Method for evaluating earthy smell of fish cultured in water body

Abstract

The invention discloses a method for evaluating earthy smell of fish cultured in a water body. The method is used for detecting abundance of a DNA (Deoxyribose Nucleic Acid) sequence which is derived from microorganisms and is shown as SEQ ID NO: 7 in the water body or tilapia mossambica. According to the invention, a fluorescence-based PCR detection method is established to identify geoA in eDNA of a culture water body so as to evaluate GSM and 2-MIB generated in an aquaculture system and earthy smell of cultured tilapia, and GSM and 2-MIB generated in the aquaculture system are detected. The invention provides a rapid method for identifying the existence of blue-green algae and actinomycetes for producing GSM and 2-MIB, so that an aquaculture farmer can better and more rapidly identify the peculiar smell problem in the aquaculture water so as to select proper prevention and control measures.

Description

Technical Field

[0001] The invention relates to the technical field of tilapia farming, and more particularly to a method for evaluating the earthy smell of fish farmed in water. Background Art

[0002] Tilapia (Oreochromis spp) is a cichlid fish native to Africa and is the second largest freshwater farmed fish in the world. Tilapia has fast growth, stable genetic traits and rich nutrition, but freshwater farmed tilapia has an earthy smell and poor taste. The earthy smell of tilapia meat seriously restricts its economic value. Therefore, it is particularly important for aquaculture to select tilapia without earthy smell.

[0003] The earthy smell of fish is a mixture of a series of low-threshold volatile compounds. Fish absorb earthy smell-related substances in their diet and water, which leads to the earthy smell of fish, especially geosmin (GSM) and 2-methylisoborneol (2-MIB), which are the two most common substances that cause earthy smell.

[0004] By sequencing the bacterial genera that produce GSM and 2-MIB, it was found that the two synthase genes involved in the production of GSM and 2-MIB are geosmin synthase gene (geoA) and 2-MIBcyclase gene (mic). These two odor compounds are secondary metabolites produced by different types of microorganisms such as actinomycetes and cyanobacteria during their growth and reproduction. A few eukaryotic organisms can also secrete GSM and 2-MIB, such as molds, protozoa and some plants.

[0005] Environmental DNA (eDNA) eDNA refers to a mixture of genomic DNA from all different organisms found in an environmental sample. It is often genetic material released by an organism into the surrounding environment and has a certain correlation with the organisms in the environment. Currently, there is no method to use environmental DNA to determine the earthy smell of tilapia meat. Summary of the invention

[0006] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a method for evaluating the earthy smell of fish cultured in water.

[0007] A first object of the present invention is to provide a method for evaluating the earthy smell of fish cultured in water.

[0008] A second object of the present invention is to provide a method for evaluating the abundance of substances that affect the earthy taste of farmed fish in a body of water.

[0009] A third object of the present invention is to provide a kit for evaluating the earthy smell of fish cultured in water.

[0010] A fourth object of the present invention is to provide a kit for evaluating the abundance of substances that affect the earthy smell of farmed fish in water.

[0011] A fifth object of the present invention is to provide an application of a product for detecting the abundance of a nucleotide sequence derived from a microorganism in water or in tilapia, such as a DNA sequence shown in SEQ ID NO: 7.

[0012] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0013] The present invention claims the following method:

[0014] A method for evaluating the earthy smell of fish cultured in water, detecting the abundance of a nucleotide sequence derived from a microorganism such as a DNA sequence shown in SEQ ID NO: 7 in the water or in tilapia.

[0015] A method for evaluating the abundance of substances that affect the earthy smell of farmed fish in water, detecting the abundance of a nucleotide sequence derived from a microorganism such as a DNA sequence shown in SEQ ID NO: 7 in the water or in tilapia.

[0016] Preferably, gill tissue or skin tissue of the fish is tested.

[0017] Preferably, primers having nucleotide sequences as shown in SEQ ID NOs: 1 to 2 are used for detection.

[0018] Preferably, the substance affecting the earthy smell of fish is geosmin and / or 2-methylisoborneol.

[0019] Preferably, the substance that affects the earthy smell of fish is geosmin.

[0020] Preferably, the fish is tilapia.

[0021] Preferably, the water body is a water sample from a tilapia freshwater farm in Guangdong Province.

[0022] The present invention also claims protection for the following products:

[0023] A kit for evaluating the earthy smell of fish cultured in water, comprising a reagent for detecting the abundance of a nucleotide sequence derived from microorganisms in water or tilapia, such as a DNA sequence shown in SEQ ID NO:7.

[0024] A kit for evaluating the abundance of substances that affect the earthy smell of farmed fish in water, comprising reagents for detecting the abundance of a nucleotide sequence derived from microorganisms in water or in tilapia, such as a DNA sequence shown in SEQ ID NO:7.

[0025] Preferably, the reagent is a primer with a nucleotide sequence as shown in SEQ ID NO: 1 to 2.

[0026] The present invention also claims the use of a product for detecting the abundance of a nucleotide sequence derived from a microorganism in water or fish, such as the DNA sequence shown in SEQ ID NO: 7, in one or more of the following:

[0027] (1) Establish a method to assess the earthy odor of fish cultured in water bodies;

[0028] (2) Establish methods for assessing the abundance of substances that affect the earthy odor of farmed fish in water bodies;

[0029] (3) preparing a kit for evaluating the earthy smell of fish cultured in water;

[0030] (4) A kit for evaluating the abundance of substances that affect the earthy smell of farmed fish in water bodies is prepared.

[0031] Preferably, the product is a primer with a nucleotide sequence as shown in SEQ ID NO: 1 to 2.

[0032] Preferably, the substance with earthy smell is GSM or 2-MIB.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] The present invention establishes a fluorescence-based PCR detection method to identify geoA in eDNA of aquaculture water to evaluate GSM and 2-MIB produced in aquaculture systems and the earthy smell of cultured tilapia, and detects GSM and 2-MIB produced in aquaculture systems. It provides a rapid method for identifying the presence of cyanobacteria and actinomycetes that produce GSM and 2-MIB, enabling aquaculturists to better and faster identify odor problems in aquaculture water so as to select appropriate prevention and control measures. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Relative abundance bar graph of species annotation results for each sample at different taxonomic levels.

[0036] Figure 2 Relative abundance heatmap of species annotation results for each sample at different taxonomic levels.

[0037] Figure 3This is the sequence correlation analysis of geoA and mic genes of each sample.

[0038] Figure 4 for each primer to amplify the corresponding target fragment; M: Genstar DL2000 marker; A: Gaozhou Fengxing Aquatic Seed Co., Ltd.; B: Gaozhou Shuangying Fish Fry Hatchery Farm; C: Gaozhou Fish Fry Breeding Base; D: Huazhou Ligang Jin'ao Tilapia Breeding Farm; E: Huazhou Guanghui Breeding Farm Co., Ltd.; F: Maoming Gongguan Town Xiangguang Tilapia Breeding Base; G: Yangchun Gangmei Town Improved Tilapia Seedling Farm; H: Jiangmen Xinhui District Lianjiang Fish Seedling Farm; I: Guangzhou Tilapia Improved Tilapia Farm; J: Negative control (ultrapure water).

[0039] Figure 5 The amplification results of the primers in Comparative Example 1 are shown in FIG.

[0040] Figure 6 The effect of water salinity on the abundance of geoA-1 genes in microorganisms in aquaculture water.

[0041] Figure 7 Effect of water salinity on the abundance of geoA-1 genes in microorganisms in gill tissue.

[0042] Figure 8 Effect of water salinity on the abundance of microbial geoA-1 genes in skin tissue.

[0043] Fig. 9 The results of SPME-GC-MS determination of odor substances in the muscle of GIFT tilapia under four salinity culture modes.

[0044] Fig.10 Primers geo_M2 and geo_M3 were used to detect the effect of different water salinities on the abundance of microbial geoA genes in various tissues. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0046] Example 1 Geosmin synthase protein and dimethylisoborneol synthase protein in water samples from freshwater tilapia farms in Guangdong Province

[0047] 1. Experimental Methods

[0048] 1. Collection of water samples from tilapia freshwater farms in Guangdong Province

[0049] Water samples were collected from freshwater tilapia farms in Guangdong Province in Gaozhou, Huazhou, Maoming, Yangjiang, and Jiangmen. The collection locations are as follows

[0050] A. Gaozhou Fengxing Aquatic Seed Co., Ltd.;

[0051] B. Gaozhou Shuangying Fish Fry Hatchery Farm;

[0052] C. Gaozhou fry breeding base;

[0053] D. Huazhou Ligang Jin Ao Luofei Breeding Farm;

[0054] E. Huazhou Guanghui Breeding Farm Co., Ltd.;

[0055] F. Xiangguang Tilapia Breeding Base, Gongguan Town, Maoming City;

[0056] G. Improved Tilapia Seedling Farm in Gangmei Town, Yangchun City;

[0057] H. Lianjiang Fish Fry Farm, Xinhui District, Jiangmen City;

[0058] I. Tilapia Seedling Farm, Guangzhou City, Guangdong Province.

[0059] Water samples were collected using sterile collection bags. Two groups of parallel samples were taken at each sampling point, and 1L of surface aquaculture water was taken from each group. A domestically produced water system microporous filter membrane with a diameter of 47mm and a pore size of 0.45μm and a vacuum pump were used to filter the water samples on site, and the filtered filter membrane was transferred to a 2mL sterile centrifuge tube. During transportation, the samples must be stored in dry ice and placed in a -80℃ ultra-low temperature refrigerator for long-term storage.

[0060] 2. Extraction of microorganisms from water samples

[0061] The eDNA of all samples was extracted using the HiPure Soil DNA Kit, and the extracted eDNA was subjected to 1.0% agarose gel electrophoresis (0.5×TBE electrophoresis buffer, 120V voltage, electrophoresis for 20 minutes) to analyze the bands. For the eDNA samples of individuals with obvious main bands, the concentration was determined using Qubit 3.0 to ensure that the quality and concentration of the DNA used for library construction met the standards.

[0062] 3. High-throughput sequencing of microbial metagenomes

[0063] Illumina PE150 was used for high-throughput sequencing, and the raw data obtained from sequencing contained adapter sequences, short fragments, and low-quality sequences. Therefore, the default settings of Fastp software were used to perform quality control on the raw data to remove adapter contamination and reads with an average quality score lower than Q20.

[0064] 4. Metagenomic data assembly and annotation

[0065] Download the uniref90 database and ID mapping information from the global protein resource database (UniProt). Use diamond software to convert the uniref90 database into a local diamond database and align and annotate the predicted amino acid sequences. Then extract the GO annotation information based on the ID mapping information and use the grep command to find the protein IDs of geoA and mic genes in various bacterial species. Finally, use seqtk software to extract the protein sequences and cds sequences of geoA and mic genes from the protein sequences and cds sequences of MAGs through protein IDs.

[0066] 2. Experimental Results

[0067] Based on the relative abundance at different taxonomic levels, the top 20 species with the highest relative abundance in each sample were screened out, and the relative abundance bar graphs and heat maps of the species annotation results of each sample at different taxonomic levels were drawn (see Figure 1 and Figure 2 ). As can be seen from the figure, the top ten species in terms of abundance are Cyanobacteria, Pseudomonas, Synechococcus, Acidobacterium, Microcystis, Bacillus, Polynucleobacterium, Aculeatus, Homo, and Microcystis aeruginosa.

[0068] Furthermore, the amino acid sequences encoding the geoA gene and the mic gene were obtained by comparing the uniref90 database. Through GO annotation, 5 geoA and 1 mic gene sequences were found, named geoA-1, geoA-2, geoA-3, geoA-4, geoA-5 and mic-1, respectively. The amino acid sequences and species of the corresponding geosmin synthase protein and dimethylisoborneol synthase protein are shown in Table 1. These amino acid sequences were converted into cds sequences, and the geoA and mic gene sequences identified in the samples were obtained. Figure 3 , indicating that the sequences of geosmin synthase (geoA) gene and 2-methylisoborneol synthase (mic) gene in the aquaculture water of Huazhou Ligang Jinao Tilapia Breeding Farm (site D), Maoming Gongguan Town Xiangguang Tilapia Breeding Base (site F), Jiangmen Xinhui District Lianjiang Fish Fry Farm (site H) are more similar than those in other freshwater aquaculture farms.

[0069] Table 1 Sequence information of geoA and mic genes

[0070]

[0071]

[0072] Example 2 Amplification of geoA gene

[0073] 1. Experimental Methods

[0074] Based on the sequences of the geoA genes (geoA-1, geoA-2, geoA-3, geoA-4, and geoA-5) obtained in Example 1, specific primers were designed (see Table 2).

[0075] Table 2

[0076]

[0077] The eDNA samples of the water samples collected from the freshwater tilapia farms in Guangdong Province in Example 1 were mixed in equal amounts and amplified and sequenced by PCR.

[0078] The PCR reaction system is: 5 μL of 2×PCR Vazyme Mix, 0.4 μL of each of the upstream and downstream primers of the primer pair of the detection primer, 1 μL of template DNA, and 3.2 μL of water to make the total volume 10 μL.

[0079] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 50 or 60°C for 15 s according to the primer Tm value, extension at 72°C for 20 s, the number of cycles was 42, and extension at 72°C for 5 min.

[0080] 2. Experimental Results

[0081] The results are as follows Figure 4 The results showed that the primer pairs geo_M1 and geo_M2 could amplify the target fragment from Yangchun Gangmei and the provincial tilapia breeding farm; the primer pair geo_M3 could amplify the target fragment from Gaozhou base, Maoming Xiangguang, Yangchun Gangmei and the provincial tilapia breeding farm; (Table 3).

[0082] Table 3

[0083]

[0084] The sequencing results showed that the nucleotide sequences of the PCR amplification products of the primer pairs geo_M1, geo_M2 and geo_M3 were shown in SEQ ID NOs: 7 to 9, respectively.

[0085] The PCR amplification product sequence of primer pair geo_M1 (121 bp, SEQ ID NO: 7) was: CCTTATAGCACAGAGTTAAGCCCGTATCTAAATGCGGCTCGAAAACACTCTA AAGAATGGGCACGTGAAATGGGTATGTTGGCAAACTTGCCCGGCATTCCCG AAGTTTTTATCTGGAATG;

[0086] The PCR amplification product sequence of primer pair geo_M2 (178 bp, SEQ ID NO: 8) was: GCAATACGCCACTCATCCATTGTTGCAACCTTTCTATATATCCTTGCAAGTGCGACCATTCCTTCTCGTCCATGCCAAAGTCTTCACGCAGCACGGGCAAATCATTAGCAACAATACGCTCAAATTGTTTCATACGACCAGTCATCAAATTATTGACAACTTCAATGGCTCTCGGTAA;

[0087] Primer pair geo_M3 PCR amplification product sequence (189bp, SEQ ID NO:9): TACCACATTTCCGCTGATCCAGCTCGCGCGCCGCAGCTCGACAGGCTGGCCGATGCCGACCTCCCTGCGGTTGTCGACCAGTTCGACGCACGACAGATGCTGCATGTTACCTTCGGCTCGGCGATCATGCGGCTCGGCCCAGAAATGCAGGCTGCCCTGCGCACCCATGAAGAGACACACTACACGGCG.

[0088] Comparative Example 1

[0089] 1. Experimental Methods

[0090] At the same time, PCR was performed on an equal amount of mixed samples of eDNA from farm water samples in Guangdong Province collected in Example 1 using the primers for amplifying geoA that have been published (https: / / doi.org / 10.1016 / j.watres.2018.02.041) (see Table 4).

[0091] Table 4

[0092]

[0093]

[0094] 2. Experimental Results

[0095] The results are as follows Figure 5 The results showed that none of the primers had specific bands, indicating that none of the primers could amplify the geoA gene in the eDNA of water samples from tilapia freshwater farms in Guangzhou, Guangdong Province.

[0096] Example 3 qPCR detection of geoA expression changes in GIFT tilapia and aquaculture water

[0097] 1. Experimental Methods

[0098] 1. Tilapia brackish water farming

[0099] At the GIFA Tilapia from the Guangdong Province Tilapia Breeding Farm, a one-month culture comparison of different salinities was conducted.

[0100] 320 GIFT tilapia with similar initial weight (average weight 700g) were selected and randomly assigned to 8 tanks for breeding, with two tanks forming a group, for a total of four groups. The size of the breeding tank is 2m in diameter and 1m in height. 40 fish were cultured in each tank.

[0101] The salinity gradients were 0, 8, 16 and 24 ppt, with 0 ppt freshwater aquaculture serving as the control group and the other 6 tanks used for salinity acclimatization.

[0102] Specific salinity acclimation process: turn off the system breeding water, add sea crystals to the water every day to increase the salinity of the water body (once a day, each time the salinity is increased by about 6ppt). Use a salinity meter to measure the salinity and adjust it to 0, 8, 16 and 24ppt respectively. Set up two parallel tanks for each group, and the salinity level will not change after adjustment. After the salinity adjustment is completed, it is marked as day 0. After that, use a salinity meter to check the salinity from time to time, and adjust it in time as needed. Change the water regularly to keep the water clean. Feed once a day.

[0103] 2. Collection of breeding experiment samples

[0104] Stop feeding for one day before sampling, and sample on the 7th, 14th, 21st and 28th day. Stop feeding for one day before sampling. First, use eugenol solution to anesthetize the fish to be sampled. Each time sampling, record the weight of each fish, remove scales, remove the surface skin, collect gills, skin, intestinal tissue and back muscle samples of GIFT tilapia, and take a total of 6 fish for each salinity gradient group. All samples were placed in enzyme-free cryopreservation tubes and frozen with liquid nitrogen, and stored at -80°C for a long time for subsequent environmental DNA (eDNA) extraction.

[0105] Water samples were collected on the 7th, 14th, 21st and 28th days using sterile collection bags. Four parallel samples were taken from each group, and 1L of surface aquaculture water was taken for each sample. The water samples were filtered using an MCE microporous filter membrane (domestic water system) with a diameter of 47mm and a pore size of 0.45μm. The filtered membrane was placed in a 2mL sterile centrifuge tube and stored at -80℃ for a long time for subsequent eDNA extraction.

[0106] 3. Extraction of microorganisms from water samples

[0107] The eDNA of all samples was extracted using the HiPure Soil DNA Kit, and the extracted eDNA was subjected to 1.0% agarose gel electrophoresis (0.5×TBE electrophoresis buffer, 120 V voltage, electrophoresis for 20 minutes) to analyze the bands.

[0108] 4. eDNA extraction from tissue samples

[0109] The bacterial eDNA was extracted from the tissue samples using the HiPure Bacterial DNA Kit, and the extracted eDNA was subjected to 1.0% agarose gel electrophoresis (0.5×TBE electrophoresis buffer, 120 V voltage, electrophoresis for 20 minutes) to analyze the bands.

[0110] 5. qPCR detection of geoA gene related to earthy smell in GIFT tilapia

[0111] GSM-producing microorganisms are present in the gills, skin and intestines of fish, so the abundance of geoA genes in the gills, skin and intestines of fish was detected to assess the abundance of GSM in tilapia.

[0112] The primer pair geo_M1 in Table 2 was used to perform qPCR on the culture water, fish skin, gills, intestine and intestinal contents under different salinities and different culture times to detect the abundance of geoA gene under different conditions.

[0113] The primers for the internal reference gene 16S were: 341F: CCTACGGGAGGCAGCAG; 518R: ATTACCGCGGCTGCTGG.

[0114] The reaction system of the qPCR reagent is 5 μL of 2×SYBR Green qPCR Mix, 0.4 μL of each of the upstream and downstream primers of the primer pair of the detection primer, 1 μL of template DNA, and 3.2 μL of water to make the total volume 10 μL.

[0115] The reaction conditions of qPCR were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 s; annealing at 60°C for 10 s, extension at 72°C for 10 s, cycle number 45; and extension at 72°C for 5 min.

[0116] 2. Experimental Results

[0117] The results showed that the abundance of geoA-1 gene in water samples, gill tissues and skin changed significantly, but there was no significant difference in the identification of geo_M1 in the intestine and intestinal contents, indicating that the amplification of geoA-1 gene abundance in gill tissues and skin using geo_M1 primers can better reflect the changes in GSM abundance in tilapia.

[0118] Effect of water salinity on the abundance of geoA-1 genes in aquaculture water microorganisms Figure 6 As shown. With the increase of culture time and water salinity, the abundance of geoA-1 genes of microorganisms showed an overall downward trend, with more significant changes on the 7th and 28th days. On the 7th day of culture, the abundance of geoA-1 genes in the 8, 16 and 24 ppt salinity groups was significantly lower than that in the freshwater group (p<0.05), with the difference between the 16 ppt and 24 ppt groups being the most significant (p<0.01). On the 28th day, the abundance of geoA genes in the 8, 16 ppt and 24 ppt groups were significantly lower than that in the freshwater group (p<0.01), with the difference in the 24 ppt group being the most significant (p<0.0001). The abundance of geoA-1 genes in the freshwater group was 7 times that of the 24 ppt culture group.

[0119] like Figure 7 As shown in the figure, water salinity has an effect on the abundance of geoA-1 genes of microorganisms in gill tissues. With the increase of culture time and water salinity, the abundance of geoA-1 genes of microorganisms basically showed a gradual downward trend. Among them, the decrease in geoA-1 gene abundance was more significant on the 7th, 14th and 21st days of salinity culture (p<0.05). On the 7th day, the geoA gene abundance of the 24ppt group was significantly lower than that of the freshwater group (p<0.01), and the gene abundance of the freshwater group was 5.35 times that of the 24ppt group; on the 14th day, the geoA gene abundance of the 16ppt and 24ppt groups was significantly lower than that of the freshwater group (p<0.05); on the 21st day, the geoA gene abundance of the 16ppt and 24ppt groups was significantly lower than that of the freshwater group (p<0.01), and the gene abundance of the freshwater group was 3.75 times and 2.56 times of them, respectively. On the 28th day, there was no significant difference in the abundance of geoA-1 gene between the 8ppt, 16ppt and 24ppt groups and the freshwater group (p>0.05).

[0120] Effect of water salinity on the abundance of microbial geoA-1 genes in skin tissue Figure 8 As shown. With the increase of culture time and water salinity, the abundance of geoA-1 genes of microorganisms in the salinity culture group and the freshwater group remained basically the same, with no significant difference. Only on the 28th day of culture, the abundance of geoA-1 genes in the 16ppt group was significantly different from that in the freshwater group (p<0.05), and the gene abundance in the freshwater group was 2.57 times that of the 16ppt group.

[0121] Example 4 Detection of geoA expression changes in GIFT tilapia and aquaculture water using SPME-GC-MS

[0122] Although tilapia meat does not contain microorganisms that produce GSM and cannot carry the geoA gene, the secondary metabolites GSM and 2-MIB produced by related microorganisms can enter the fish meat through the tilapia's respiration and ingestion of algae. Therefore, SPME-GC-MS was used to detect GSM and 2-MIB in GIFT tilapia meat.

[0123] 1. Experimental Methods

[0124] 1. Collection of experimental tissue samples

[0125] The tilapia in the "Tilapia brackish water farming" in Example 3 stopped feeding for one day before sampling, and sampling was performed on the 7th, 14th, 21st and 28th days respectively. Stop feeding for one day before sampling. The sampled fish were first anesthetized with eugenol solution. The weight of each fish was recorded for each sampling, the scales were removed, the surface skin was removed, and the back muscles were taken. A total of 12 fish were taken for each salinity gradient. The fish samples were placed in a sterilized 50mL centrifuge tube, temporarily stored in dry ice, and stored at -80°C for a long time for subsequent SPME-GC-MS detection.

[0126] 2. SPME-GC-MS detection of earthy odor-related substances in fish under different salinity breeding conditions

[0127] 5 g muscle was weighed from each sample, and three samples of the same salinity gradient were mixed in equal amounts and sent to Guangzhou Analysis and Testing Center, China for testing. According to GB / T 38470-2016, the modified method was used to detect GSM and 2-MIB in fish meat.

[0128] Accurately weigh 10 g (accurate 0.1 g) of the sample into a 60 mL headspace bottle, add 10 μL of 2-methoxy-3-isobutylpyrazine (IBMP) (concentration of 4 μg / mL) as an internal standard, add 10 g of sodium chloride, add 40 mL of deionized water, homogenize and break, and then place a micro stirrer.

[0129] Before using the SPME needle for extraction, place it at 250℃ for 30min. The SPME extraction steps are as follows: first place the headspace bottle containing the sample on a magnetic heating stirring table and place it in a 60℃ water bath for 10min. Then fix the extraction head on the rack, insert it into the headspace bottle, and take it out after stirring and extracting the headspace for 40min. Quickly insert the extraction head into the injection port of the gas chromatograph and desorb for 5min, so that the volatile components adsorbed by the SPME fiber head coating are rapidly thermally desorbed at high temperature, and can be analyzed and identified by GC-MS.

[0130] 2. Experimental Results

[0131] 2-isobutyl-3-methoxypyrazine (IBMP) was used as the internal standard solution at a concentration of 4 μg / mL. The concentrations of the standard series solutions of geosmin and 2-methylisoborneol were 1, 5, 10, 25, and 50 μg / mL, respectively, for sample injection determination. The standard working curve was drawn with the ratio of the concentration of the measured component in the standard solution to the internal standard concentration as the horizontal coordinate and the ratio of the peak area of ​​the measured component in the standard solution to the internal standard peak area as the vertical coordinate. The regression equations and correlation coefficients of GSM and 2-MIB are shown in Table 5.

[0132] Table 5 Regression equations and correlation coefficients of geosmin and 2-methylisoborneol

[0133]

[0134] The results of SPME-GC-MS determination of odor substances in the muscle of GIFT tilapia in the four salinity culture modes of 0, 8, 16 and 24 ppt in Example 3 are as follows: Fig. 9 . The results showed that on the 7th day of breeding, the GSM in the muscle of tilapia farmed in the 16 and 24 ppt groups was significantly lower than that in the freshwater group (p<0.01), and the 2-MIB in the muscle of tilapia farmed in the 24 ppt group was significantly lower than that in the freshwater group (p<0.01). On the 14th day of breeding, the GSM in the muscle of tilapia farmed in the 16 and 24 ppt groups was significantly lower than that in the freshwater group (p<0.05), and the 2-MIB in the muscle of all saltwater farmed tilapia was significantly lower than that in the freshwater group (p<0.01), among which the 24 ppt group was the most obvious. The results showed that the content of the two odor substances in the muscle of saltwater farmed tilapia was significantly lower than that in the freshwater farmed group. After 21 days of breeding, the content of GSM and 2-MIB in the fish meat was below the detection limit of GC-MS and therefore could not be detected.

[0135] The results showed that SPME-GC-MS detection of GSM concentration in fish meat showed that with the increase of breeding time and water salinity, the content of GSM and 2-MIB in fish meat decreased, indicating that the number of microorganisms producing GSM and 2-MIB decreased, which is consistent with the results of using geo_M1 in Example 3 to measure the abundance of microbial geoA genes in water and fish gills.

[0136] Comparative Example 2

[0137] 1. Experimental Methods

[0138] The primer pairs geo_M2 and geo_M3 in Table 2 were used to perform qPCR detection on each sample in Example 3, and the detection method was the same as that in Example 3.

[0139] 2. Experimental Results

[0140] After 14 days of culture, the primer pairs geo_M2 and geo_M3 were used to detect the abundance of microbial geoA genes in water, tilapia gills, and tilapia skin tissues at different salinities. The results are as follows: Fig.10 show.

[0141] The geoA gene of primer pair geo_M2 in aquaculture water, gills, and skin showed a decreasing trend with increasing salinity, which was significantly different from the 0ppt freshwater aquaculture group, but the abundance difference between the 8, 16, and 24ppt salinity aquaculture groups was not significant; the abundance of geo_M3 in each sample showed no significant difference between the freshwater group and the salinity aquaculture group. In summary, the consistency of the inspection results of geoA gene abundance and the SPME-GC-MS detection results of GSM concentration in fish meat, primer pair geo_M1 was significantly better than primer pairs geo_M2 and geo_M3, and the primer that best matched the concentration trend of GSM in fish meat was geo_M1.

Claims

1. A method for evaluating the earthy smell of fish cultured in water, characterized in that: The abundance of a nucleotide sequence derived from a microorganism in water or tilapia, such as a DNA sequence shown in SEQ ID NO: 7, is detected.

2. A method for evaluating the abundance of substances that affect the earthy smell of farmed fish in a water body, characterized in that The abundance of a nucleotide sequence derived from a microorganism in water or tilapia, such as a DNA sequence shown in SEQ ID NO: 7, is detected.

3. The method according to claim 1 or 2, characterized in that the gill tissue or skin tissue of the fish is detected.

4. The method according to any one of claims 1 to 3, characterized in that primers with nucleotide sequences as shown in SEQ ID NOs: 1 to 2 are used for detection.

5. The method according to any one of claims 1 to 3, wherein the substance affecting the earthy smell of fish is geosmin and / or 2-methylisoborneol.

6. The method according to claim 5, wherein the substance affecting the earthy smell of fish is geosmin.

7. A kit for evaluating the earthy smell of fish cultured in water, characterized in that: The invention contains reagents for detecting the abundance of a nucleotide sequence derived from microorganisms in water or tilapia, such as a DNA sequence shown in SEQ ID NO:

7.

8. A kit for evaluating the abundance of substances that affect the earthy smell of fish cultured in water, characterized in that The invention contains reagents for detecting the abundance of a nucleotide sequence derived from microorganisms in water or tilapia, such as a DNA sequence shown in SEQ ID NO:

7.

9. The method according to claim 7 or 8, wherein the reagent is a primer having a nucleotide sequence as shown in SEQ ID NO: 1 to 2.

10. The product for detecting the abundance of a nucleotide sequence such as a DNA sequence shown in SEQ ID NO: 7 in water or fish is used in one or more of the following: (1) Establish a method to assess the earthy odor of fish cultured in water bodies; (2) Establish methods for assessing the abundance of substances that affect the earthy odor of farmed fish in water bodies; (3) preparing a kit for evaluating the earthy smell of fish cultured in water; (4) A kit for evaluating the abundance of substances that affect the earthy smell of farmed fish in water bodies is prepared.

Images