Primer composition and kit for rapidly identifying rujgera MC10 and application of primer composition and kit
By designing the ATP5B and parC target gene primer composition for Rugeria MC10, the rapid identification of this strain was achieved, solving the problem of low resolution in the prior art, and improving the identification accuracy and sensitivity.
Patent Information
- Application Number
- CN202411659192.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2025-03-04
AI Technical Summary
The prior art is difficult to quickly and accurately identify Rugeria MC10, especially in the same genus, with low resolution of strains.
A primer composition was designed to detect the target genes ATP5B and parC of Rugeria MC10, and the rapid identification of Rugeria MC10 was achieved through PCR amplification reaction and sequencing analysis.
It improves the identification accuracy and resolution of Rugeria MC10, and can achieve high sensitivity and rapid detection in different environmental samples and pure bacteria samples, meeting the application needs of Rugeria MC10.
Smart Images
Figure CN119552981A_ABST
Abstract
Description
Technical Field
[0001] The present application belongs to the technical field of marine heterotrophic microbial strain identification, and in particular to a primer composition, a kit and an application thereof for rapid identification of Rudgeria MC10. Background Art
[0002] Ruegeria is a representative strain of marine heterotrophic microorganisms, and MC10 is one of its species. Ruegeria MC10 was isolated and sequenced for the first time by our laboratory, and there are no related reports yet. Ruegeria MC10 was isolated from the curled black star coral Oulastrea crispata, and many characteristics of its genome showed that it may have established a symbiotic relationship with the coral host. By designing an aquarium experiment that simulates the real marine environment, it was further found that when Ruegeria MC10 was fed as a probiotic to stressed corals or oysters, these marine organisms could remain healthy under stress conditions. It can be seen that Ruegeria MC10 has the potential to be used as a probiotic for a variety of marine organisms in the future. Therefore, it is very necessary to develop a set of methods for rapid and accurate identification of Ruegeria MC10.
[0003] At present, bacterial identification still mainly uses 16S rRNA nucleic acid sequences as targets, but usually can only be identified to the genus level, and the resolution of strains within the same genus is not high. The applicant constructed a phylogenetic tree based on the 16S rRNA nucleic acid sequence of Rudgeria and found that it could not well distinguish Rudgeria MC10 from other Rudgeria.
[0004] Therefore, it is urgent to find target genes with higher resolution to achieve rapid identification of Rudgeria MC10 and successfully distinguish MC10 from other Rudgeria. Summary of the invention
[0005] The purpose of the present application is to provide a primer composition, a kit and an application thereof for rapidly identifying Rudgeria MC10, aiming to solve the problem that there is no method for rapidly and accurately identifying and isolating Rudgeria MC10 in the prior art.
[0006] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:
[0007] In the first aspect, the present application provides a primer composition for rapid identification of Bacillus rudgeri MC10. The primer composition is used to detect the target gene of Bacillus rudgeri MC10, and comprises a first primer pair and a second primer pair. The sequence of the first primer pair is shown in SEQ ID NO.1-SEQ ID NO.2, and the sequence of the second primer pair is shown in SEQ ID NO.3-SEQ ID NO.4.
[0008] In some embodiments, the target genes of Rudgeria MC10 include ATP5B target gene and parC target gene; wherein, the ATP5B target gene of Rudgeria MC10 is amplified using the first primer pair to obtain the sequence shown in SEQ ID NO.5; the parC target gene of Rudgeria MC10 is amplified using the second primer pair to obtain the sequence shown in SEQ ID NO.6.
[0009] In a second aspect, the present application provides a kit for rapid identification of Rudgeria MC10, the kit comprising the above-mentioned primer composition for rapid identification of Rudgeria MC10.
[0010] In some embodiments, in the primer composition for rapid identification of Rudgeria MC10, the concentration of the primers shown by SEQ ID NO.1-SEQ ID NO.4 is 10 μM.
[0011] In some embodiments, the kit further comprises an amplification reaction system; wherein the amplification reaction system comprises a 2×Taq preformed enzyme reaction solution.
[0012] In some embodiments, the procedure of the amplification reaction system is: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, setting 35 cycles, extension at 72°C for 10 min; and storage at 4°C.
[0013] In a third aspect, the present application provides a use of the above-mentioned kit for rapid identification of Rudgeria MC10 in the specific detection of Rudgeria MC10 in pure bacterial samples or complex samples.
[0014] In a fourth aspect, the present application provides a detection method using the above-mentioned kit for rapid identification of Rudgeria MC10, comprising the following steps:
[0015] Provide DNA template solution of the sample to be tested;
[0016] Using the primer combination in the above-mentioned kit for rapid identification of Rudgeria MC10 to perform PCR amplification reaction on the DNA template liquid to obtain a PCR product;
[0017] The PCR products were verified, purified, and sequenced in turn, and the sequencing results were analyzed to determine whether Rugeria MC10 existed in the sample to be tested.
[0018] In some embodiments, the system of PCR amplification reaction is 20 μL, wherein the concentration of the upstream primer is 10 μM and the amount added is 1 μL; the concentration of the downstream primer is 10 μM and the amount added is 1 μL; the amount of DNA template liquid added is 1 μL, the amount of 2×Taq preformed enzyme reaction liquid added is 10 μL, and the amount of sterilized MillQ water added is 7 μL.
[0019] In some embodiments, the sample to be tested includes a pure bacterial colony or a complex environmental sample.
[0020] In some embodiments, the sequencing method comprises Sanger sequencing or Illumina sequencing.
[0021] The first aspect of the present application provides a primer composition for rapid identification of Bacillus rugiperda MC10. The provided primer composition can be used to detect the target gene of Bacillus rugiperda MC10, wherein the provided target gene is screened based on comparative genomics and phylogenetic analysis methods. Therefore, the provided primer composition has higher accuracy and a resolution much higher than 16S rRNA by cloning and then analyzing the target gene; and, it can achieve high-sensitivity and rapid detection of Bacillus rugiperda MC10 in different environmental samples and pure bacterial samples, and can fully meet the needs of its identification in the application stage of Bacillus rugiperda MC10.
[0022] The second aspect of the present application provides a kit for rapid identification of Bacillus rugiperda MC10, the kit comprising the above-mentioned primer combination for rapid identification of Bacillus rugiperda MC10; therefore, by using the kit for analysis, it is possible to rapidly and accurately identify Bacillus rugiperda MC10, and the detection time is short, the operation is simple, and the cost is low, which is conducive to wide promotion and application.
[0023] The third aspect of the present application provides a kit for rapid identification of Bacillus MC10 for use in specifically detecting Bacillus MC10 in pure bacterial samples or complex samples; since the kit for rapid identification of Bacillus MC10 includes a primer combination with high specificity for detecting the target gene of Bacillus MC10, the target gene of Bacillus MC10 can be amplified in pure bacterial samples or complex samples, thereby quickly and accurately identifying Bacillus MC10.
[0024] The fourth aspect of the present application provides a detection method using the above-mentioned kit for rapid identification of Rudgeria MC10. The detection method is simple to operate, low in cost, does not require large-scale instruments and equipment, and is suitable for analysis on a variety of sequencing platforms. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0026] Figure 1 The phylogenetic tree is constructed based on the 16S rRNA nucleic acid sequence of Rudgeria and its outgroups provided in the examples of the present application;
[0027] Figure 2 The phylogenetic trees were constructed based on the ATP5B nucleic acid sequences of Rudgeria and its outgroups provided in the examples of the present application;
[0028] Figure 3 The phylogenetic trees were constructed based on the parC nucleic acid sequences of Rudgeria and its outgroups provided in the examples of the present application;
[0029] Figure 4 is the electrophoresis diagram of the PCR product provided in Example 1 of the present application;
[0030] Figure 5 It is a comparison analysis diagram of the ATP5B sequence obtained by PCR amplification provided in Example 1 of the present application and the ATP5B sequence in the genome;
[0031] Figure 6 is a comparison analysis diagram of the parC sequence obtained by PCR amplification provided in Example 1 of the present application and the parC sequence in the genome;
[0032] Figure 7 This is the electrophoresis diagram of the PCR product provided in Example 2 of the present application. DETAILED DESCRIPTION
[0033] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.
[0034] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.
[0035] In this application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, c can be single or multiple, respectively.
[0036] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.
[0037] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "an" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.
[0038] The weight of the relevant components mentioned in the embodiment description of the present application can not only refer to the specific content of each component, but also represent the proportional relationship between the weights of the components. Therefore, as long as the content of the relevant components is proportionally enlarged or reduced according to the embodiment description of the present application, it is within the scope disclosed in the embodiment description of the present application. Specifically, the mass in the embodiment description of the present application can be μg, mg, g, kg and other mass units known in the chemical industry.
[0039] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, features defined as "first" and "second" may explicitly or implicitly include one or more of the features.
[0040] like Figure 1 As shown, Figure 1 The phylogenetic tree was constructed based on the 16S rRNA nucleic acid sequences of Rudgeria and its outgroups. Different colors represent different populations of Rudgeria, and the location of MC10 has been marked. It can be found that MC10 cannot form an evolutionary branch independently, but is mixed with other Rudgeria MC0 and MC19, indicating that 16S rRNA cannot be used to accurately identify Rudgeria MC10.
[0041] A first aspect of an embodiment of the present application provides a primer composition for rapid identification of Bacillus rudgeri MC10. The primer composition is used to detect the target gene of Bacillus rudgeri MC10, and comprises a first primer pair and a second primer pair. The sequence of the first primer pair is shown in SEQ ID NO.1-SEQ ID NO.2, and the sequence of the second primer pair is shown in SEQ ID NO.3-SEQ ID NO.4.
[0042] The first aspect of the embodiments of the present application provides a primer composition for rapid identification of Bacillus rugiperda MC10. The provided primer composition can be used to detect the target gene of Bacillus rugiperda MC10, wherein the provided target gene is screened based on comparative genomics and phylogenetic analysis methods. Therefore, the provided primer composition has higher accuracy and a resolution much higher than 16S rRNA by cloning and then analyzing the target gene; and, it can achieve high-sensitivity and rapid detection of Bacillus rugiperda MC10 in different environmental samples and pure bacterial samples, and can fully meet the needs of its identification in the application stage of Bacillus rugiperda MC10.
[0043] In some embodiments, the target genes of S. rugeria MC10 include ATP5B target gene and parC target gene.
[0044] In some specific embodiments, the determination of the target gene of Rudgeria MC10 comprises the following method:
[0045] (1) Based on the genomes of more than 500 Rudgeria species available in our laboratory and in public databases, we constructed a phylogenetic tree and used population genomics methods to divide the populations within Rudgeria and clarify the boundary between MC10 and other Rudgeria populations;
[0046] (2) Using comparative genomics methods, we identified all single-copy homologous genes of Rudgeria, and required that all homologous genes be annotated with the same function. In this step, we found 503 homologous genes that met the requirements.
[0047] (3) Based on the phylogenetic analysis method, gene trees were generated for the homologous genes screened out in step (2), and each tree was analyzed. Genes that could distinguish different populations were selected as target genes for identification. In this step, two target genes were found, namely ATP5B and parC, which encode subunits of mitochondrial ATP synthase and subunits of DNA topoisomerase IV, respectively.
[0048] Based on ATP5B of Rudgeria and its outgroups (e.g. Figure 2 ) and parC (as Figure 3Phylogenetic trees were constructed based on the nucleic acid sequences of the strains downloaded from the public database. The different colors in the inner circle represent the different genera of the strains downloaded from the public database. The corresponding genera of each color can be seen on the left side of the phylogenetic tree (the strains without color markings are newly isolated strains in this laboratory); the different colors in the outer circle represent different populations of Rudgeria, among which the location of MC10 has been marked. It can be seen that MC10 independently forms an evolutionary branch and can be distinguished from other Rudgeria and their outgroups, indicating that the two target genes ATP5B and parC can be used to accurately identify Rudgeria MC10.
[0049] According to the provided ATP5B target gene and parC target gene, primer combinations were designed for the two genes respectively based on the basic principles of PCR primer design.
[0050] In some embodiments, the primer composition includes a first primer pair and a second primer pair.
[0051] Among them, the sequence of the first primer pair is shown in SEQ ID NO.1-SEQ ID NO.2, SEQ ID NO.1 is ATP5B-F, specifically: GGYAARACCGTTCTGATCATG; SEQ ID NO.2 is ATP5B-R, specifically: CYTTTTCCGARATCGCDCGG. The first primer pair was used to amplify the ATP5B target gene of Rudgeria MC10 to obtain the sequence shown in SEQID NO.5, specifically: GAGCTGATCAACATCGCAAAAGTGCACTCGGGCTACTCGGTGTTTGCGGGTGTTGGCGAACGGACCCGTGAAGGCAACGACCTGTACTGGGAAATGATCGAATCGAACGTGATCAAGCCGGACAACCTGTCGGAATCCAAGGTGGCCCTGGTTTACGGACAGATGAACGAACCTCCCGGAGCGCGTGCGCGTGTTGCTCTGACCGGTCTGACCCTGGCCGAGCAGTTCCGCGACCAGTCCGGTAC CGACGTTCTGTTCTTCGTCGACAACATCTTCCGCTTCACACAGGCGGGCTCCGAGGTTTCGGCTCTGCTGGGTCGTATTCCTTCGGCGGTGGGCTACCAGCCAACACTGGCGACCGACATGGGCGCCCTGC AGGAACGCATCACCTCGACCAAGTCGGGCTCGATCACCTCGGTTCAGGCCATTTATGTTCCTGCGGACGACCTGACCGACCCTGCGCCTGCAACCTCGTTTGCGCACTTGGACGCGACCACCGTTCTGAA.
[0052] Among them, the sequence of the second primer pair is shown in SEQ ID NO.3-SEQ ID NO.4, SEQ ID NO.3 is parC-F, specifically: CRCTGGTSGACGGGCARGG; SEQ ID NO.4 is parC-R, specifically: CGATCAGYTTGGAYTTCTGRACCTG. The parC target gene of Rudgeria MC10 was amplified using the second primer pair to obtain the sequence shown in SEQ ID NO.6, specifically: CAACTTCGGCAATATCGACGGCGACAACCCGGCGGCCTCGCGCTACACCGAGGCGCGGATGACCATCGTGGCTGAGGCCTTGCTTGAGGGTCTGAACGAAGACGCCGTTGATTTCCGCGACAACTATGACGGCACGCTGACCGAGCCGGTCGTGCTGCCGGCGCAGTTCCCCAACCTGCTGGCCAACGGTGCCAGCGGTATCGCGGTGGGCATGGCGACCAACATTCCGCCG CATAACATCTCGGAGCTCTGCGATGCCTGTCTGCACCTGATCAAAACGCCGGACGCGCGTGACGACACGCTATTGAACTACGTTCCCGGTCCTGACTTTCCAACTGGCGGCGTGATCGTTGAG CCGCCCGAGAACATTGCTCAGGCCTATCGGACTGGGCGCGGCTCTTTCCGTCTGCGCTGCAAATACGAGGTTGAAGATCTTGGTCGGGGTCAATGGCAGATCATTGTCACAGAGATTCCCTAT.
[0053] A second aspect of an embodiment of the present application provides a kit for rapid identification of Rudgeria MC10, the kit comprising the above-mentioned primer composition for rapid identification of Rudgeria MC10.
[0054] A second aspect of an embodiment of the present application provides a kit for rapid identification of Bacillus rugiperda MC10, the kit comprising the above-mentioned primer combination for rapid identification of Bacillus rugiperda MC10; therefore, by using the kit for analysis, it is possible to rapidly and accurately identify Bacillus rugiperda MC10, and the detection time is short, the operation is simple, and the cost is low, which is conducive to wide promotion and application.
[0055] In some embodiments, in the primer composition for rapid identification of Rudgeria MC10, the concentration of the primers shown by SEQ ID NO.1-SEQ ID NO.4 is 10 μM.
[0056] In some embodiments, the kit further comprises an amplification reaction system; wherein the amplification reaction system comprises a 2×Taq preformed enzyme reaction solution.
[0057] In some embodiments, the procedure of the amplification reaction system is: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, setting 35 cycles, extension at 72°C for 10 min; and storage at 4°C.
[0058] A third aspect of the embodiments of the present application provides a use of the above-mentioned kit for rapid identification of Bacillus rugiperda MC10 in specifically detecting Bacillus rugiperda MC10 in pure bacterial samples or complex samples.
[0059] The third aspect of the embodiment of the present application provides a kit for rapid identification of Bacillus MC10 for use in specifically detecting Bacillus MC10 in pure bacterial samples or complex samples; since the kit for rapid identification of Bacillus MC10 includes a primer combination with high specificity for detecting the target gene of Bacillus MC10, the target gene of Bacillus MC10 can be amplified in pure bacterial samples or complex samples, thereby quickly and accurately identifying Bacillus MC10.
[0060] The fourth aspect of the embodiment of the present application provides a detection method using the above-mentioned kit for rapid identification of Rudgeria MC10, comprising the following steps:
[0061] S01. Provide a DNA template solution of the sample to be tested;
[0062] S02. The primer composition in the kit for rapid identification of Rudgeria MC10 is used to perform a PCR amplification reaction on the DNA template liquid to obtain a PCR product;
[0063] S03. The PCR products are verified, purified, and sequenced in sequence, and the sequencing results are analyzed to determine whether Rudgeria MC10 exists in the sample to be tested.
[0064] The fourth aspect of the embodiment of the present application provides a detection method using the above-mentioned kit for rapid identification of Rudgeria MC10. The detection method is simple to operate, low in cost, does not require large-scale instruments and equipment, and is suitable for analysis on a variety of sequencing platforms.
[0065] In step S01, a DNA template solution of a sample to be tested is provided.
[0066] In some embodiments, the sample to be tested includes a pure bacterial colony or a complex environmental sample.
[0067] In some specific embodiments, when the sample to be tested is a pure colony, the strain to be tested is cultured in a solid culture medium until a single clone grows significantly, and then a suitable amount of the biological sample is picked up from the solid culture medium with a sterilized pipette tip and fully resuspended in 50ul of 10% chelex solution; the chelex solution mixed with the bacteria is placed in a PCR instrument and incubated at 99 degrees for 20 minutes to lyse the bacteria and release the DNA, thereby obtaining the DNA template liquid of the sample to be tested.
[0068] In some specific embodiments, when the sample to be tested is a complex environmental sample, a standard DNA extraction kit (such as Qiagen DNeasy PowerSoil Pro Kits) is used to extract the total DNA of the sample to be tested. The final DNA sample should be dissolved in 50 μL of sterile MillQ water, the concentration should be at least 20 ng / μL, and diluted to 20 ng / μL with sterile MillQ water for use.
[0069] In step S02, the primer combination in the above-mentioned kit for rapid identification of Rudgeria MC10 is used to perform PCR amplification reaction on the DNA template liquid to obtain a PCR product.
[0070] In some embodiments, the system of PCR amplification reaction is 20 μL, wherein the concentration of the upstream primer is 10 μM and the amount added is 1 μL; the concentration of the downstream primer is 10 μM and the amount added is 1 μL; the amount of DNA template liquid added is 1 μL, the amount of 2×Taq preformed enzyme reaction liquid added is 10 μL, and the amount of sterilized MillQ water added is 7 μL.
[0071] In some embodiments, the procedure of the amplification reaction system is: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, setting 35 cycles, extension at 72°C for 10 min; and storage at 4°C.
[0072] In step S03, the PCR products are verified, purified, and sequenced in sequence, and the sequencing results are analyzed to determine whether Rudgeria MC10 exists in the sample to be tested.
[0073] In some embodiments, the verification includes a preliminary verification method using agarose gel electrophoresis analysis, in which the PCR product is first subjected to electrophoresis analysis to preliminarily determine whether the theoretical amplified sequence length of the PCR product is accurate.
[0074] In some embodiments, the theoretical amplified sequence length of ATP5B should be 509 bp, and the theoretical amplified sequence length of parC should be 478 bp.
[0075] The PCR products with the correct bands are further purified and sequenced.
[0076] In some embodiments, the sequencing method comprises Sanger sequencing or Illumina sequencing.
[0077] In some specific embodiments, when the sample to be tested is a pure colony, Sanger sequencing can be used to sequence the PCR product with an accurate theoretical amplification sequence length, and the sequencing result can be compared with the target sequence to determine whether the strain to be tested is Rudgeria MC10.
[0078] In some specific embodiments, when the sample to be tested is a complex environmental sample, illumina sequencing can be used. The specific method includes: purifying the PCR product with the correct band, constructing an illumina sequencing standard library, and performing high-throughput sequencing; according to the results of the sequencing, obtaining the ATP5B or parC gene sequence information of the environmental sample to be tested or the mixed bacterial sample, comparing it with the target sequence, and performing phylogenetic analysis and relative quantitative analysis, so as to determine whether Rudgeria MC10 exists in the complex sample and calculate the relative abundance of MC10.
[0079] The following describes the invention in conjunction with specific embodiments.
[0080] Example 1
[0081] Identification of pure bacteria by colony PCR
[0082] (1) After the strain to be tested is cultured in a solid culture medium until a single clone grows out, an appropriate amount of biological sample is picked up from the solid culture medium with a sterilized pipette tip and fully resuspended in 50 uL of 10% chelex solution;
[0083] (2) Place the chelex solution mixed with bacteria in a PCR instrument and incubate at 99 degrees for 20 minutes to lyse the bacteria and release the DNA.
[0084] (3) The first primer pair ATP5B-F / R shown in the synthesized SEQ ID NO.1-SEQ ID NO.2 and the second primer pair parC-F / R shown in SEQ ID NO.3-SEQ ID NO.4 were used as primers, respectively, and the DNA in step (2) was used as a template for PCR amplification. The reaction system was 20 μL, wherein the concentration of the upstream primer was 10 μM, and the amount added was 1 μL; the concentration of the downstream primer was 10 μM, and the amount added was 1 μL; the amount added of the DNA template solution was 1 μL, the amount added of the 2×Taq preformed enzyme reaction solution was 10 μL, and the amount added of the sterilized MillQ water was 7 μL. Moreover, the program of the amplification reaction system was: 95°C pre-denaturation for 3 min, 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 1 min, 35 cycles were set, 72°C extension for 10 min; and 4°C storage.
[0085] (4) The PCR products were verified by running gel and the PCR products with correct bands were sequenced by Sanger sequencing.
[0086] (5) Compare the sequencing results with the target sequence to determine whether the strain to be tested is Rudgeria MC10.
[0087] Result analysis:
[0088] ① Run gel verification on the PCR product, such as Figure 4 As shown, lanes 1-3 are the amplified products of ATP5B, and lanes 4-6 are the amplified products of parC. The theoretical amplified sequence length of ATP5B should be 509 bp, and the theoretical amplified sequence length of parC should be 478 bp.
[0089] ②Compare the sequencing results with the target sequence. The ATP5B target sequence is as follows: Figure 5 As shown, the parC target sequence is as Figure 6 As shown in the figure, it can be seen that the sequence differences between the sequencing results and the target sequence are 110bp and 361bp respectively when ATP5B or parC is used for identification. However, the sequence difference between MC0 and MC10 is 0bp when 16S rRNA is used for colony PCR identification. Therefore, it can be seen that the accuracy of identification using ATP5B or parC is higher than that using 16S.
[0090] Example 2
[0091] Identification of MC10 in complex samples using high-throughput sequencing
[0092] (1) Use a standard DNA extraction kit (such as Qiagen DNeasy PowerSoil Pro Kits) to extract the total DNA of the sample to be tested. The final DNA sample should be dissolved in 50 μL of sterile MillQ water. The concentration should be at least 20 ng / μL and diluted to 20 ng / μL with sterile MillQ water for later use;
[0093] (2) The first primer pair ATP5B-F / R shown in the synthesized SEQ ID NO.1-SEQ ID NO.2 and the second primer pair parC-F / R shown in SEQ ID NO.3-SEQ ID NO.4 were used as primers, respectively, and the DNA in step (2) was used as a template for PCR amplification. The reaction system was 20 μL, wherein the concentration of the upstream primer was 10 μM, and the amount added was 1 μL; the concentration of the downstream primer was 10 μM, and the amount added was 1 μL; the amount added of the DNA template solution was 1 μL, the amount added of the 2×Taq preformed enzyme reaction solution was 10 μL, and the amount added of the sterilized MillQ water was 7 μL. In addition, the program of the amplification reaction system was: 95°C pre-denaturation for 3 min, 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 1 min, 35 cycles were set, 72°C extension for 10 min; and 4°C storage.
[0094] (3) Performing gel running verification on the PCR product obtained in step (2), purifying the PCR product with the correct band, and constructing an Illumina sequencing standard library for high-throughput sequencing;
[0095] (4) According to the sequencing results in step (3), the ATP5B or parC gene sequence information of the environmental sample or mixed bacterial sample to be tested is obtained, which is compared with the target sequence, and phylogenetic analysis and relative quantitative analysis are performed to determine the presence or absence of Rudgeria MC10 in the complex sample and calculate the relative abundance of MC10.
[0096] Result analysis:
[0097] ① Run gel verification on the PCR product, such as Figure 7 As shown, the provided complex sample includes six different biological samples, namely S5M1, S5M2, S6M1, S6M2, S7M1, and S7M2.
[0098] In summary, the primer combination for rapid identification of Bacillus rugiperda MC10 provided in the present application can be used to detect the target gene of Bacillus rugiperda MC10, wherein the target gene provided is screened out based on comparative genomics and phylogenetic analysis methods, therefore, the provided primer combination has higher accuracy and a resolution much higher than 16S rRNA by cloning and then analyzing the target gene; moreover, high-sensitivity and rapid detection of Bacillus rugiperda MC10 in different environmental samples and pure bacterial samples can be achieved, and the needs for its identification can be fully met in the application stage of Bacillus rugiperda MC10.
[0099] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.
Claims
1. A primer combination for rapid identification of Rudgeria MC10, characterized in that: The primer combination is used to detect the target gene of the Rudgeria MC10, and includes a first primer pair and a second primer pair. The sequence of the first primer pair is shown in SEQ ID NO.1-SEQ ID NO.2, and the sequence of the second primer pair is shown in SEQ ID NO.3-SEQ ID NO.
4.
2. The primer composition for rapid identification of Rudgeria MC10 according to claim 1, characterized in that: The target genes of Rudgeria MC10 include ATP5B target gene and parC target gene; wherein, the ATP5B target gene of Rudgeria MC10 is amplified using the first primer pair to obtain the sequence shown in SEQ ID NO.5; the parC target gene of Rudgeria MC10 is amplified using the second primer pair to obtain the sequence shown in SEQ ID NO.
6.
3. A kit for rapid identification of Rudgeria MC10, characterized in that: The kit comprises the primer combination for rapid identification of Rudgeria MC10 according to any one of claims 1 or 2.
4. The kit for rapid identification of Rudgeria MC10 according to claim 3, characterized in that: In the primer composition for rapid identification of Rudgeria MC10, the concentration of the primers shown in SEQ ID NO.1 to SEQ ID NO.4 is 10 μM.
5. The kit for rapid identification of Rudgeria MC10 according to claim 3, characterized in that: The kit also includes an amplification reaction system; wherein the amplification reaction system includes a 2×Taq preformed enzyme reaction solution.
6. The kit for rapid identification of Rudgeria MC10 according to claim 5, characterized in that: The procedure of the amplification reaction system is: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, setting 35 cycles, extension at 72°C for 10 min; and storage at 4°C.
7. Use of the kit for rapid identification of Bacillus rugiperda MC10 as claimed in any one of claims 3 to 6 in specifically detecting Bacillus rugiperda MC10 in pure bacterial samples or complex samples.
8. A detection method using the kit for rapid identification of Rudgeria MC10 according to any one of claims 3 to 6, characterized in that: The steps include: Provide DNA template solution of the sample to be tested; Using the primer combination in the kit for rapid identification of Rudgeria MC10 according to claim 3 to perform PCR amplification reaction on the DNA template liquid to obtain a PCR product; The PCR products are verified, purified, and sequenced in sequence, and the sequencing results are analyzed to determine whether Rudgeria MC10 exists in the sample to be tested.
9. The detection method of the kit for rapid identification of Rudgeria MC10 according to claim 8, characterized in that: The system of the PCR amplification reaction is 20 μL, wherein the concentration of the upstream primer is 10 μM and the amount added is 1 μL; the concentration of the downstream primer is 10 μM and the amount added is 1 μL; the amount added of the DNA template liquid is 1 μL, the amount added of the 2×Taq preformed enzyme reaction liquid is 10 μL, and the amount added of the sterilized MillQ water is 7 μL.
10. The detection method of the kit for rapid identification of Rudgeria MC10 according to claim 8, characterized in that: The sample to be tested includes a pure bacterial colony or a complex environmental sample; and / or, The sequencing method includes Sanger sequencing or Illumina sequencing.