase treatment; 3: RT-PCR amplification results of pseudovirus particles after DNase treatment; 4: RT-PCR amplification results of pseudovirus particles without human astrovirus nucleic acid fragments after RNase treatment; 5: RT-PCR amplification results of pseudovirus particles after 10 μL RNase treatment; 6: RT-PCR amplification results of pseudovirus particles after 20 μL RNase treatment.

[0035] Figure 6 Schematic diagram of the amplification curve of real-time fluorescence RT-PCR detection of human astrovirus pseudovirion particles. DETAILED DESCRIPTION

[0036] The following disclosure provides many different embodiments or examples for implementing different solutions of the present invention.

[0037] Example 1: Construction of recombinant plasmid pET-32a(+)-SSP-MS2-HAstV

[0038] 1. Construction of recombinant plasmid pET-32a(+)-MS2

[0039] 1.1. Design of primers for RT-PCR amplification of MS2 phage-related genes

[0040] According to the genome sequence of MS2 bacteriophage (purchased from American Type Culture Collection ATCC 15597-B1) encoding the mature enzyme protein gene sequence, the lytic protein gene sequence, the coat protein gene sequence and the replicase protein gene sequence as shown in SEQ ID No. 2, RT-PCR amplification primers were designed, namely, the upstream primer MS2 F: GGATATCGGGTGGGACCCCTT (the underline indicates the introduced restriction site EcoR V), as shown in SEQ ID No. 8 in the sequence listing, and the downstream primer MS2 R: CGCGGATCCAGTAAGCAATTGCTGTA (the underline indicates the introduced restriction site BamH I), as shown in SEQ ID No. 9 in the sequence listing.

[0041] 1.2. Construction of recombinant plasmid pET-32a(+)-MS2

[0042] The TRIzol method was used to extract the whole genome RNA of MS2 phage, and the MS2 phage related genes were amplified by RT-PCR, as shown in the sequence table SEQ ID No. 2. The MS2 phage related gene products amplified by RT-PCR and the prokaryotic expression vector pET-32a (+) were digested with restriction endonucleases EcoR V and BamH I (both preserved in this laboratory), and the double enzyme digestion reaction system is shown in Table 1.

[0043] Table 1 Double enzyme digestion reaction system

[0044]

[0045] Incubate at 37°C for 2 h; recover the double-digested products and connect them using T4 DNA Ligase ligase kit. The reaction system is shown in Table 2.

[0046] Table 2 DNA enzyme ligation reaction system

[0047]

[0048] The ligation was carried out at 16°C for 30 min. The ligation product was then transformed into E. coli DH5α competent cells, plated, and a single colony was picked and sequenced for identification. The correct recombinant plasmid was named pET-32a(+)-MS2.

[0049] 2. Construction of recombinant plasmid pET-32a(+)-SSP-MS2

[0050] 2.1. Construction of recombinant plasmid pET-32a(+)-S-MS2

[0051] The synthetic SUMO fusion tag DNA sequence is shown in the sequence table SEQ ID No. 4. The synthetic SUMO fusion tag DNA sequence and the pET-32a(+)-MS2 recombinant plasmid were digested with BgIII and KpnI (both preserved in this laboratory), respectively. The double enzyme digestion reaction system is shown in Table 3.

[0052] Table 3 Double enzyme digestion reaction system

[0053]

[0054] Incubate at 37°C for 2 h; recover the double-digested products and connect them using T4 DNA Ligase ligase kit. The reaction system is shown in Table 4.

[0055] Table 4 DNA enzyme ligation reaction system

[0056]

[0057] The ligation was carried out at 16°C for 30 min. The ligation product was then transformed into E. coli DH5α competent cells, plated, and a single colony was picked and sequenced for identification. The correct recombinant plasmid was named pET-32a(+)-S-MS2.

[0058] 2.2. Construction of recombinant plasmid pET-32a(+)-SS-MS2

[0059] The artificially synthesized SAP gene sequence is shown in the sequence table SEQ ID No. 5. The synthetic SAP gene sequence and the pET-32a(+)-S-MS2 recombinant plasmid were digested with Kpn I and Nco I (both preserved in this laboratory), respectively. The double enzyme digestion reaction system is shown in Table 5.

[0060] Table 5 Double enzyme digestion reaction system

[0061]

[0062] Incubate at 37°C for 2 h; recover the double-digested products and connect them using T4 DNA Ligase ligase kit. The reaction system is shown in Table 6.

[0063] Table 6 DNA enzyme ligation reaction system

[0064]

[0065] The ligation was carried out at 16°C for 30 min. The ligation product was then transformed into E. coli DH5α competent cells, plated, and a single colony was picked and sequenced for identification. The correct recombinant plasmid was named pET-32a(+)-SS-MS2.

[0066] 2.3. Construction of recombinant plasmid pET-32a(+)-SSP-MS2

[0067] The synthetic flexible PT-Linker DNA sequence is shown in the sequence table as SEQ ID No. 6. The synthetic flexible PT-Linker DNA sequence and the pET-32a(+)-SS-MS2 recombinant plasmid were digested with Nco I and EcoR V (both stored in this laboratory), respectively. The double enzyme digestion reaction system is shown in Table 7.

[0068] Table 7 Double enzyme digestion reaction system

[0069]

[0070] Incubate at 37°C for 2 h; recover the double-digested products and connect them using T4 DNA Ligase ligase kit. The reaction system is shown in Table 8.

[0071] Table 8 DNA enzyme ligation reaction system

[0072]

[0073] The ligation was carried out at 16°C for 30 min. The ligation product was then transformed into E. coli DH5α competent cells, plated, and a single colony was picked and sequenced for identification. The correct recombinant plasmid was named pET-32a(+)-SSP-MS2.

[0074] 3. Construction of recombinant plasmid pET-32a(+)-SSP-MS2-LS

[0075] 3.1. Construction of recombinant plasmid pET-32a(+)-SSP-MS2-L

[0076] The synthetic flexible F-Linker DNA sequence is shown in the sequence table SEQ ID No. 3. The synthetic flexible F-Linker DNA sequence and the pET-32a(+)-SSP-MS2 recombinant plasmid were digested with EcoR I and Sac I (both preserved in this laboratory), respectively. The double enzyme digestion reaction system is shown in Table 9.

[0077] Table 9 Double enzyme digestion reaction system

[0078]

[0079] Incubate at 37°C for 2 h; recover the double-digested products and connect them using T4 DNA Ligase ligase kit. The reaction system is shown in Table 10.

[0080] Table 10 DNA enzyme ligation reaction system

[0081]

[0082] The ligation was carried out at 16°C for 30 min. The ligation product was then transformed into E. coli DH5α competent cells, plated, and a single colony was picked and sequenced for identification. The correct recombinant plasmid was named pET-32a(+)-SSP-MS2-L.

[0083] 3.2. Construction of recombinant plasmid pET-32a(+)-SSP-MS2-LS

[0084] The artificially synthesized stem-loop structure DNA sequence is shown in the sequence table SEQ ID No. 7. The synthetic stem-loop structure DNA sequence and the pET-32a(+)-SSP-MS2-L recombinant plasmid were digested with Sal I and Xho I (both preserved in this laboratory), respectively. The double enzyme digestion reaction system is shown in Table 11.

[0085] Table 11 Double enzyme digestion reaction system

[0086]

[0087] Incubate at 37°C for 2 h; recover the double-digested products and connect them using T4 DNA Ligase ligase kit. The reaction system is shown in Table 12.

[0088] Table 12 DNA enzyme ligation reaction system

[0089]

[0090] The ligation was carried out at 16°C for 30 min. The ligation product was then transformed into E. coli DH5α competent cells, plated, and a single colony was picked and sequenced for identification. The correct recombinant plasmid was named pET-32a(+)-SSP-MS2-LS.

[0091] 4. Construction of recombinant plasmid pET-32a(+)-SSP-MS2-HAstV

[0092] 4.1. Design of primers for RT-PCR amplification of conserved gene sequences of human astrovirus

[0093] Taking the conserved sequence of human astrovirus as the target sequence, two sets of RT-PCR amplification primers were designed, namely, the upstream primer HAstV-1F: CCGGGATCCAAGCAGGTAACTGTTG (the underline indicates the introduced restriction site BamH I), as shown in the sequence table SEQ ID No.10, and the downstream primer HAstV-1R: GGGAATTCGGTTTTGGTCCTGTGAC (the underline indicates the introduced restriction site EcoR I), as shown in the sequence table SEQ ID No.11; that is, the upstream primer HAstV-2F: CCGGAGCTCAAGCAGGTAACTGTTG (the underline indicates the introduced restriction site Sac I), as shown in the sequence table SEQ ID No.12, and the upstream primer HAstV-2R: GGGTCGACGGTTTTGGTCCTGTGAC (the underline indicates the introduced restriction site SalI), as shown in the sequence table SEQ ID No.13.

[0094] 4.2. Construction of recombinant plasmid pET-32a(+)-SSP-MS2-HAstV

[0095] The genomic RNA of HAstV positive samples (stored in this laboratory) was extracted by TRIzol method, and the HAstV conservative gene sequence was amplified by RT-PCR method, as shown in the sequence table SEQ ID No. 1. The conservative gene sequence of human astrovirus amplified by RT-PCR method and the recombinant plasmid pET-32a(+)-SSP-MS2-LS were digested with restriction endonucleases BamH I and EcoR I, respectively, and Sac I and Sal I (both stored in this laboratory), and the double enzyme digestion reaction system is shown in Table 13.

[0096] Table 13 Double enzyme digestion reaction system

[0097]

[0098] Incubate at 37°C for 2 h; recover the double-digested products and ligate them using T4 DNA Ligase ligase kit. The reaction system is shown in Table 14.

[0099] Table 14 DNA enzyme ligation reaction system

[0100]

[0101] The ligation was carried out at 16°C for 30 minutes. The ligation product was then transformed into E. coli DH5α competent cells, plated, and a single colony was picked and sequenced for identification. The correct recombinant plasmid was named pET-32a(+)-SSP-MS2-HAstV. Its structural diagram is shown in the figure. Figure 1 shown.

[0102] 5. Construction of recombinant plasmid pET-32a(+)-MS2-HAstV

[0103] With the conservative sequence of human astrovirus as the target sequence, RT-PCR amplification primers were designed, the upstream primer HAstV-1F, as shown in the sequence list SEQ ID No.10, and the downstream primer HAstV-1R, as shown in the sequence list SEQ ID No.11. The genomic RNA of the HAstV positive sample (stored in this laboratory) was extracted by the TRIzol method, and the HAstV conservative gene sequence was amplified by the RT-PCR method, as shown in the sequence list SEQ ID No.1. The conservative gene sequence of human astrovirus amplified by the RT-PCR method and the recombinant plasmid pET-32a(+)-MS2 constructed above were digested with restriction endonucleases BamH I and EcoR I (both stored in this laboratory), and the double enzyme digestion reaction system is shown in Table 15.

[0104] Table 15 Double enzyme digestion reaction system

[0105]

[0106] Incubate at 37°C for 2 h; recover the double-digested products and ligate them using T4 DNA Ligase ligase kit. The reaction system is shown in Table 16.

[0107] Table 16 DNA enzyme ligation reaction system

[0108]

[0109] The ligation was carried out at 16°C for 30 minutes. The ligation product was then transformed into E. coli DH5α competent cells, plated, and a single colony was picked and sequenced for identification. The correct recombinant plasmid was named pET-32a(+)-MS2-HAstV. Its structural diagram is shown in the figure. Figure 2 shown.

[0110] Example 2: Preparation of human astrovirus pseudovirions

[0111] 1. The recombinant plasmids pET-32a(+)-SSP-MS2-HAstV and pET-32a(+)-MS2-HAstV were transformed into E. coli BL21 competent cells, respectively, to obtain positive colonies containing the recombinant plasmids pET-32a(+)-SSP-MS2-HAstV and pET-32a(+)-MS2-HAstV, and inoculated into LB liquid culture medium for culture.

[0112] 2. Inoculate the above cultured bacterial solution with Kan at a ratio of 1:100. + LB liquid medium (containing 0.2% glucose) was added and the OD600 When the concentration reached 0.4, the inducer IPTG was added to a final concentration of 0.5 mmol / L to induce expression; after culturing for 7 hours, the bacteria were collected by centrifugation.

[0113] 3. Take 8 mL of bacterial lysis buffer (30 mmol / L Tris-HCl, pH 8.5, 4 mmol / L EDTA, 80 mmol / L NaCl, 1.0% Triton X-100, lysozyme 50 mg / L) to suspend the bacteria and incubate at 37°C for 30 min; then ultrasonically disrupt the cells and collect the supernatant by centrifugation.

[0114] 4. Add RNase and DNase I to the supernatant described in step 3 to a final concentration of 2 mg / L, incubate at 37°C for 1 h, and collect the supernatant by centrifugation.

[0115] 5. Collect the supernatant as described in step 4 and transfer it to an ultrafiltration centrifuge tube (10kD), and centrifuge it at 4°C, 4,000r / min for 1h; aspirate all the concentrated liquid from the collection tube of the ultrafiltration tube to obtain purified pseudovirus particles, take 10μL as a sample for SDS-PAGE electrophoresis, and store the rest at -80°C for later use.

[0116] 6. Add a small amount of PBS solution to the pseudovirus particle solution obtained above and mix well. Add protein loading buffer [0.5 mmol / L Tris-HCl (pH 6.8) 2.5mL, DTT 0.42 g, SDS 0.5 g, bromophenol blue 0.025 g, glycerol 2.8mL, deionized water to 5 mL] in a ratio of 1:4 and mix well. Boil in boiling water for 10 minutes and cool to room temperature for use. Perform SDS-PAGE gel electrophoresis in 5% SDS-PAGE concentrating gel and 12% SDS-PAGE separation gel, stain with Coomassie brilliant blue staining solution, and then decolorize with decolorizing solution until the protein bands are clearly visible. Figure 3 The SDS-PAGE electrophoresis diagram showed that a relatively obvious target band appeared at about 13 kDa after induction, indicating that the recombinant bacteria can normally express pseudovirion protein; and the protein expression level of the pET-32a(+)-SSP-MS2-HAstV strain was significantly higher than that of the pET-32a(+)-MS2-HAstV strain, so the expression of pseudovirion protein by pET-32a(+)-SSP-MS2-HAstV is better than the classic strategy for constructing pseudovirion.

[0117] Example 3: Characterization of human astrovirus pseudovirion particles

[0118] 1. As Figure 4As shown, the above pseudovirus particle stock solution was negatively stained with 2% phosphotungstic acid, and then the pseudovirus particles were observed under a transmission electron microscope, and virus-like particles with dense arrangement and uniform size and shape could be observed.

[0119] 2. Analysis of ribonuclease resistance of human astrovirus pseudovirions. The RNA in the prepared human astrovirus pseudovirions was extracted by the TRIzol method. The specific steps are as follows: 50 μL of the human astrovirus pseudovirion stock solution prepared in Example 2 was placed in an RNase-free EP tube, 1 mL of TRIzol solution was added, and the mixture was allowed to stand at room temperature for 5 min after shaking for 30 s; 0.2 mL of chloroform was added, the mixture was allowed to stand at room temperature for 5 min after shaking for 30 s, and centrifuged at 12,000 r / min for 15 min; the upper aqueous phase solution was collected and placed in a new RNase-free EP tube, an equal volume of isopropanol solution was added, the mixture was allowed to stand at room temperature for 30 min, and centrifuged at 12,000 r / min for 15 min; 1 mL of 75% ethanol was added to the precipitate for washing, and the mixture was centrifuged at 8,000 r / min for 15 min; the supernatant was discarded, and the RNA in the precipitate evaporated the ethanol at room temperature; 20 μL of RNase-free ddH2O was added to dissolve the RNA precipitate, and the precipitate was immediately placed at -80°C for storage.

[0120] In order to determine whether the pseudovirus particles prepared in Example 2 contain human astrovirus RNA fragments, the RNA extracted above was used as a template, and the upstream primer HAstV-1F and the downstream primer HAstV-1R were designed, as shown in the sequence list SEQ ID No. 10 and the sequence list SEQ ID No. 11, and the primer set can amplify the cDNA fragment corresponding to the human astrovirus nucleic acid fragment. Deionized water was used as a template as a negative control, and an RT-PCR kit (such as One-Step RT-PCR Kit) was used for detection, and the reaction system is shown in Table 17 below.

[0121] Table 17 RT-PCR reaction system

[0122]

[0123] Amplification conditions: reverse transcription at 42°C for 5 min; pre-denaturation at 95°C for 5 min; denaturation at 94°C for 20 s, annealing at 58°C for 30 s, extension at 72°C for 20 s, 35 cycles; post-extension at 72°C for 10 min. RT-PCR amplification products were analyzed by 1.2% agarose gel electrophoresis.

[0124] 3. Analysis of the DNAse resistance of human astrovirus pseudovirions. PCR and RT-PCR methods were used to detect whether the human astrovirus pseudovirions prepared in Example 2 contained residual recombinant plasmid DNA. The above-mentioned human astrovirus pseudovirion stock solution was used as a PCR amplification template and the RNA in the pseudovirion prepared by the TRIzol method was extracted as a RT-PCR amplification template, respectively. The upstream primer HAstV-1F and the downstream primer HAstV-1R were designed, as shown in the sequence listing SEQ ID No.10 and the sequence listing SEQ ID No.11. This primer set can amplify the cDNA fragment corresponding to the nucleic acid sequence in the human astrovirus pseudovirion. Deionized water was used as a template as a negative control, and PCR amplification enzymes (such as 2×Taq Master Mix) and RT-PCR kits (such as One-Step RT-PCR Kit) was used for detection, and the reaction system is shown in Table 18 below.

[0125] Table 18 PCR reaction system and RT-PCR reaction system

[0126]

[0127] PCR amplification reaction conditions: 95℃ pre-denaturation for 10min; 94℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 20s, 35 cycles; 72℃ post-extension for 10min; PCR products were analyzed by 1.2% agarose gel electrophoresis. RT-PCR amplification reaction conditions: 42℃ reverse transcription for 5min; 95℃ pre-denaturation for 5min; 94℃ denaturation for 20s, 58℃ annealing for 30s, 72℃ extension for 20s, 35 cycles; 72℃ post-extension for 10min. RT-PCR products were analyzed by 1.2% agarose gel electrophoresis.

[0128] like Figure 5 The results showed that the MS2 phage capsid contained conserved genes of human astrovirus and the human astrovirus pseudovirus particles were not doped with plasmid DNA; at the same time, it was found that the human astrovirus pseudovirus particles were resistant to degradation by ribonucleases of different concentrations, indicating that the prepared pseudovirus particles were resistant to external ribonucleases and had good stability.

[0129] Example 4: Evaluation of human astrovirus pseudovirion quality control

[0130] 1. According to the TRIzol method in Example 3, RNA was extracted from human astrovirus pseudovirus particles assembled by the pET-32a(+)-SSP-MS2-HAstV strain and the pET-32a(+)-MS2-HAstV strain, and the primer and probe sequences in the entry-exit inspection and quarantine industry standard "SN / T 5325.5-2020 Digital PCR method for quantitative detection of foodborne viruses in exported foods" were analyzed to prepare human astrovirus pseudovirus particles in Example 2 as quality control products for detecting human astrovirus. The RNA in the two human astrovirus pseudovirions was used as the research object. The RNA extracted from two different sources was diluted 10 times as a template. The upstream primer HAstV ORF2 F was designed, as shown in the sequence table SEQ ID No. 14. The downstream primer HAstV ORF2R was designed, as shown in the sequence table SEQ ID No. 15. The probe sequence HAstV ORF2 P was shown in the sequence table SEQ ID No. 16. The fluorescent group FAM was added to the 5' end of the probe sequence, and the quenching group BHQ1 was introduced to the 3' end of the probe sequence to perform real-time fluorescence quantitative RT-PCR detection. For example, using a real-time fluorescence quantitative RT-PCR kit (such as Multiplex Probe OneStep qRT-PCR Kit (UDG) was used for detection, deionized water was used as a template and a negative control, and the reaction system is shown in Table 19 below.

[0131] Table 19 Real-time fluorescence quantitative RT-PCR detection method reaction system

[0132]

[0133] Reaction conditions: reverse transcription at 50°C for 10 min; pre-denaturation at 95°C for 1 min; denaturation at 95°C for 10 s, denaturation at 60°C for 20 s, and 40 cycles; fluorescence signals were collected in each cycle.

[0134] Figure 6 The amplification curve results showed that the prepared human astrovirus pseudovirus particles can be used as a positive quality control for detecting human astrovirus and can evaluate the entire detection process. The prepared human astrovirus pseudovirus particle stock solution and its gradient dilution (10 -1 ~10 -4) showed obvious exponential amplification, while there was no obvious amplification when deionized water was used as a template as a negative control, indicating that the prepared pseudovirus particles contained human astrovirus nucleic acid RNA fragments. In addition, the CT value of viral nucleic acid RNA in the human astrovirus pseudovirus particles formed by the pET-32a(+)-SSP-MS2-HAstV strain was lower than that in the human astrovirus pseudovirus particles formed by the pET-32a(+)-MS2-HAstV strain, indicating that the content of viral nucleic acid RNA in the human astrovirus pseudovirus particles formed by the pET-32a(+)-SSP-MS2-HAstV strain was higher, which is helpful as a positive quality control for detecting human astrovirus.

[0135] Since the human astrovirus nucleic acid fragments contained in the pseudovirus particles can be used as quality control products for RNA gene fragments corresponding to the target sequence of human astrovirus in the entry-exit inspection and quarantine industry standards of my country, "SN / T 5325.5-2020 Digital PCR method for quantitative detection of foodborne viruses in exported food", "SN / T 3841-2014 Rapid detection of norovirus and astrovirus in shellfish by reverse transcription-loop-mediated constant temperature nucleic acid amplification (RT-LAMP) method", and "SN / T 2519-2010 Astrovirus detection method in shellfish by ordinary PCR and real-time fluorescence PCR method", they can be used in conjunction with the above standards. Thus, the bottlenecks that seriously restrict the development of human astrovirus detection, such as "there are detection methods but no standard samples", "the development of standard samples does not correspond to the standard method, resulting in narrow application", and "the poor matching between standard samples and detection methods", have been changed.

[0136] The above is a detailed description of a specific embodiment of the present invention through the examples, but the protection scope of the present invention is not limited thereto. Under the premise of achieving the purpose of the present invention, those skilled in the art can make various changes and modifications to the technical scheme of the present invention. For example, in addition to the RNA fragments corresponding to the human astrovirus detection target sequence determined in the entry-exit inspection and quarantine industry standard "SN / T5325.5-2020 Digital PCR method for quantitative detection of foodborne viruses in exported food" mentioned in the above embodiments, the entry-exit inspection and quarantine industry standard of my country "SN / T 3841-2014 Rapid detection of norovirus and astrovirus in exported shellfish Reverse transcription-loop-mediated constant temperature nucleic acid amplification (RT-LAMP) method" and the entry-exit inspection and quarantine industry standard of my country "SN / T 2519-2010 Astrovirus detection method in shellfish Ordinary PCR and real-time fluorescence PCR method", the nucleic acid fragments contained in the pseudovirus particles of the present invention can also be other nucleic acid fragments that can be used as human astrovirus detection targets. In addition, in addition to the pET-32a(+) prokaryotic expression vector mentioned in the present invention, other prokaryotic expression vectors can also be used to perform transcription and / or translation expression of the human astrovirus conserved sequence described in the present invention.

Claims

1. A recombinant vector containing a human astrovirus nucleic acid fragment, obtained by inserting an exogenous nucleotide sequence into a prokaryotic expression vector backbone, characterized in that: The exogenous nucleotide sequence is formed by sequentially connecting the following gene sequences: SUMO fusion tag DNA sequence, SAP Gene sequence, MS2 bacteriophage-related DNA sequence, human astrovirus sequence fragment.

2. The recombinant vector according to claim 1, characterized in that The human astrovirus sequence fragment is also followed by a stem-loop structure DNA sequence.

3. The recombinant vector according to claim 1 or 2, characterized in that The human astrovirus sequence fragments include at least two human astrovirus nucleic acid fragments, and the human astrovirus nucleic acid fragments are connected by a flexible F-Linker DNA sequence; and / or Said SAP The gene sequence and MS2 phage-related DNA sequence were connected using a flexible PT-Linker DNA sequence.

4. The recombinant vector according to claim 3, characterized in that The flexible F-Linker DNA sequence is shown as SEQ ID No. 3 and / or the flexible PT-Linker DNA sequence is shown as SEQ ID No.

6.

5. The recombinant vector according to claim 3, characterized in that The nucleic acid fragment of human astrovirus is a conserved region of human astrovirus, and the cDNA fragment corresponding to the nucleic acid fragment of human astrovirus is shown in SEQ ID No.

1.

6. The recombinant vector according to claim 1, characterized in that The MS2 phage-related DNA sequence contains a gene sequence encoding a mature enzyme protein, a lytic protein gene sequence, a coat protein gene sequence and a replicase protein gene sequence, and the MS2 phage-related DNA sequence is shown in SEQ ID No.

2.

7. The recombinant vector according to claim 1, characterized in that The SUMO fusion tag DNA sequence is shown in SEQ ID No. 4 and / or SAP The gene sequence is shown in SEQ ID No.

5.

8. The recombinant vector according to claim 2, characterized in that The stem-loop structure DNA sequence is shown as SEQ ID No.

7.

9. The recombinant vector according to claim 1, characterized in that The prokaryotic expression vector is pET-32a(+), and the exogenous nucleotide sequence is inserted into the prokaryotic expression vector pET-32a(+).

10. A target for detecting human astrovirus, characterized in that: The recombinant vector according to any one of claims 1 to 9 is transcribed and translated in cells, and then separated and purified to obtain the product.

Images