Use of FBXO42-specific inhibitors in treatment of Notch signal dependent diseases

Abstract

The present invention provides a method of treating a Notch signal dependent disease in a subject with an FBXO42 specific inhibitor. The Notch signal dependent disease is selected from leukemia. The invention also provides a method for screening drugs for treating Notch signal dependent diseases by using the FBXO42 as a target spot.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to PCT patent application No. PCT / CN2022 / 104922 filed on July 11, 2022, the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present disclosure generally relates to methods of downregulating FBXO42 using relevant inhibitors to treat Notch signaling-dependent diseases. Background Art

[0003] The Notch signaling pathway is one of the most severely dysregulated pathways in cancer. Alterations, including activating mutations and increased Notch pathway activity, contribute to cancer progression, particularly acute T-lymphoblastic leukemia / lymphoma (T-ALL) ( A. P. Weng et al., Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306, 269-271 (2004) )、Chronic lymphocytic leukemia (C-ALL) ( X. S. Puente et al., Non-coding recurrent mutations in chronic lymphocytic leukaemia. Nature 526, 519-524 (2015) ), diffuse large B-cell lymphoma (DLBCL) ( K. Karube et al., Integrating genomic alterations in diffuse large B-cell lymphoma identifies new relevant pathways and potential therapeutic targets. Leukemia 32, 675-684 (2018) )、Head and neck squamous cell carcinoma (HNSCC) ( N. Agrawal et al., Exome sequencing of head and neck squamous cell carcinoma reveals inactivating mutations in NOTCH1. Science 333, 1154-1157 (2011); N. Stransky et al., The mutational landscape of head and neck squamous cell carcinoma. Science 333, 1157-1160 (2011); N. Stransky et al., The mutational landscape of head and neck squamous cell carcinoma. Science 333, 1157-1160 (2011)) and breast cancer ( D. R. Robinson et al., Functionally recurrent rearrangements of the MAST kinase and Notch gene families in breast cancer. Nat Med 17, 1646-1651 (2011); S. Stylianou, R. B. Clarke, K. Brennan, Aberrant activation of notch signaling in human breast cancer. Cancer Res 66, 1517-1525 (2006) ). Therapeutic strategies to modulate Notch pathway function include chemical and immunological targeting of Notch receptors, delta ligands, and gamma-secretase ( Y. Wu et al., Therapeutic antibody targeting of individual Notch receptors. Nature 464, 1052-1057 (2010); M. Lopez-Guerra et al., Specific NOTCH1 antibody targets DLL4-induced proliferation, migration, and angiogenesis in NOTCH1-mutated CLL cells. Oncogene 39, 1185-1197 (2020); P. J. Real et al., Gamma-secretase inhibitors reverse glucocorticoid resistance in T cell acute lymphoblastic leukemia. Nat Med 15, 50-58 (2009) ). Although the Notch pathway has been studied over the past few decades, pharmaceutical compounds targeting Notch activity remain underutilized in clinical settings, particularly in Notch-activated T-cell leukemias. To date, γ-secretase inhibitors are the most extensively studied potential anticancer agents in these settings. However, due to the side effects caused by γ-secretase inhibitors in clinical settings ( J. H. van Es et al., Notch / gamma- secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature 435, 959-963 (2005) ) and because mutant Notch does not require γ-secretase cleavage to be activated ( A. P. Weng et al., Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306, 269-271 (2004) ), there is still an urgent need to develop new strategies by identifying novel molecular targets, especially downstream components of Notch activation.

[0004] Recombination signal-binding protein of immunoglobulin kappa J region (RBPJ), a transcription factor in the Notch signaling pathway, plays a dual role in regulating Notch signaling. In the absence of the Notch intracellular domain (NICD), RBPJ acts as a transcriptional repressor of Notch target genes by interacting with co-repressor complexes such as histone deacetylases ( H. Y. Kao et al., A histone deacetylase corepressor complex regulates the Notch signal transduction pathway. Genes Dev 12, 2269-2277 (1998) ), lysine-specific histone demethylase 1A ( P. Mulligan et al., A SIRT1-LSD1 corepressor complex regulates Notch target gene expression and development. Mol Cell 42, 689-699 (2011) ) and lethal (3) malignant brain tumor-like protein 3 (L3MBTL3) ( T. Xu et al., RBPJ / CBF1 interacts with L3MBTL3 / MBT1 to promote repression of Notch signaling via histone demethylase KDM1A / LSD1. EMBO J 36, 3232-3249 (2017) ) to exert its effects. Once Notch is activated, RBPJ binds to NICD and masterminds (MAML) to form a ternary complex, recruiting coactivators such as histone acetyltransferase p300 and GCN5, and triggering the transcription of Notch target genes ( H. Kurooka, T. Honjo, Functional interaction between the mouse notch1 intracellular region and histone acetyltransferases PCAF and GCN5. J Biol Chem 275, 17211-17220 (2000) ).

[0005] Despite progress in the past decade in describing the molecular architecture of transcriptional complexes, the mechanism of RBPJ functional switching remains unclear, making it difficult to target Notch transcriptional steps. RBPJ depletion leads to inactivation of Notch signaling in certain cellular contexts ( E. Vasyutina et al., RBP-J (Rbpsuh) is essential to maintain muscle progenitor cells and to generate satellite cells. Proc Natl Acad Sci U S A 104, 4443-4448 (2007) ), while in other cases it leads to activation of Notch signaling ( I. Kulic et al., Loss of the Notch effector RBPJ promotes tumorigenesis. J Exp Med 212, 37-52 (2015) ), so pharmacological treatment targeting RBPJ is very risky in Notch-related cancers.

[0006] RBPJ / NICD dimerization is suspected to be the stabilizing event that enables RBPJ binding ( Y. Nam, P. Sliz, W. S. Pear, J. C. Aster, S. C. Blacklow, Cooperative assembly of higher-order Notch complexes functions as a switch to induce transcription. Proc Natl Acad Sci U S A 104, 2103-2108 (2007); M. R. Hass et al., SpDamID: Marking DNA Bound by Protein Complexes Identifies Notch-Dimer Responsive Enhancers. Mol Cell 59, 685-697 (2015); H. Liu et al., Notch dimerization is required for leukemogenesis and T-cell development. Genes Dev 24, 2395-2407 (2010) ); however, the DNA binding affinity of RBPJ is unexpectedly low (Kd ∼1 μM) ( R. Torella et al., A combination of computational and experimental approaches identifies DNA sequence constraints associated with target site binding specificity of the transcription factor CSL. Nucleic Acids Res 42, 10550-10563 (2014) ), and the binding of NICD to RBPJ does not affect the binding affinity of RBPJ to DNA ( R. Torella et al., A combination of computational and experimental approaches identifies DNA sequence constraints associated with target site binding specificity of the transcription factor CSL. Nucleic Acids Res 42, 10550-10563 (2014) ). Is the plasticity of RBPJ binding to DNA due to auxiliary factors that can sense chromatin structure? (R. Liefke et al., Histone demethylase KDM5A is an integral part of the core Notch-RBP-J repressor complex. Genes Dev 24, 590-601 (2010); F. Oswald et al., A phospho-dependent mechanism involving NCoR and KMT2D controls a permissive chromatin state at Notch target genes. Nucleic Acids Res 44, 4703-4720 (2016) ), or whether RBPJ cooperates with other DNA-binding proteins to prolong its association with chromatin ( A. S. Geimer Le Lay et al., The tumor suppressor Ikaros shapes the repertoire of notch target genes in T cells. Sci Signal 7, ra28 (2014); S. Chari, S. Winandy, Ikaros regulates Notch target gene expression in developing thymocytes. J Immunol 181, 6265-6274 (2008) Regardless, the role of RBPJ is controversial and context-dependent, and the mechanisms by which the RBPJ transcriptional switch is fine-tuned remain to be elucidated.

[0007] In this study, we established a detailed RBPJ interactome by tandem affinity purification coupled to mass spectrometry (TAP-MS) and explored key potential regulators of RBPJ transcriptional activity. We found that FBXO42 physically and functionally interacts with RBPJ, mediating its K63-linked polyubiquitination and contributing to its association with chromatin, whose conformation is subsequently opened and Notch signaling is activated. Both genetic knockout (KO) of FBXO42 and pharmacological inhibition of FBXO42 action attenuated leukemia progression in vivo, demonstrating therapeutic value in Notch-related diseases. Summary of the invention

[0008] The present disclosure provides a new method for treating Notch signaling-dependent diseases. In certain embodiments, the present disclosure provides a method for treating Notch signaling-dependent diseases by using a FBXO42-specific inhibitor, wherein the FBXO42-specific inhibitor may be a polypeptide antagonist specific for FBXO42, a polynucleotide specific for FBXO42, or a small molecule compound inhibitor specific for FBXO42. Preferably, the Notch signaling-dependent disease includes an activating mutation and / or amplification of Notch gene and / or Notch pathway activity, and preferably, the Notch signaling-dependent disease is selected from leukemia, myeloma, lymphoma, breast cancer, liver cancer, head and neck squamous cell carcinoma (HNSCC), lung cancer and other cancers carrying an activating mutation and / or amplification of Notch gene and / or Notch pathway activity.

[0009] On the one hand, the present disclosure provides a FBXO42-specific inhibitor for treating Notch signal-dependent diseases. The FBXO42 inhibitor is selected from a polypeptide antagonist specific for FBXO42, a polynucleotide specific for FBXO42, or a small molecule compound inhibitor specific for FBXO42. Preferably, the Notch signal-dependent disease includes an activating mutation and / or enhancement of Notch gene and / or Notch pathway activity, and preferably, the Notch signal-dependent disease is selected from leukemia, myeloma, lymphoma, breast cancer, liver cancer, head and neck squamous cell carcinoma (HNSCC), lung cancer and other cancers carrying an activating mutation and / or enhancement of Notch gene and / or Notch pathway activity.

[0010] In one aspect, the present invention provides the use of a FBXO42-specific inhibitor in the preparation of a drug for treating a Notch signal-dependent disease. The FBXO42 inhibitor is a polypeptide antagonist specific for FBXO42, a polynucleotide specific for FBXO42, or a small molecule compound inhibitor specific for FBXO42. Preferably, the Notch signal-dependent disease includes an activating mutation and / or enhancement of the Notch gene and / or Notch pathway activity. Preferably, the Notch signal-dependent disease is selected from leukemia, myeloma, lymphoma, breast cancer, liver cancer, head and neck squamous cell carcinoma (HNSCC), lung cancer and other cancers carrying an activating mutation and / or enhancement of the Notch gene and / or Notch pathway activity.

[0011] In one embodiment, the small molecule compound is a small molecule inhibitor targeting NEDD8 activating enzyme (NAE).

[0012] In one embodiment, the polypeptide antagonist is an anti-FBXO42 antibody.

[0013] In one embodiment, the polynucleotide is selected from the group consisting of siRNA, shRNA, guide RNA, miRNA and ASO.

[0014] In certain embodiments, the polynucleotide specific for FBXO42 comprises a nucleotide sequence of SEQ ID NO: 1, a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 99% or higher identity with SEQ ID NO: 1, or an amino acid sequence having one or more additions, deletions and / or substitutions of amino acids compared to SEQ ID NO: 1, and the polynucleotide specific for FBXO42 is capable of preventing the binding of a ligand such as.

[0015] In one embodiment, the Notch signal-dependent disease is selected from leukemias such as acute T lymphocytic leukemia or chronic lymphocytic leukemia, myelomas such as multiple myeloma, lymphomas such as Hodgkin lymphoma, Burkitt lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma, breast cancer, liver cancer, lung cancer, head and neck squamous cell carcinoma (HNSCC) and lung adenocarcinoma cells. The leukemia is acute T lymphocytic leukemia or chronic lymphocytic leukemia. In a specific embodiment, the disease is any type of leukemia. These diseases have Notch signal activation or upregulation, preferably, the Notch signal-dependent disease includes Notch-related mutations, more preferably, Notch-related mutations include Notch1, Notch2 and / or Notch3 mutations.

[0016] In one embodiment, the subject is a non-human mammal or a human.

[0017] On the other hand, the present invention provides a method for screening drugs for treating Notch signal-dependent diseases using FBXO42 as a target, the method comprising: observing the effect of a candidate drug on the expression or activity level of FBXO42, and if the candidate drug can inhibit the expression or activity level of FBXO42, it indicates that the candidate drug is a potential drug for treating Notch signal-dependent diseases. In one embodiment, the Notch signal-dependent disease is selected from leukemias such as acute T lymphocytic leukemia or chronic lymphocytic leukemia, myelomas such as multiple myeloma, lymphomas such as Hodgkin lymphoma, Burkitt lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma, breast cancer, liver cancer, lung cancer, head and neck squamous cell carcinoma (HNSCC) and lung adenocarcinoma cells. The leukemia is acute T lymphocytic leukemia or chronic lymphocytic leukemia. In a specific embodiment, the disease is any type of leukemia. These diseases have Notch signal activation or upregulation, preferably, the Notch signal-dependent disease includes Notch-related mutations, more preferably, Notch-related mutations include Notch1, Notch2 and / or Notch3 mutations. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1FBXO42 is shown to be a novel interactor of RBPJ and a positive regulator of the Notch pathway. (A) Interaction network of RBPJ. HCIPs were grouped based on their cellular functions as indicated by GO analysis and literature search. Ubiquitination (Ub) / ubiquitin-like (UbL)-related proteins, proteins that are potential positive and negative regulators are indicated by dots of different colors. Signaling pathways and proteins reported to be involved in Notch pathway regulation are indicated by texts of different colors. NER, nuclear excision repair; BER, base excision repair; Th1 / Th2, T Helper 1 / 2 cells. (B and C) Expression of L3MBTL3 (B) and Notch target genes (C) were evaluated in WT and L3MBTL3-KO HEK293T cells. (D and E) Expression of FBXO42 (D) and Notch target genes (E) were evaluated in WT and FBXO42-KO HEK293T cells. (F and G) GFP reporter (F) and luciferase assays (G) were performed to evaluate Notch signaling activity in WT and FBXO42-KO HEK293T cells. (HJ) The expression levels of FBXO42 in the indicated Notch-related cancers were analyzed using the TCGA dataset. (K and L) The expression levels of FBXO42 in various cancer cell lines (K) and T-ALL cell lines (L) from the Cancer Cell Line Encyclopedia (https: / / sites.broadinstitute.org / ccle). (M and N) The expression correlation of FBXO42 and Notch pathway target genes in DLBCL and AML patients was analyzed using the UALCAN database (https: / / software.broadinstitute.org / morpheusualcan.path.uab.edu / home). (BG, n = 3) Quantitative data are presented as mean ± SEM from three independent experiments. Two-tailed Student's t test was used for calculation P value. P <0.05, P <0.001, P <0.0001, NS, not significant.

[0019] Figure 2Enrichment analysis and validation of RBPJ interactors, and the association of FBXO42 with the Notch pathway are shown. (AC) Biological process (A), cellular component (B), and KEGG enrichment (C) analysis of genes encoding RBPJ interactors. The x-axis represents gene ratio = count / set size. The size of the dot represents the number of genes associated with the GO term, and the color of the dot represents the adjusted P value. (D) The optimal RBPJ interactors identified in this study were selected for co-immunoprecipitation (co-IP) assays to validate their interaction with RBPJ. HEK293T cells were co-transfected with Myc-tagged constructs and cSFB-tagged RBPJ. Cell lysates were incubated with S beads. 5% lysate was used as input control. Blots show antibodies recognizing FLAG- and Myc-epitope tags and actin. (E and F) Expression levels of FBXO42 in HNSCC (E) and ALL (F) patients from the TCGA dataset. (G) Expression correlation between FBXO42 and Notch target genes in ALL patients using the GEO dataset. Calculated using a two-tailed Student's t-test P value. P <0.05, P <0.0001.

[0020] Figure 3FBXO42 is shown to directly interact with RBPJ. (A) Interaction network of FBXO42. The top 50 interactors identified in TAP-MS are shown. (B) KEGG enrichment analysis of the capture (prey) obtained in FBXO42 tandem affinity purification (TAP)-MS. The x-axis represents gene ratio = count / set size. The size of the point represents the number of genes associated with the GO term, and the color of the point represents the adjusted P value. (C) Circos plot showing overlapping RBPJ and FBXO42 captures. Purple lines connect genes shared by RBPJ and FBXO42. Blue lines connect different genes enriched in the same ontology term. (D and E) HEK293T cell lysates were incubated with IgG control and antibodies against FBXO42 (D) or RBPJ (E). 5% lysate was used as input control. Blots show antibodies recognizing RBPJ, FBXO42, and actin. (F and G) HEK293T cells were co-transfected with Myc-tagged FBXO42 and cSFB-tagged RBPJ as indicated. Cell lysates were incubated with S beads (F) or anti-MYC antibody (G). 5% lysate was used as input control. Blots show antibodies recognizing FLAG and MYC epitope tags and actin. (H) Coomassie blue staining of cSFB-tagged RBPJ and FLAG-FBXO42 proteins purified from 293F cells. (I) Biomolecular interaction kinetic curves showing the binding affinity between purified RBPJ and FBXO42 proteins. 225 nM RBPJ was bound to the SA probe. Colors indicate the concentration gradient of FBXO42 protein (19.5 nM-625 nM). (J and K) Schematic representation of the domain deletion mutants of RBPJ (J) and FBXO42 (K) used in the domain mapping analysis. (L and M) HEK293T cells were co-transfected with Myc-tagged FBXO42 and cSFB-tagged WT or mutant RBPJ (L) or cSFB-tagged RBPJ and Myc-tagged WT or mutant FBXO42 (M). (N) HEK293T cells were co-transfected with Myc-tagged FBXO42 Kelch domain and cSFB-tagged RBPJNTD as indicated. (LN) Cell lysates were incubated with S beads. 5% lysate was used as input control. Blots show antibodies recognizing FLAG and MYC epitope tags and actin. (DI, LN, n = 3).

[0021] Figure 4FBXO42 is shown to promote RBPJ K63-linked polyubiquitination and positively regulate Notch signaling. (A) cSFB-RBPJ, hemagglutinin-ubiquitin (HA-Ub), and Myc-FBXO42 WT were co-transfected into HEK293T cells as indicated and treated with or without MG132 for 4 h. Cell lysates were incubated with S beads and analyzed by western blot for RBPJ polyubiquitination detection. (B) Immunoprecipitated endogenous RBPJ products from WT and FBXO42 KO cells were immunoblotted for Ub. (C) cSFB-RBPJ, hemagglutinin-ubiquitin (HA-Ub), and Myc-FBXO42 WT or ΔF mutant were co-transfected into HEK293T cells. Cell lysates were collected and analyzed for RBPJ polyubiquitination. (D) HEK293T cells were transfected with cSFB-RBPJ, Myc-FBXO42, and HA-Ub with or without FLAG-NICD1 overexpression. Cell lysates were incubated with S beads and analyzed by western blot for RBPJ polyubiquitination detection. (E) HEK293T cells were transfected with cSFB-RBPJ, Myc-FBXO42, or HA-Ub WT or mutants. The extent of RBPJ polyubiquitination was evaluated as described above. (F) The sequences of the predicted and identified peptides (the respective lysine residues are indicated) in mass spectrometry are shown. (G) Ubiquitination of 5 cSFB-RBPJ lysine mutants (K135R, K175R, K269R, K285R, and K315R) was evaluated. HEK293T cells were co-transfected with Myc-FBXO42, HA-Ub-K63, and cSFB-RBPJ WT or its lysine mutants as indicated. Cell lysates were incubated with S beads and analyzed by western blot for RBPJ polyubiquitination detection. (H) Sequence alignment of RBPJ in different species shows the conservation of the K175 site. (I) HEK293T cells were transfected with cSFB-RBPJ WT or K175R mutant and treated with cycloheximide (CHX) for the indicated times, and lysates were probed using an antibody against the FLAG epitope. (J) Quantification of the results shown in (I). (K) HEK293T cells were transfected with the various constructs as indicated and subsequently treated with DMSO or MLN4924. Cell lysates were analyzed for RBPJ ubiquitination. (LN) qPCR analysis of Notch target genes HES1 (L), HES5 (M), and c-MYC (N) in HEK293T cells overexpressing FBXO42, RBPJ WT, or K175R mutant. (O) mRNA expression of Notch target genes in cells treated with MLN4924. (P) Efficiency of RBPJ short interfering RNA (siRNA) detected by Western blot. (Q) qPCR analysis of Notch target genes in RBPJ-knockout cells.(R) HEK293T cells were transfected with si-Scramble or si-RBPJ and overexpressed with Myc-FBXO42, followed by qPCR analysis of Notch target gene expression. (AJ, LR, n = 3). Quantitative data are presented as mean ± SEM. Calculations were performed using a two-tailed Student's t-test or ANOVA. P values ​​for multiple comparisons. P <0.05, P <0.01, P <0.001,##P<0.01 vs .FBXO42.

[0022] Figure 5 FBXO42-mediated RBPJ polyubiquitination at lysine 175 is shown. (A) Endogenous RBPJ ubiquitination was measured after immunoprecipitation with anti-RBPJ antibody and Ub immunoblotting under FBXO42 overexpression. 5% lysate was used as input control. (B) cSFB-RBPJ, hemagglutinin-ubiquitin (HA-Ub), and Myc-FBXO42 WT or ΔK mutant were co-transfected into HEK293T cells as indicated and treated with MG132 for 4 h. Cell lysates were incubated with S beads and analyzed by western blot for RBPJ polyubiquitination detection. (C) Peptide sequences with ubiquitination modifications identified in WT and FBXO42 KO cells. (D) HEK293T cells were co-transfected with Myc-FBXO42, HA-Ub WT, and cSFB-RBPJ WT or its lysine mutants as indicated. Cell lysates were incubated with S beads and analyzed by western blot for RBPJ polyubiquitination detection. (E) Overview of peptides identified in global ubiquitination analysis after MLN4924 treatment or FBXO42 depletion. (F) Percentage of ubiquitinated peptides in different groups. (G and H) Gene Ontology analysis of these proteins with differential ubiquitination modifications. (I and J) Venn diagrams showing the overlap between the identified differential proteins and reported Notch interactors.

[0023] Figure 6FBXO42 is shown to regulate RBPJ chromatin binding and transcriptional activity. (A) WT and FBXO42-KO HEK293T cells were harvested and subjected to subcellular fractionation. Nuclear, cytoplasmic, chromatin and soluble fractions were isolated and subjected to immunoblot analysis. (B) HEK293T cells overexpressing RBPJ WT or K175R were harvested, and chromatin and soluble fractions were isolated. Immunoblotting analysis was then performed. (C) WT and FBXO42 KO HEK293T cells were co-transfected with cSFB-RBPJ and Myc-p300. Cell lysates were collected, incubated with S-protein beads and blotted with antibodies against FLAG- or MYC epitope tags. (D) WT and FBXO42-KO HEK293T cells were transfected with cSFB-RBPJ and used for S-protein bead pull-down assays. Immunoblotting was then performed with the indicated endogenous antibodies. (E) HEK293T cells expressing RBPJ WT or its K175R mutant were harvested and used for S protein bead pull-down assay. Immunoblotting was then performed with the indicated endogenous antibodies. (F) WT and FBXO42-KO HEK293T cells were transfected with cSFB-RBPJ and Myc-FBXO42 WT or ΔF mutant. Histone modifications were then assessed by western blotting using antibodies against H3K4m1 and H3K27ac. H3 and actin served as loading controls. (G) WT and FBXO42-KO HEK293T cells were collected for CUT&Tag assay. The canonical RBPJ motifs identified in the CUT&Tag assay are shown. (H) Representative images of RBPJ binding sites in known Notch pathway target genes HES1, HES4, and MYC are shown. HSP90AA1 was used as a negative control. (I) Heatmap showing RBPJ CUT&Tag read density of WT and FBXO42-KO HEK293T cells. (J) Signaling pathway enrichment of genes with differential RBPJ binding affinity based on Gene Ontology annotation. The size of the dot indicates the number of genes associated with the GO term, and the color of the dot indicates the adjusted P value. (K) Heatmap showing CUT&Tag read density of RBPJ WT and K175R mutant. (AF, n=3).

[0024] Figure 7It is shown that ubiquitinated RBPJ is more associated with chromatin and mediates its activity. (A) Subcellular fractionation for the detection of FBXO42 and its ubiquitin complex (SKP1, CUL1, RBX1). Lysates from nuclear, cytoplasmic, soluble, and chromatin fractions were used for the indicated immunoblots. (B and C) RBPJ-ubiquitinated products are mainly associated with chromatin-enriched fractions. RBPJ ubiquitination assay was performed in four subcellular fractions containing WCL, cytosol, soluble, and chromatin under FBXO42 depletion (B) or overexpression (C). (DG) Representative motifs identified in CUT&Tag assay. (H) Luciferase reporter was used to detect the effect of RBPJ K175R mutant on its transcriptional activity. (IK) JURKAT cells depleted of endogenous RBPJ were overexpressed with RBPJ WT or K175R mutant and used for CUT&Tag assay. Representative images of CUT&Tag peaks in Notch pathway target genes HES1, HES4, and MYC are shown (AC, n = 3).

[0025] Figure 8FBXO42 is shown to mediate global chromatin remodeling in an RBPJ-dependent manner. (A) WT and FBXO42 KO cells were co-transfected with cSFB-RBPJ and Myc-tagged constructs encoding epigenetic modifiers. Then, cell lysates were incubated with S-protein beads and blotted with antibodies against FLAG- or MYC-epitope tags. (B) WT and FBXO42-KO cells were co-transfected with cSFB-RBPJ and Myc-tagged constructs encoding SWI / SNF complex proteins. Then, cells were harvested and analyzed as described in (A). (C) Heatmap showing differential interactions between chromatin factors and RBPJ in WT and FBXO42 KO cells detected by mass spectrometry. (D) Enrichment analysis showing differentially interacting proteins of heterochromatin components based on Gene Ontology annotations. (E) Immunofluorescence detection of HP1α foci in WT and FBXO42-KO cells. Scale bar, 10 μm. (F) The number of HP1α foci and the percentage of HP1α foci area were calculated using Image J software. (G) WT and FBXO42-KO cells were digested with micrococcal nuclease (MNase) for 3 min, and chromatin relaxation was monitored by releasing nucleosomes. (H) After chromatin isolation, chromatin binding of SWI / SNF subunits SMARCA2, SMARCA4, and SMARCC2 in WT and FBXO42-KO cells was analyzed using Western blot. ORC2 served as a loading control. (I) WT and FBXO42-KO cells were digested with DNase I for 3 min and then analyzed by agarose gel electrophoresis. (J) Chromatin from WT and FBXO42 KO cells was isolated, digested with DNase I, and used as a substrate for accessibility assays. (K) Heat map view of ATAC-seq signal intensity at transcription start sites in WT and FBXO42 KO JURKAT cells. (L) ATAC-seq peaks at the MYC locus and H3K4m1, H3K4m3, H3K27ac ChIP-seq peaks and DNase-seq peaks downloaded from the ENCODE database were analyzed. (A, B, EJ, n = 3). Quantitative data are presented as mean ± SEM. Calculations were performed using a two-tailed Student's t-test. P value. P <0.05, P <0.01.

[0026] Figure 9The effect of the FBXO42-RBPJ axis on chromatin remodeling is shown. (A) HEK293T cells were transfected with cSFB-RBPJ WT or K175R and Myc-tagged constructs encoding epigenetically modified proteins. Then, cell lysates were incubated with S-protein beads and blotted with antibodies against FLAG- or MYC-epitope tags. (n=3). (B) Heatmap view of differential interactions between chromatin factors identified by mass spectrometry and RBPJ WT or its K175R mutant. (CG) Volcanoplot of differentially interacting proteins showing tandem affinity purification coupled to mass spectrometry (TAP-MS) of heterochromatin components. Proteins involved in chromatin remodeling are labeled. (H) ATAC-seq peaks at the HES1 locus and H3K4m1, H3K4m3, H3K27ac ChIP-seq peaks and DNase-seq peaks downloaded from the ENCODE database were analyzed. (I and J) ChIP-qPCR for H3K4me3 (I) and H3K27ac (J) enrichment at Notch target gene promoter sites in JURKAT cells.

[0027] Figure 10 It is shown that FBXO42 plays an important role in Notch signaling-dependent leukemogenesis. (A) Western blotting was performed in various leukemia cell lines with antibodies recognizing FBXO42 and actin. PBSC represents healthy hematopoietic cells. (B) CRISPR / Cas9-mediated KO of FBXO42 in JURKAT and HSB2 cells was determined by western blotting. (C and D) The mRNA levels of Notch target genes in WT and FBXO42-KO JURKAT (C) and HSB2 (D) cells were determined by qPCR. (E and F) The levels of RBPJ in different fractions were determined in WT and FBXO42-KO JURKAT (E) and HSB2 (F) cells, as shown in Figure 3. Figure 6As shown in A. (G) Chromatin binding of SWI / SNF subunits SMARCA2, SMARCA4, and SMARCC2 in WT and FBXO42-KO leukemia cells was analyzed by Western blotting after chromatin isolation. (HK) The invasion ability of WT and FBXO42-KO JURKAT (H) and HSB2 (J) cells was measured using the Matrigel 3D culture system. Scale bar, 50 μm. The average diameter of the spheroids was determined (I and K). (LO) The migration ability of WT and FBXO42-KO JURKAT (L) and HSB2 (N) cells was measured using the Transwell migration assay. Scale bar, 200 μm. The number of cells that migrated into the lower chamber was counted (M and O). (PS) The anchorage-independent tumorigenicity of WT and FBXO42-KO JURKAT (P) and HSB2 (R) cells was measured using the soft agar colony formation assay. The number of colonies in P and R (Q and S) were counted, respectively. (TY) FBXO42 function is dependent on the presence of RBPJ. The KO efficiency of RBPJ in JURKAT (T) and HSB2 (W) cells was determined by Western blotting. The mRNA levels of Notch target genes in WT and RBPJ-KO JURKAT (U) and HSB2 (X) cells were determined by qPCR. The mRNA levels of Notch target genes in RBPJ-KO JURKAT (V) and HSB2 (Y) cells overexpressing FBXO42 were determined by qPCR. (AY, n = 3) Quantitative data are presented as mean ± SEM from three independent experiments. Calculated using two-tailed Student's t-test P One-way ANOVA analysis P Values ​​for multiple comparisons. P <0.01, P <0.001. ##P<0.01 for data in (V) and (Y) vs. FBXO42.

[0028] Figure 11RBPJ is shown to positively regulate leukemia cell invasion and tumorigenesis. (AD) The invasion ability of WT and RBPJ-KO JURKAT (A) and HSB2 (C) cells was measured using the Matrigel 3D culture system. Scale bar, 50 μm. The average diameter of the spheres formed in A and C were summarized (B and D), respectively. (EH) The anchorage-independent tumorigenesis ability of WT and RBPJ-KO JURKAT (E) and HSB2 (G) cells was measured using a soft agar colony formation assay. The number of colonies in E and G was counted and summarized (F and H). (AH, n = 3). Quantitative data are presented as mean ± SEM. Calculations were made using a two-tailed Student's t-test. P value. P <0.01, P <0.001.

[0029] Figure 12 The ubiquitination ligase function of FBXO42 required for Notch signaling-dependent leukemogenesis is shown. FBXO42-KO cells were rescued with WT FBXO42 or F-box deletion mutants and used for the following studies. (AC) mRNA levels of Notch target genes in treated HEK293T (A), JURKAT (B), and HSB2 (C) cells were determined by qPCR. (DG) The invasion ability of treated JURKAT (D) and HSB2 (F) cells was assessed using the Matrigel 3D culture system. Scale bar, 50 μm. The respective average diameters of spheres in D and F are summarized (E and G), respectively. (HK) Anchorage-independent growth of rescued JURKAT (H) and HSB2 (J) cells was measured using a soft agar colony formation assay. The number of colonies in H and J was counted and summarized (I and K). (L) JURKAT and HSB2 cells were treated with MLN4924 in a concentration gradient manner for 36 h, and then cell viability was assessed using the Cell Counting Kit-8 assay. (M and N) Expression of Notch target genes in MLN4924-treated JURKAT (M) and HSB2 (N) cells was determined by qPCR. (OR) Anchorage-independent growth of MLN4924-treated JURKAT (O) and HSB2 (Q) cells was measured using a soft agar colony formation assay. The number of colonies was counted and summarized (P and R). (AR, n = 3) Data are shown as mean ± SEM from independent experiments. Calculated using one-way ANOVA P Values ​​were used for multiple comparisons or two-tailed Student's t test. P <0.05, P <0.01, P<0.001.

[0030] Figure 13 It was shown that genetic and pharmacological targeting of FBXO42 attenuated leukemia progression in vivo.

[0031] (AH) Xenograft tumor growth studies were performed with WT or FBXO42-KO JURKAT (AD) and HSB2 (EH) cells. Mice were euthanized 4 weeks after tumor cell injection. Tumors were excised, photographed, and weighed. The volume (B and F) and weight (C and G) of the tumors were measured, respectively. The mRNA levels of Notch target genes in the tumors were determined by qPCR (D and H), respectively. (IK) In vivo leukemia mouse models were established by intravenous injection of WT and FBXO42-KO JURKAT cells carrying GFP into NSG mice. GFP in peripheral blood was measured weekly by flow cytometry analysis (I) and summary (K) + Percentage of leukemic cells. Representative flow cytometry dot plots of GFP expression in peripheral blood are shown (J). (LO) Spleens from mice in different groups were excised, representative images are shown (L), and spleen weights were measured (M). Tumor cell invasion was assessed by measuring GFP intensity by fluorescence microscopy (N) and hemoglobin and eosin staining (O). Scale bar, 50 μm. (P and Q) WT and FBXO42-KO JURKAT cells expressing luciferase were transplanted into NSG mice by tail vein injection. Tumor growth in each group was tracked by bioluminescence imaging. (R) Survival analysis of mice from (P). (SV) Xenograft tumor growth studies with JURKAT cells. Mice bearing JURKAT xenografts were then subcutaneously administered vehicle or 30 mg / kg MLN4924 twice daily for 21 days. At the end of the study, tumors were excised, photographed, and weighed. Macroscopic images of tumors are shown (R). Tumor volume (S) and weight (T) and mouse body weight (U) were measured. (AO, SV, n = 5, PR, n = 10) Quantitative data are presented as mean ± SEM. Two-tailed Student's t-test was used to calculate the difference. P value. P <0.05, P <0.01, NS, not significant. DETAILED DESCRIPTION

[0032] The following description of the present disclosure is intended only to illustrate various different embodiments of the present disclosure. Therefore, the specific modifications discussed should not be interpreted as limiting the scope of the present disclosure. It is obvious to those skilled in the art that various different equivalents, changes and modifications can be made without departing from the scope of the present disclosure, and it should be understood that these equivalent embodiments will be included herein. All references cited herein, including publications, patents and patent applications, are incorporated herein by reference in their entirety.

[0033] definition The articles "a," "an," and "the" are used herein to refer to one or to more than one (ie, to at least one) of the grammatical object of the article. For example, "a polypeptide" means one polypeptide or more than one polypeptide.

[0034] Throughout this disclosure, unless the context requires otherwise, the terms "comprises," "comprising," and "containing" will be understood to imply the inclusion of the stated steps or elements or groups of steps or elements without excluding any other steps or elements or groups of steps or elements. "Consisting of" means including and limited to whatever follows the phrase "consisting of." Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory, and no other elements may be present. "Consisting essentially of" means including any elements listed after the phrase, and is limited to other elements that do not interfere with or contribute to the activities or actions specified for the listed elements in this disclosure. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or mandatory, but other elements are optional and may or may not be present, depending on whether they affect the activity or action of the listed elements.

[0035] The term "FBXO42" as used herein refers to F-box protein 42 (Fbx42), a member of the F-box protein family. FBXO42 The gene encodes a protein of 717 amino acids characterized by an approximately 40 amino acid F-box motif in its N-terminus and 3 central kelch repeats downstream of the F-box.

[0036] The term "inhibitor" as used herein refers to a substance that can reduce, decrease or eliminate the amount, specific function and specific property of a target. The target can be a protein, polypeptide, nucleic acid, etc., and the inhibitor directly or indirectly affects the amount, specific function and specific property of the target, thereby resulting in a corresponding reduction, reduction or elimination of the amount, specific function and specific property of the target. The inhibitor can be a protein, polypeptide, nucleic acid, small molecule compound, etc.

[0037] For example, the term "inhibitor" as used herein refers to a substance that can reduce, decrease or eliminate the expression, transcription, translation of a gene, and / or the stability of the protein produced thereby, the ability to bind to a protein, etc., including but not limited to polypeptide antagonists directed against the protein, inhibitory nucleic acids specific to the protein, antibodies directed against the protein, small molecule compound inhibitors that can inhibit activity, and / or substances that can inhibit the interaction between the protein and other membrane proteins, etc.

[0038] For example, the term "FBXO42-specific inhibitor" as used herein refers to an inhibitor that is capable of reducing, decreasing or eliminating FBXO42 The expression, transcription, translation of the gene, and / or the stability of the FBXO42 protein produced thereby, the ability to bind to proteins, etc., including but not limited to polypeptide antagonists against FBXO42, FBXO42 Inhibitory nucleotides, antibodies against FBXO42 protein, small molecule compound inhibitors capable of inhibiting FBXO42 activity, and / or substances capable of inhibiting the interaction between FBXO42 protein and ligand, etc.

[0039] The term "antibody" as used herein refers to any immunoglobulin or complete molecule and fragments thereof that bind to a specific epitope. The antibodies include, but are not limited to, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, humanized antibodies, single-chain antibodies, and fragments and / or portions of complete antibodies, as long as these fragments or portions retain the antigen binding ability of the parent antibody. In the present disclosure, for example, "anti-FBXO42 antibody" refers to a monoclonal antibody, polyclonal antibody, single-chain antibody and immunologically active fragment or portion thereof that can specifically bind to the FBXO42 protein or its functional variant or functional fragment. In the present disclosure, the terms "FBXO42 antibody", "antibody against FBXO42" and "anti-FBXO42 antibody" are used interchangeably.

[0040] In the present disclosure, a "functional variant" refers to a protein or polypeptide of the present invention having one or more amino acid modifications in its amino acid sequence. The modification may be a "conservative" modification (in which the substituted amino acid has similar structural or chemical properties) or a "non-conservative" modification; similar modifications also include the addition or deletion of amino acids or both. However, neither the modification of amino acid residues nor the addition or deletion of amino acids substantially changes or destroys the biological or immunological activity and function of the original amino acid sequence. In the present disclosure, similarly, a "functional fragment" refers to any part of a protein or polypeptide of the present invention that retains substantially similar or identical biological or immunological activity and function to the protein or polypeptide of which it is a part (parent protein or polypeptide).

[0041] The term "polynucleotide specific for FBXO42" as used herein refers to a polynucleotide that is capable of binding toFBXO42 Gene and / or suppression FBXO42 Nucleotides that inhibit gene expression. Typical inhibitory nucleotides include, but are not limited to, antisense oligonucleotides, triple helix DNA, RNA aptamers, ribozymes, small interfering RNA (siRNA), short hairpin RNA (shRNA) and microRNA (microRNA). These nucleotide compounds have a higher affinity for binding to the specific gene than other nucleotide sequences, so they can inhibit the expression of the specific gene.

[0042] The term "small molecule compound" as used herein refers to an organic compound with a molecular weight of less than 3 kDaltons, which may be natural or chemically synthesized. The term "derivative" as used herein refers to a compound produced by modifying a parent organic compound by one or more chemical reactions, which has a similar structure and functionally similar effects to the parent organic compound. The term "analog" as used herein refers to a compound that is not produced by chemical modification of a parent organic compound, but is structurally similar to the parent organic compound and has a similar effect in its function.

[0043] The term "disease" as used herein refers to a Notch signal-dependent disease, such as a cancer in which Notch signal transduction is activated. Notch signal-dependent diseases include activating mutations and / or enhancements of Notch genes and / or Notch pathway activity. The cancer may be, but is not limited to, acute T-lymphocytic leukemia ( Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science. 2004; 306: 269-71.CUTLL1, a novel human T-cell lymphoma cell line with t (7;9) rearrangement, aberrant NOTCH1 activation and high sensitivity to gamma-secretase inhibitors. Leukemia. 2006; 20: 1279-87 ), chronic lymphocytic leukemia ( NOTCH1 mutations influence survival in chronic lymphocytic leukemia patients. BMC Cancer. 2013; 13: 274 ), multiple myeloma ( Inhibition of Notch signaling induces apoptosis of myeloma cells and enhances sensitivity to chemotherapy. Blood. 2008; 111: 2220-9 ), lymphomas such as Hodgkin lymphoma ( Activated Notch1 signaling promotes tumor cell proliferation and survival in Hodgkin and anaplastic large cell lymphoma. Blood. 2002; 99: 3398-403. ), Burkitt's lymphoma ( Notch is an essential upstream regulator of NF-kappaB and is relevant for survival of Hodgkin and Reed- Sternberg cells. Leukemia. 2012; 26: 806-13 ), diffuse large B-cell lymphoma ( Gain-of- function mutations and copy number increases of Notch2 in diffuse large B- cell lymphoma. Cancer Science. 2009; 100: 920- 926. ), mantle cell lymphoma ( Whole transcriptome sequencing reveals recurrent NOTCH1 mutations in mantle cell lymphoma. Blood. 2012; 119: 1963-1971 ), splenic marginal zone lymphoma ( The coding genome of splenic marginal zone lymphoma: activation of NOTCH2 and other pathways regulating marginal zone development. J Exp Med. 2012; 209: 1537-51. ), follicular lymphoma ( Molecular detection of t (14;18) (q32; q21) in follicular lymphoma. Methods Mol Biol. 2013; Recurrent Mutations of NOTCH Genes in Follicular Lymphoma. Blood. 2013; 122: 4253 ), breast cancer ( Notch1 is involved in migration and invasion of human breast cancer cells ), liver cancer ( Differentiation-inducing therapeutic effect of Notch inhibition in reversing malignant transformation of liver normal stem cells via MET. Oncotarget 9, 18885–18895 (2018). ), lung cancer ( Alterations of the Notch pathway in lung cancer. Proc. Natl Acad. Sci. USA 106, 22293–22298 (2009). ), lung adenocarcinoma cells ( Notch-1 stimulates survival of lung adenocarcinoma cells during hypoxia by activating the IGF-1R pathway. Oncogene 29, 2488–2498 (2010). Oxygen concentration determines the biological effects of NOTCH-1 signaling in adenocarcinoma of the lung. Cancer Res. 67, 7954–7959 (2007). ). Preferably, the Notch signal-dependent disease is selected from leukemia, myeloma, lymphoma, breast cancer, liver cancer, head and neck squamous cell carcinoma (HNSCC), lung cancer and other cancers carrying activating mutations and / or enhanced activity of Notch gene and / or Notch pathway.

[0044] The term "therapeutic target" as used herein refers to various substances that can be used to treat a certain disease and the target of the substance in an animal or human body. When the substance acts on the target, a therapeutic effect on the disease can be obtained. The substance can be a variety of substances such as proteins, polypeptides, nucleic acids, small molecule compounds, etc., and the target can be a certain gene (including a specific sequence of the gene), a certain protein (including a specific site of the protein), a certain protein complex (including its specific binding site), or certain characteristics, certain functions, certain interactions with surrounding substances and the environment of the above-mentioned genes and / or proteins, etc., as long as the substance can affect the gene, protein, protein complex or its characteristics, functions, and interactions to treat the disease.

[0045] As used herein, the term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, such as mammals and non-mammals, such as non-human primates, sheep, dogs, cats, horses, cows, chickens, amphibians, reptiles, etc. Unless otherwise indicated, the terms "patient" or "subject" are used interchangeably.

[0046] The term "treat" as used herein refers to reversing, ameliorating or inhibiting the progression of the disease to which the term applies, or the progression of one or more symptoms of the disease. As used herein, the term also includes preventing the disease, which includes preventing the onset of the disease or any symptoms associated therewith, as well as ameliorating symptoms or reducing the severity of any condition prior to its onset, depending on the patient's condition.

[0047] The terms "inhibit", "attenuate", "downregulate", "remove" and the like all refer to a reduction or decrease in amount or degree. This reduction or decrease is not limited to any degree as long as it shows such a trend. For example, relative to the original amount or degree, the reduction or decrease may be 100%, or may be 50% or even 1% or less.

[0048] "Percentage (%) of sequence identity" with respect to an amino acid sequence (or nucleic acid sequence) is defined as the percentage of amino acid (or nucleic acid) residues in the candidate sequence that are identical with the amino acid (or nucleic acid) residues in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum number of identical amino acids (or nucleic acids). Conservative substitutions of amino acid residues may or may not be considered identical residues. For the purpose of determining the percentage of amino acid (or nucleic acid) sequence identity, for example, publicly available tools such as BLASTN, BLASTp (available on the website of the National Center for Biotechnology Information (NCBI), see also Altschul SF et al., J. Mol. Biol., 215: 403-410 (1990); Stephen F. et al., Nucleic Acids Res., 25: 3389-3402 (1997)), ClustalW2 (available on the website of the European Bioinformatics Institute, see also Higgins DG et al., Methods in Enzymology, 266: 383-402 (1996); Larkin MA et al., Bioinformatics (Oxford, England), 23 (21): 2947-8 (2007)), and ALIGN or Megalign (DNASTAR) software can be used. Those skilled in the art can use the default parameters provided by the tool, or can customize parameters suitable for the alignment, for example by selecting an appropriate algorithm.

[0049] The present invention is further described in detail below. However, the mode of implementing the present invention is not limited to the following examples.

[0050] Experimental model and subject details Constructs The genes encoding RBPJ and FBXO42 were amplified from cDNA and cloned into the pDONR201 vector (Invitrogen, Carlsbad, CA) as entry clones and subsequently transferred to a Gateway-compatible destination vector for the expression of C-terminal SFB (cSFB)- or MYC-tagged fusion proteins. Deletion mutants of FBXO42 and RBPJ were generated by introducing point mutations and verified by sequencing.

[0051] Cell culture and transfection HEK293T cells were cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin (Thermo Fisher Scientific). HSB2 and JURKAT cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin at 37°C in a humidified incubator with 5% CO2.

[0052] To establish HEK293T cells stably expressing cSFB-RBPJ and cSFB-FBXO42, cells were transfected with the corresponding plasmids using polyethyleneimine (Polysciences) and selected in DMEM supplemented with 2 μg / mL puromycin (Sangon, China) for at least 2 weeks.

[0053] For KO experiments, CRISPR constructs were packaged into lentivirus by co-transfection into HEK-293T cells with packaging plasmids pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260). 48 hours after transfection, cell culture medium was collected and used to infect HEK293T, HSB2, or JURKAT cells. Cells were infected twice at 24 h intervals to achieve maximum infection efficiency.

[0054] Generation of CRISPR-induced KO FBXO42-KO HEK293T, JURKAT, and HSB2 cell lines were established by CRISPR / Cas9-mediated genome editing. Target sequences for CRISPR interference were designed using the Benchling tool (2021) and ligated into the lentiCRISPR v2 plasmid (Addgene #52961) at the BsmBI restriction site. N. E. Sanjana, O. Shalem, F. Zhang, Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods 11, 783-784 (2014) ) and packaged into lentivirus by co-transfection with packaging plasmids pMD2.G and psPAX2 into HEK293T cells. HEK293T, JURKAT and HSB2 cells were infected with lentiCRISPR virus at the desired titer and then selected with puromycin. Each clone was further amplified and the loss of target protein expression was confirmed by immunoblotting.

[0055] The sgRNA sequence for FBXO42: 5'-CGGCCCTTGTCTGCAAACAG; the sgRNA sequence for RBPJ: 5'-AAAGAACAAATGGAACGCGA.

[0056] Western blotting and immunoprecipitation Cells were washed twice with phosphate-buffered saline (PBS) and lysed in NETN lysis buffer (20 mM Tris-HCl, pH 8.0; 100 mM NaCl; 0.5% NP-40; and 1 mM EDTA) supplemented with protease and phosphatase inhibitors (Sangon, China). Whole-cell lysates were subjected to SDS-PAGE and then immunoblotted with specific antibodies.

[0057] For immunoprecipitation, 1 × 10 7 Cells were lysed with NETN buffer on ice for 30 min. The lysate was then incubated with 30 μL of conjugated S-beads (for SBF-labeled pull-down assays) for 2 h at 4°C or with antibodies against endogenous proteins for 1 h at 4°C, followed by the addition of 20 μL of protein A / G agarose and incubation for 2 h at 4°C. Immunoprecipitates were washed three times with lysis buffer before immunoblotting analysis. The following primary antibodies were used: rabbit anti-RBPJ (5313S, CST, RRID: AB_2665555), mouse anti-FBXO42 (TA800283, OriGene, RRID: AB_2625356), THE TM HA tag (A01244, Genscript), THE TM c-MYC tag (A00704, Genscript), ANTI-FLAG® M2 antibody (B3111, Sigma-Aldrich, RRID: AB_2910145), rabbit anti-ubiquitin (AF0306, Beyoctime), rabbit anti-β-actin (AC026, ABclonal, RRID: AB_2768234), rabbit anti-LSD1 (YM0422, Immunoway), rabbit anti-SMARCA4 (ET1611-85, HuaBio), rabbit anti-SMARCA2 (ER65406, HuaBio), rabbit anti-SMARCC2 (ER62787, HuaBio), rabbit anti-ORC2 (A15697, ABclonal). The following secondary antibodies were used: goat anti-mouse IgG antibody (H&L) [HRP] (A00160, Genscript), goat anti-rabbit IgG antibody (H&L) [HRP] (A00178, Genscript).

[0058] TAP TAP purification was performed as described previously ( W. Bian et al., Low-density-lipoprotein- Receptor-related protein 1 mediates Notch pathway activation. Dev Cell 56, 2902-2919 e2908 (2021) Briefly, 1×10 8HEK293T cells were lysed in 5 ml NETN buffer (with protease inhibitors) at 4°C for 30 min, followed by Turbo nuclease treatment. The lysate was then incubated with streptavidin-coupled beads (Thermo Fisher Scientific, Waltham, MA) for 2 h at 4°C. After washing with NETN buffer, bound proteins were eluted with NETN buffer containing 2 mg / mL biotin (Sigma, St. Louis, MO) at 4°C for 2 h. The eluate was then incubated with S-protein beads (EMD Millipore, Burlington, VT) for 4 h. The beads were washed three times with NETN buffer and subjected to SDS-PAGE followed by Coomassie brilliant blue staining. The entire band was excised and subjected to in-gel trypsin digestion and MS analysis.

[0059] In vivo ubiquitination assay For in vivo ubiquitination assays, HEK293T cells were transfected with the indicated plasmids and treated with or without 10 μM MG132 (S2619, Selecick) for 4 h before harvesting. Whole cells were lysed with NETN buffer containing protease inhibitors. Equal amounts of protein lysates were pulled down with S-protein beads for 4 h at 4 °C. After incubation, beads were extensively washed three times with NETN buffer, boiled with sample buffer for 20 min, and subjected to SDS-PAGE followed by immunoblotting with antibodies against various proteins as indicated. For endogenous RBPJ ubiquitination detection, lysates were immunoprecipitated with RBPJ antibody and then immunoblotted with an antibody against ubiquitin.

[0060] Real-time quantitative PCR Total RNA was isolated from cells using TRIzol reagent (Takara), and cDNA synthesis was performed using 1 μg of total RNA and HiScript III reverse transcriptase (R212-02, Vazyme). The mRNA levels of specific genes were quantified by SYBR Green qPCR according to the manufacturer's instructions on the Jena Qtower3G quantitative PCR system. Actin was used as a reference gene and the relative mRNA levels were determined using the comparative Ct method, following Formula 2 -ΔΔCt . List the primers used: HES1-F: 5'-CCTGTCATCCCCGTCTACAC, HES1-R: 5'-CACATGGAGTCCGCCGTAA, HES5-F: 5'-CGCATCAACAGCAGCATCGAG, HES5-R: 5'-GACGAAGGCTTTGCTGTGCT, c-MYC-F: 5'-GGCTCCTGGCAAAAGGTCA, c-MYC-R: 5'-CTGCGTAGTTGTGCTGATGT, Actin-F: 5'-TTGCCGACAGGATGCAGAAGGA, Actin-R: 5'-AGGTGGACAGCGAGGCCAGGAT.

[0061] Luciferase reporter assay Luciferase reporter constructs containing HES1 and HES5 promoters and 8x RBPJ binding site were generated by inserting the HES1 and HES5 promoters and 8x RBPJ binding site sequences into the pGL3-basic luciferase vector upstream of the firefly luciferase gene. For luciferase assays, HEK293T cells were plated at 50% confluence in 24-well plates and cultured overnight. Firefly luciferase reporter constructs and Renilla control reporter were co-transfected into cells at a molar ratio of 10:1. After 24 h of culture, luciferase activity was measured using a dual-luciferase assay kit (11402ES60, YEASEN) and normalized to Renilla activity.

[0062] Immunofluorescence staining Cells were seeded in cell culture plates, fixed with 4% paraformaldehyde for 10 min at room temperature, permeabilized with 0.1% TritonX-100 for 10 min, washed with PBS and blocked in 5% BSA in PBS for 30 min, and then labeled with anti-HP1α primary antibody (ab109028, Abcam, RRID: AB_10858495) for 1 h at room temperature. After incubation, cells were washed twice with PBS and stained with goat anti-rabbit Alexa Fluor® 488-labeled IgG (ab150077, Abcam, RRID: AB_2630356) for 1 h at room temperature and 4',6-diamidino-2-phenylindole (DAPI) staining (4083S, CST). FluorSave TM Coverslips were mounted using ELISA kit (345789, Milipore). Cells were visualized using an Olympus FV3000 microscope imaging system (Olympus, Japan).

[0063] Chromatin fractionation To separate the cytoplasmic and chromatin fractions, perform the assay as described previously ( W. Bian et al., Low-density- lipoprotein-receptor-related protein 1 mediates Notch pathway activation. Dev Cell 56, 2902-2919 e2908 (2021); T. Tian et al., The ZATT-TOP2A-PICH Axis Drives Extensive Replication Fork Reversal to Promote Genome Stability. Mol Cell 81, 198-211 e196 (2021) ) WT and FBXO42 KO HEK293T or leukemia cells were harvested and fractionated with slight modifications. Briefly, cells were resuspended in cold buffer A (10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 1 mM dithiothreitol (DTT), 0.1% Triton X-100) containing protease inhibitors at 4°C for 5 min. The lysate was centrifuged at 1,500 × g for 5 min, and the supernatant was further clarified by high-speed centrifugation (13,000 × g, 10 min, 4°C) to remove cell debris and insoluble aggregates and collected as the cytoplasmic fraction. Nuclei were washed once with buffer A without 0.1% Triton X-100 and then lysed in buffer B (3 mM EDTA, 0.2 mM EGTA, 1 mM DTT) containing protease inhibitors at 4°C for 10 min. Soluble nuclear proteins were separated from chromatin by centrifugation (2,000 × g, 5 min). The separated chromatin-enriched pellet was washed once with buffer B and centrifuged at high speed (13,000 × g, 1 min) and then lysed in 2× Laemmli sample buffer. The samples were then subjected to SDS-PAGE followed by immunoblotting with antibodies against various proteins as indicated.

[0064] CUT&Tag assay and sequencing As mentioned previously ( HS Kaya-Okur et al., CUT&Tag for efficient epigenomic Profiling of small samples and single cells. Nat Commun 10, 1930 (2019) ) for CUT&Tag assay. Briefly, 100,000 WT and FBXO42 KO JURKAT cells were collected and lysed according to the manufacturer's instructions (YEASEN, Cat#12597). Convanavalin A-coated magnetic beads were incubated with cell lysates for 1 h at room temperature, followed by incubation with anti-RBPJ primary antibody (1:50, abcam ab25949) for 2 h, secondary antibody for 1 h, and pA / G-Tn5 adapter complex for 1 h. After labeling for 1 h, DNA was extracted with phenol-chloroform-isoamyl alcohol. The DNA was expressed using a 50 μM ELISA kit for Illumina. ® HieffNGS ®Libraries were prepared using the Tagment Index kit (96 Index) (YEASEN, Cat#12610) and pooled for 150-bp paired-end sequencing on Novoseq (Novogene). Raw fastq files were trimmed using Trim Galore (length 20, e = .1) and aligned to the human genome (hg38) using Bowtie2. Reads were ordered and converted to BAM format, and data tracks were visualized using IGV. Final data analysis and visualization were performed using in-house R scripts.

[0065] Micrococcal nuclease and DNase sensitivity assays As mentioned previously ( Y. Li et al., Histone H1 acetylation at lysine 85 regulates chromatin condensation and genome stability upon DNA damage. Nucleic Acids Res 46, 7716-7730 (2018) ) were performed for micrococcal nuclease (MNase) and DNase sensitivity assays as described above with slight modifications. Briefly, cell pellets were lysed in buffer A (10 mM HEPES, pH 7.9; 10 mM KCl; 1.5 mM MgCl2; 0.34 M sucrose; 10% glycerol; 1 mM DTT; and 0.1% Triton X-100) for 10 min on ice. Nuclei were pelleted and digested with 10 U / mL micrococcal nuclease (2910A, Takara) in digestion buffer (10 mM Tris·HCl, pH 7.5; 1 mM NaCl; 3 mM MgCl2; and 1 mM CaCl2) at 37°C for 3 min or with DNase (M0303S, NEB) at 37°C for 5 min. Treated nuclei were lysed and subsequently subjected to RNase A and proteinase K digestion. Genomic DNA was purified using a DNA purification kit (DC301-01, Vazyme) and separated by 1.2% agarose gel electrophoresis. DNA bands were visualized under a Gel Doc XR+ system (Bio-Rad).

[0066] DNase I chromatin accessibility analysis Chromatin accessibility was analyzed according to the protocol (PMID: 33654939, 30911685). Isolated chromatin was placed on ice for 5 min in a buffer containing 10 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 1 mM CaCl2, 10 mM KCl, 300 mM sucrose, and 0.1% TritonX-100, then washed and resuspended in the same buffer without detergent. One third of the chromatin was then digested with 3 U / 100 μL of DNase I (NEB) for 7 min at room temperature. Another third was treated similarly in the absence of DNase I (untreated controls were used for normalization). The reaction was stopped by adding 10 mM EDTA / 2 mM EGTA and incubated at 65°C for 10 min. DNA was gently sonicated, treated with 50 μg / mL RNase (Sigma) for 30 min at 37°C, and treated with 250 μg / mL proteinase K (Sigma) for 2 h at 42°C. DNA was purified and analyzed using the Jena Qtower3G system. According to the formula 100 / 2 Ct(DNase I)−Ct(no DNase I) qPCR results were analyzed for normalization to input DNA (without DNase I treatment).

[0067] ATAC-seq library preparation and data analysis ATAC-seq library processing was performed according to the manufacturer's protocol (N248, Novoprotein). The process typically involves resuspending 50,000 live cells and isolating nuclei; then, transposition was performed using Tn5 transposase, followed by adapter ligation and PCR amplification. Libraries were sequenced at 150 bp paired-end on Novseq. All paired-end sequencing reads were first adapter-trimmed using cutadapt (v1.18). Then, the sheared sequencing reads were aligned to the human genome (hg38) using bowtie2 (v2.3.3.1). Peaks for each sample were called using MACS2 (v2.1.1.20160309). ATAC-seq signals were visualized in Integrative Genomics Viewwer (IGV, v2.5.3) and analyzed using deeptools (v3.3.0). Mass spectrometry-based global protein ubiquitination analysis.

[0068] Global protein ubiquitination analysis was performed according to the manufacturer's instructions (5562, CST). Briefly, cell lysates were prepared in urea buffer, followed by reduction, alkylation, and overnight digestion with trypsin. Peptides were then immunoaffinity purified using the Remnant Motif (K-ε-GG) and mass spectrometry detection.

[0069] Chromatin immunoprecipitation (ChIP) ChIP assays were performed based on the protocol described previously (Pub Med: 19632176). Cells were cross-linked with 1% formaldehyde for 10 min and quenched with 125 mM glycine at room temperature with gentle shaking for 5 min. After rinsing twice with cold PBS, cells were collected in PBS supplemented with protease inhibitors, centrifuged, and lysed in ice-cold lysis buffer (1% SDS, 5 mM EDTA, 50 mM Tris-HCl pH 8.1) supplemented with protease inhibitors for 10 min. Cell lysates were sonicated using a Bioruptor Sonicator (Diagenode) to fragment DNA into ~500-bp fragments for ChIP-qPCR. Soluble chromatin was diluted in dilution buffer (1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris-HCl pH 8.1), 4 μg of ChIP-grade antibodies were added, and incubated at 4°C with gentle shaking for 2 h. 50 μl of protein A / G bead slurry (16-663, Millipore) was added and incubated for 1 hour at 4°C. The beads were then washed for 10 minutes each at 4°C using the following buffers: buffer I (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mMTris-HCl pH 8.1), buffer II (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 500 mM NaCl, 20 mM Tris-HCl pH 8.1), buffer III (0.25 mM LiCl, 1% NP-40, 1% deoxycholic acid, 1 mM EDTA, 10 mM Tris-HCl pH 8.1), and TE buffer (2 times). To elute the DNA, the beads were incubated in elution buffer (1% SDS, 0.1 M NaHCO3) at room temperature with vigorous shaking for 15 min. The supernatant was then collected and incubated overnight at 65°C to reverse crosslink the DNA. DNA was purified using a DNA purification kit (DC301-01, Vazyme) for subsequent qPCR. The following antibodies were used in ChIP: anti-H3K4me3 (ab8580, Abcam, RRID:AB_306649), anti-H3K27ac (ab177178, Abcam, RRID:AB_2828007), and anti-IgG (3900S, CST, RRID:AB_1550038). ChIP-qPCR experiments were performed in triplicate and the results were normalized to the input DNA.

[0070] Mouse Model All animal experiments were performed according to protocols approved by the Institutional Animal Care and Use Committee of Westlake University (AP#20-023-LX). WT and FBXO42-KO HSB2 and JURKAT cells (5 × 10 6 ) were resuspended in 100 μL of Matrigel (356237, Corning) diluted 1:1 with PBS and injected subcutaneously into the left and right flanks of anesthetized 6- to 8-week-old female BALB / c nude mice (SLAC). Starting from the seventh day, tumor formation was observed every two weeks. Four weeks after injection, the mice were euthanized, the tumors were removed, photographed and weighed.

[0071] For invasion assays, NSG mice (Charles River) were used to establish a leukemia model. WT and FBXO42-KOJURKAT-GFP reporter cells (5 × 10 6 ) were resuspended in 100 μL PBS and injected intravenously into 6- to 8-week-old female NSG mice via the tail vein. Starting from the seventh day, peripheral blood leukemic cells were analyzed by detecting GFP levels by flow cytometry. At the end of the study, mice were euthanized, spleen tissues were removed, photographed, fixed with 4% paraformaldehyde, embedded in paraffin, and stained with hematoxylin and eosin.

[0072] For the evaluation of MLN4924 efficacy in vivo, 6- to 8-week-old female BALB / c nude mice were inoculated subcutaneously on the right flank with 5 × 10 6 JURKAT cells were grown and tumor growth was monitored by caliper measurement. When tumors were visible, mice were subcutaneously administered vehicle or MLN4924 (30 mg / kg, twice daily) for 21 days and then tumor growth was recorded.

[0073] In vivo bioluminescence imaging To monitor tumor growth in vivo, firefly luciferase was transduced into JURKAT cells for animal studies by lentiviral infection. Then, cells were infected with lentiCRISPR virus to knock out FBXO42, and these infected cells were transplanted intravenously into 6- to 8-week-old female NSG mice. For imaging analysis, animals were intraperitoneally administered 150 mg / kg D-luciferin (40902ES01, YEASEN) and anesthetized with isoflurane. Tumor luciferase images were captured with an IVIS imaging system (Biospace ImagerOptima).

[0074] Histological analysis Spleen tissues collected from different groups of mice were fixed in 4% paraformaldehyde and immersed in fixative for 24 hours. After embedding in paraffin, 4 μm sections were prepared and placed on poly-L-lysine coated slides. Morphological changes were analyzed by hematoxylin and eosin staining.

[0075] Flow cytometric analysis Peripheral blood was collected from NSG mice, and red blood cells were removed by RBC lysis (C3702, Beyoctime). After washing cells three times with PBS, GFP intensity was analyzed using a CytoFLEX6 flow cytometer and Cytopert software according to the manufacturer's instructions.

[0076] Statistical analysis All western blot, immunofluorescence and RT-qPCR data were obtained from at least three replicate experiments. Data were analyzed using Prism 7.0 software (Graph Pad, USA) and presented as mean values ​​(standard error of the mean, ± SEM). Statistical significance between two groups was determined by unpaired two-tailed Student's t-test. Multiple group comparisons were performed by one-way analysis of variance (ANOVA). P values ​​< 0.05 (indicated by asterisks ( ) indicates that the ) is considered significant.

[0077] Example 1: Proteomic analysis of the RBPJ interaction network identifies FBXO42 as a novel regulator of Notch signaling Moderation To gain a comprehensive understanding of the transcriptional regulation of the Notch pathway and identify novel RBPJ interactors, we established the RBPJ protein interaction network using TAP-MS in HEK293T cells due to its broad protein abundance and ease of transfection and manipulation. MS analysis of purified protein extracts showed that RBPJ was successfully purified with 570 and 381 peptide-spectrum matches (PSMs), respectively. We used the MUSE algorithm to analyze the MS results ( W. Bian et al., Low-density- lipoprotein-receptor-related protein 1 mediates Notch pathway activation. Dev Cell 56, 2902-2919 e2908 (2021) ) and build a high confidence map of RBPJ interactors ( Figure 1 A). Functional annotation and pathway enrichment experiments showed that RBPJ interaction is highly involved in embryonic development, cell fate determination and transcriptional regulation ( Figure 2 AC), which is consistent with a role in Notch signaling. We selected several of the strongest RBPJ-interacting proteins identified in this study for co-immunoprecipitation (co-IP) assays to validate their interaction with RBPJ ( Figure 2 D). All tested interactors interact with RBPJ, indicating that the interaction network is reliable ( Figure 2D). CRISPR / Cas9-mediated KO screening of the strongest RBPJ interactors revealed the strongest positive and negative regulators of Notch signaling. Knockout of L3MBTL3, a previously reported negative regulator of RBPJ ( T. Xu et al., RBPJ / CBF1 interacts with L3MBTL3 / MBT1 to promote repression of Notch signaling via histone demethylase KDM1A / LSD1. EMBO J 36, 3232-3249 (2017) ) increased Notch target gene expression ( Figure 1 B and 1C), knockout of FBXO42 significantly reduced the expression of Notch target genes ( Figure 1 D and 1E). In addition, knockout of FBXO42 weakened the binding of RBPJ to the HES1 / 5 promoter region and the constructed 8×RBPJ binding site ( Figure 1 F and 1G), indicating that FBXO42 can regulate RBPJ transcriptional activity through direct binding.

[0078] Dysregulation of Notch signaling has been associated with various cancer types, including T-ALL, DLBCL, HNSCC, and breast cancer ( AP Weng et al., Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306, 269-271 (2004); K. Karube et al., Integrating genomic alterations in diffuse large B-cell lymphoma identifies new relevant pathways and potential therapeutic targets. Leukemia 32, 675-684 (2018); N. Agrawal et al., Exome sequencing of head and neck squamous cell carcinoma reveals inactivating mutations in NOTCH1. Science 333, 1154-1157 (2011); N. Stransky et al., The mutational landscape of head and neck squamous cell carcinoma. Science 333, 1157-1160 (2011); D. R. Robinson et al., Functionally recurrent rearrangements of the MAST kinase and Notch gene families in breast cancer. Nat Med 17, 1646-1651 (2011); S. Stylianou, R. B. Clarke, K. Brennan, Aberrant activation of notch signaling in human breast cancer. Cancer Res 66, 1517-1525 (2006) We found that FBXO42 was highly expressed in Notch-activated T-cell leukemia, DLBCL, and breast cancer, but not in Notch-inactivated HNSCC ( Figure 1 HJ, 2E and 1F). It is downregulated in various leukemia and breast cancer cell lines ( Figure 1 K), especially ALL cell lines ( Figure 1 In addition, the expression of FBXO42 and Notch pathway target genes HES1, MYC, HES5, HEY1, HEY2, and HEYL was also high in DLBCL ( Figure 1 M), LAML ( Figure 1 N) and ALL patients ( Figure 2 G) shows a relatively high correlation. Taken together, these data suggest a potential role for FBXO42 as an important positive regulator of Notch signaling.

[0079] Example 2: FBXO42 directly interacts with RBPJ FBXO42 is a substrate recognition component of the SKP1-CUL1-F-box protein (SCF) type E3 ligase complex, which was previously reported to promote p53 ubiquitination and degradation ( L. Sun et al., JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation. Proc Natl Acad Sci U S A 106, 10195-10200 (2009)To determine whether RBPJ and FBXO42 interact directly, we performed reciprocal TAP-MS using FBXO42 as bait and established the FBXO42 interaction network ( Figure 3 A). Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis showed that FBXO42 may be involved in many pathological conditions ( Figure 3 B). We identified several previously reported FBXO42 interactors, including SKP1, CUL1, and COPS family members, which are involved in demethylation of the cullin subunit in the SCF-type E3 ligase complex ( S. Lyapina et al., Promotion of NEDD-CUL1 conjugate cleavage by COP9 signalosome. Science 292, 1382-1385 (2001); R. Groisman et al., The ubiquitin ligase activity in the DDB2 and CSA complexes is differentially regulated by the COP9 signalosome in response to DNA damage. Cell 113, 357-367 (2003) RBPJ has also been repeatedly identified as a strong interactor of FBXO42 ( Figure 3 A), indicating that FBXO42 forms a stable protein complex with RBPJ. Interestingly, although there is little overlap between RBPJ- and FBXO42-interacting proteins, the functions of these proteins are highly overlapping ( Figure 3 C), indicating that FBXO42 can specifically promote RBPJ transcriptional activity.

[0080] We used antibodies targeting endogenous FBXO42 or RBPJ ( Figure 3 D and 3E) and the epitope tags RBPJ and FBXO42 ( Figure 3 F and 3G) further verified the interaction between FBXO42 and RBPJ. FBXO42 and RBPJ strongly interact with each other ( Figure 3 To assess the dynamic binding parameters underlying the RBPJ / FBXO42 in vitro interaction, we performed biomolecular interaction assays using purified recombinant RBPJ and FBXO42 proteins ( Figure 3 H). In vitro, FBXO42 interacts with RBPJ with very high affinity (Kd = 47 nM) ( Figure 3 I). To identify the binding regions on RBPJ and FBXO42, we generated a series of domain deletion mutants of RBPJ and FBXO42 ( Figure 3 J and 3K). We found that the N-terminal domain (NTD; amino acids [aa] 1-178) of RBPJ ( Figure 3 L) and the Kelch domain (aa101-350) of FBXO42 ( Figure 3 M) is critical for their interaction. Similarly, a strong interaction was observed between the RBPJ-NTD and FBXO42-Kelch domains ( Figure 3 N). Taken together, these data confirm a direct interaction between RBPJ and FBXO42 in vitro and in cells, which is mediated by the NTD of RBPJ and the Kelch domain of FBXO42.

[0081] Example 3: FBXO42 promotes RBPJ K63-linked polyubiquitination and positively regulates Notch signaling Since FBXO42 belongs to the SCF complex, we wondered whether FBXO42 is involved in the ubiquitination of RBPJ. Indeed, we found that FBXO42 promoted RBPJ polyubiquitination, which was significantly attenuated after FBXO42 depletion ( Figure 4 A and 4B, 5A). The FBXO42 F-box domain, which links FBXO42 to other components of the SCF complex, is required for RBPJ polyubiquitination ( Figure 4 C). The Kelch domain of FBXO42, which mediates the interaction between FBXO42 and RBPJ, is also required for RBPJ polyubiquitination ( Figure 5 B). Overexpression of NICD slightly increased RBPJ polyubiquitination, suggesting a potential role for Notch signaling activation or upregulation in promoting RBPJ polyubiquitination ( Figure 4 D). Using ubiquitin mutants in which only a single wild-type (WT) K residue was retained and all other K residues were replaced by arginine (R) residues, we found that only overexpression of K63-ubiquitin and FBXO42 promoted substantial RBPJ polyubiquitination, indicating that FBXO42 specifically promotes K63-linked polyubiquitination of RBPJ ( Figure 4 E).

[0082] To map the ubiquitination sites in RBPJ, we performed MS and analyzed the RBPJ ubiquitination profile in the presence and absence of FBXO42. As shown by MS, overexpression of FBXO42 greatly promoted RBPJ K175 ubiquitination ( Figure 4 F). In addition, this ubiquitin peptide was not obtained in FBXO42 KO cells ( Figure 5 C). Based on the potential ubiquitination sites of RBPJ shown in the public database of phosphorylation sites (https: / / www.phosphsite.org), we mutated the K at these sites to R, constructed mutants, and tested their ubiquitination intensity. Only the K175R mutant significantly abolished FBXO42-mediated RBPJ polyubiquitination ( Figure 4 G and 5D). The K175 residue is evolutionarily conserved, suggesting that homologous sites in other organisms may be similarly modified ( Figure 4 H). K175 ubiquitination does not affect the turnover rate of RBPJ, indicating that it does not mediate proteolytic degradation of RBPJ ( Figure 4I and 4J). Since FBXO42 is a substrate recognition component of the SCF complex, we used MLN4924, a small molecule inhibitor of NEDD8-activating enzyme, to determine whether the function of FBXO42 could be targeted pharmacologically. MLN4924 inhibits Cullin-1 neddylation, thereby inhibiting SCF activity, and is currently in phase I-III clinical trials ( TA Soucy et al., An inhibitor of NEDD8-activating enzyme as a new approach to treat cancer. Nature 458, 732-736 (2009); TA Soucy, PG Smith, M. Rolfe, Targeting NEDD8-activated cullin-RING ligases for the treatment of cancer. Clin Cancer Res 15, 3912-3916 (2009) Indeed, MLN4924 effectively abolished FBXO42-mediated K63-linked polyubiquitination of RBPJ ( Figure 4 K). In addition, to detect whether other Notch pathway proteins are affected by FBXO42, we analyzed the changes in global ubiquitination after FBXO42 knockout and MLN4924 treatment and found that the percentage of ubiquitinated peptides was reduced in the FBXO42 knockout and MLN4924 groups ( Figure 5 E and 5F). Proteins that were differentially ubiquitinated upon MLN4924 treatment were mainly involved in the proteasome and ubiquitin processes ( Figure 5 G), while in FBXO42 knockout cells, the differentially expressed proteins were involved in RNA processing ( Figure 5 H). Interestingly, 33 and 19 of these proteins were also found among the reported Notch interactors ( Figure 5 I and 5J ), indicating the relevance of FBXO42 in Notch signaling.

[0083] Ubiquitination via K48 linkage targets the modified protein for protease degradation, whereas ubiquitination via K63 linkage often plays a role in signal transduction ( C. M. Pickart, D. Fushman, Polyubiquitin chains: polymeric protein signals. Curr Opin Chem Biol 8, 610-616 (2004) ). Considering that RBPJ is the main transcription factor in Notch signaling, FBXO42 could regulate Notch pathway activation by promoting RBPJ K63-linked ubiquitination. Indeed, overexpression of FBXO42 with WT RBPJ but not the RBPJ K175R mutant significantly increased the expression of Notch target genes HES1, HES5, and c-MYC ( Figure 4 LN), indicating that RBPJ K175 polyubiquitination is essential for its transcriptional activity. MLN4924 treatment also inhibited the expression of the above Notch target genes ( Figure 4 O), supporting that FBXO42-mediated K63-linked polyubiquitination of RBPJ is involved in Notch signaling activation or upregulation. Knockdown of RBPJ expression reduced the expression of Notch target genes HES1, HES5, and c-MYC ( Figure 4 P and 4Q, and abolished FBXO42-promoted activation of these genes ( Figure 4 R), indicating that FBXO42-promoted Notch activation is RBPJ-dependent.

[0084] Together, these findings suggest that FBXO42 positively regulates Notch signaling by promoting K63-linked polyubiquitination of RBPJ at K175.

[0085] Example 4: FBXO42 regulates RBPJ chromatin binding and transcriptional activity RBPJ is thought to play a dual role in the regulation of Notch signaling. Depletion of RBPJ can lead to either repression or activation of Notch target genes, depending on the cellular context ( R. Kopan, MX Ilagan, The canonical Notch signaling pathway: unfolding the activation mechanism. Cell 137, 216-233 (2009) To further elucidate the mechanism of regulation of RBPJ transcriptional activity, we performed subcellular fractionation assays and assessed the levels of RBPJ in different cellular compartments. Knockdown of FBXO42 reduced the levels of nuclear and chromatin-bound RBPJ, while increasing cytoplasmic RBPJ levels ( Figure 6 A). The RBPJ K175R mutant also showed less chromatin binding than WT RBPJ ( Figure 6 B), indicating that FBXO42-mediated polyubiquitination of RBPJ regulates the binding of RBPJ to chromatin.

[0086] To further explore the molecular mechanism of RBPJ transcriptional activation, we evaluated the role of FBXO42 in RBPJ cofactor selectivity, as the transcriptional activity of RBPJ depends on its interaction with coactivators or co-repressors ( K. Tanigaki, T. Honjo, Two opposing roles of RBP-J in Notch signaling. Curr Top Dev Biol 92, 231-252 (2010) ). Knockdown of FBXO42 inhibits the interaction of RBPJ with co-activators p300, MAML1, and NICD1, while enhancing its interaction with the co-repressor L3MBTL3 ( Figure 6 C and 6D). The RBPJ K175R mutant showed similar cofactor selectivity as the FBXO42 KO ( Figure 6 E), indicating that FBXO42-mediated polyubiquitination of RBPJ regulates RBPJ cofactor preference. Next, we wanted to know whether FBXO42 directly regulates RBPJ transcriptional activity. Knockdown of FBXO42 expression suppressed histone 3 (H3) K4 methylation and H3K27 acetylation levels of RBPJ, which was rescued by overexpression of WT FBXO42 but not by overexpression of the F-box knockout mutant of FBXO42 ( Figure 6F). To evaluate transcriptional activity, we performed CUT&Tag assay of RBPJ in WT and FBXO42 KO cells. In addition to the canonical RBPJ motif, other leukemia-associated motifs were identified ( Figure 6 In particular, we found that knockdown of FBXO42 resulted in a reduction in global RBPJ binding and in the chromatin recruitment of RBPJ to its target genes HES1, HES4, and MYC ( Figure 6 H and 6I). After FBXO42 KO, genes with different RBPJ binding affinities were mainly enriched in protein homeostasis, cell behavior, signal transduction, and Notch-related cancers, which is consistent with the biological role played by RBPJ ( Figure 6 J). In addition, compared with RBPJ WT, the transcriptional activity of the RBPJ K175R mutant was impaired as shown by luciferase reporter assay and CUT&Tag assay ( Figure 7 HK).

[0087] Together, these data suggest that FBXO42-mediated polyubiquitination of RBPJ regulates RBPJ chromatin binding and subsequently modulates its transcriptional activity.

[0088] Example 5: FBXO42 mediates global chromatin remodeling in an RBPJ-dependent manner Chromatin remodeling is critical for transcriptional regulation ( B. Zhang, KJ Chambers, DV Faller, S. Wang, Reprogramming of the SWI / SNF complex for co-activation or co-repression in prohibitin-mediated estrogen receptor regulation. Oncogene 26, 7153-7157 (2007); BB Liau et al., Adaptive Chromatin Remodeling Drives Glioblastoma Stem Cell Plasticity and Drug Tolerance. Cell Stem Cell 20, 233- 246 e237 (2017) ). Therefore, we wondered whether FBXO42 regulates the interaction between RBPJ and chromatin remodeling complexes. Knockdown of FBXO42 broadly led to increased interactions between RBPJ and heterochromatin components associated with gene silencing, including HDAC1, LSD1, TRIM28, CBX1, and CBX5 ( Figure 8 A) RC Allshire, HD Madhani, Ten principles of heterochromatin formation and function. Nat Rev Mol Cell Biol 19, 229-244 (2018) ), and decreased interaction between RBPJ and the SWI / SNF complexes involved in transcriptional activation and core components of chromatin remodeling complexes ( Figure 8 B and 8C). Likewise, the RBPJ K175R mutant showed a similar interaction pattern to the FBXO42 KO background ( Fig. 9 A and 9B), indicating that FBXO42-mediated ubiquitination of RBPJ K175 is critical for its association with chromatin remodeling complexes.

[0089] To determine the overall impact of the FBXO42-RBPJ axis on chromatin remodeling activity, we analyzed differences in the interactome of key heterochromatin components CBX1, CBX3, CBX5, SUV39 H1, and TRIM28 between WT and FBXO42-KO cells. Knockdown of FBXO42 resulted in changes in the interaction landscape composed of these heterochromatin proteins; namely, altered interactions with other chromatin remodeling factors such as EMSY, PCGF6, and PHC2 ( Figure 8 D and 9C-G), further supporting their potential role in the regulation of chromatin remodeling.

[0090] Since these chromatin remodeling complexes are involved in chromatin compaction and detangling, we wondered whether the FBXO42-RBPJ axis directly regulates chromatin accessibility. Indeed, the number of heterochromatin marker HP1α foci was significantly increased in FBXO42-KO cells ( Figure 8 Furthermore, depletion of FBXO42 reduced the release of nucleosomes from chromatin after micrococcal nuclease treatment ( Figure 8 G) and reduced binding of the SWI / SNF complex to chromatin, as measured by analysis of its essential ATPase subunits SWI / SNF-associated matrix-bound actin-dependent chromatin regulator A2 (SMARCA2), SMARCA4, and the catalytic core subunit SMARCC2 ( Figure 8 H). DNase I chromatin accessibility analysis showed that upon FBXO42 depletion, the RBPJ-bound region was less sensitive to DNase I digestion and was more condensed in its chromatin state ( Figure 8 I and 8J). In addition, ATAC-seq data showed changes in global chromatin accessibility after FBXO42 knockdown ( Figure 8 K and 8L) and binding to leukemia-associated transcription factors ( Fig. 9 H), which mainly involves leukemia promoter and enhancer regions characterized by H3K4me1, H3K4me3, H3K27ac ChIP-seq and DNase-seq data from the ENCODE database ( Figure 8 M and Fig. 9 I), using ChIP-qPCR ( Fig. 9 J and 9K) further confirmed.

[0091] In conclusion, FBXO42 increases global chromatin accessibility in an RBPJ-dependent manner, which may serve as a regulator of RBPJ-primed actions for Notch signaling activation or upregulation.

[0092] Example 6: FBXO42 plays an important role in Notch signaling-dependent leukemia.

[0093] Abnormal activation of the Notch pathway is closely associated with the occurrence and progression of T-ALL; however, only a subset of these patients carry NOTCH gene mutations ( AP Weng et al., Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306, 269-271 (2004); M. Sanchez- Martin, A. Ferrando, The NOTCH1-MYC highway toward T-cell acute lymphoblastic leukemia. Blood 129, 1124-1133 (2017) ). Since FBXO42 plays a key role in Notch signaling, we wondered whether FBXO42 contributes to leukemogenesis. Therefore, we tested protein expression in several T-ALL cell lines and selected cells expressing WT NOTCH The HSB2 and JURKAT cell lines with relatively high FBXO42 levels were used for subsequent studies ( Fig.10 A). Knockdown of FBXO42 in these two cell lines ( Fig.10 B) leads to decreased expression of Notch target genes ( Fig.10 C and 10D). Similarly, FBXO42 KO leukemia cells showed reduced levels of RBPJ in the chromatin fraction ( Fig.10 E and 10F, and reduced levels of chromatin-associated SWI / SNF complex components ( Fig.10 G). To further explore the role of FBXO42 in leukemogenesis, we evaluated the effect of FBXO42 knockout on leukemic cell invasion ( Fig.10 HK), Migration ( Fig.10 LO) and anchorage-independent cell growth ( Fig.10 PS). Depletion of FBXO42 significantly reduced leukemia cell invasion, migration, and tumorigenesis ( Fig.10 HS).

[0094] To further investigate the extent to which FBXO42 regulation of Notch signaling and leukemogenesis depends directly on RBPJ, we first analyzed the expression of Notch target genes in leukemic cells in the absence of RBPJ ( Fig.10 Similar to the effects of FBXO42 depletion, loss of RBPJ in JURKAT and HSB2 cells reduced the expression of Notch target genes ( Fig.10 U and 10X). It also inhibited spheroid formation ( Fig.11 AD and anchorage-independent growth ( Fig.11EH), which is consistent with the FBXO42-KO phenotype. We further explored the function of FBXO42 in regulating Notch signaling activity in RBPJ-deficient cells. We found that in RBPJ competent cells, overexpression of FBXO42 led to a significant upregulation of HES1, HES5, and c-MYC expression. However, in RBPJ-deficient cells, overexpression of FBXO42 had a mild effect on the expression of HES1, HES5, and c-MYC. Fig.10 V and 10Y).

[0095] To determine whether FBXO42 regulation of leukemogenesis depends on its ubiquitination activity on RBPJ, we overexpressed WT FBXO42 and F-box-deficient FBXO42 mutants in FBXO42-KO cells and determined the rescue effect on the cellular phenotype. Overexpression of WT FBXO42, but not the F-box-deficient mutant, rescued Notch target gene expression in FBXO42-deficient HEK293T and leukemic cells ( Fig.12 AC). In addition, when WT FBXO42 but not the F-box deletion mutant was overexpressed, the sphere formation rate of leukemia cells ( Fig.12 DG and anchorage-independent cell growth ( Fig.12 MLN4924, which abolished FBXO42-mediated K63-linked polyubiquitination of RBPJ and Notch activation, increased cell viability ( Fig.12 L), Notch target gene expression ( Fig.12 M and 12N) and anchorage-independent growth of leukemic cells ( Fig.12 OR) was decreased, indicating that FBXO42 requires ubiquitination activity to regulate Notch signaling-dependent leukemia.

[0096] Together, these data demonstrate that FBXO42 plays an important role in Notch signaling and leukemic cell tumorigenesis in a ubiquitin- and RBPJ-dependent manner.

[0097] Example 7: Knockout of FBXO42 inhibits tumor development in human leukemia cells, mouse xenografts, and leukemia models born.

[0098] To further demonstrate the function of FBXO42 in the pathogenesis of leukemia, we determined the effect of FBXO42 KO on tumor formation. First, WT and FBXO42-KO JURKAT or HSB2 cells were subcutaneously injected into the left and right flanks of 6-week-old nude mice, respectively, to establish a xenograft leukemia model. Tumor formation was monitored for 28 days and measured every 3 days. Compared with the tumor size and tumor weight in mice injected with control JURKAT cells, the tumor size and tumor weight in mice injected with FBXO42-KO JURKAT cells were significantly reduced ( Fig.13 AC). Similar results were obtained in the HSB2-induced xenograft mouse model ( Fig.13 EG). To evaluate whether the inhibitory effect of FBXO42 on tumor formation is related to the regulation of Notch signaling, tumor tissues derived from different cells were isolated and the expression of classical Notch target genes was detected. The expression of Notch target genes was reduced in tumors formed by FBXO42-KO cells ( Fig.13 D and 13H).

[0099] We established another mouse model by tail vein injection of leukemic cells to explore the effect of FBXO42 expression on leukemic cell invasion in vivo. GFP-labeled WT FBXO42 and FBXO42-KO JURKAT cells were injected into immunodeficient NSG mice via the tail vein, and leukemia progression was monitored weekly by measuring GFP intensity by flow cytometric analysis ( Fig.13 I). We observed that knockout of FBXO42 significantly reduced leukemia burden and progression in peripheral blood ( Fig.13 J and 13K), and splenomegaly ( Fig.13 L and 13M). We found that leukemic cell infiltration and spleen histological abnormalities were attenuated in the FBXO42-KO group ( Fig.13 In addition, bioluminescence imaging using luciferase-expressing WT FBXO42 and FBXO42-KO JURKAT cells also confirmed the inhibitory effect of FBXO42 on leukemia progression and mouse survival ( Fig.13 PR). Because MLN4924 inhibits leukemic cell viability, we examined its effects in the JURKAT xenograft model. Pharmacological inhibition of FBXO42 activity by MLN4924 reduced leukemic burden in vivo without causing overt toxicity, as demonstrated by tumor growth rate ( Fig.13 SV).

[0100] Together, these data suggest that FBXO42 plays a critical role in leukemic tumorigenesis both in vitro and in vivo and may be a potential drug target for interfering with Notch-related diseases, especially T-ALL.

[0101] The present invention is not limited to the above-mentioned embodiments. Without departing from the spirit and principle of the present invention, any change, modification, substitution, combination and simplification are equivalent to the present invention and are included in the protection scope of the present invention.

Claims

1. A method for treating a Notch signaling-dependent disease in a subject by using a FBXO42-specific inhibitor, wherein the Notch signaling-dependent disease comprises an activating mutation and / or enhancement of Notch gene and / or Notch pathway activity, preferably, the Notch signaling-dependent disease is selected from leukemia, myeloma, lymphoma, breast cancer, liver cancer, head and neck squamous cell carcinoma (HNSCC), lung cancer and other cancers carrying an activating mutation and / or enhancement of Notch gene and / or Notch pathway activity.

2. The method according to claim 1, wherein the FBXO42-specific inhibitor is a polypeptide antagonist specific to FBXO42, a polynucleotide specific to FBXO42, or a small molecule compound inhibitor specific to FBXO42.

3. The method according to claim 2, wherein the polynucleotide is selected from siRNA, shRNA, guide RNA, miRNA, ASO.

4. The method according to claim 3, wherein the guide RNA comprises: 1) the nucleotide sequence of SEQ ID NO: 1 (cggcccttgtctgcaaacag); 2) a nucleotide sequence that is at least about 70%, about 80%, about 85%, about 90%, about 95%, about 99% or more identical to SEQ ID NO: 1; or 3) a nucleotide sequence having one or more amino acid additions, deletions and / or substitutions compared to SEQ ID NO: 1, The polynucleotide specific for FBXO42 is capable of binding FBXO42 gene, preventing its translation.

5. The method according to claim 2, wherein the polypeptide antagonist is an anti-FBXO42 antibody that prevents the binding of a ligand such as RBPJ, preferably, the antibody specifically binds to FBXO42.

6. The method according to claim 1, wherein the Notch signaling-dependent disease is selected from leukemia, myeloma, lymphoma, breast cancer, liver cancer, head and neck squamous cell carcinoma (HNSCC) and lung cancer with Notch-related mutations, more preferably, the Notch-related mutations include Notch1, Notch2 and / or Notch3 mutations.

7. The method of claim 6, wherein the leukemia is acute T-lymphocytic leukemia or chronic lymphocytic leukemia.

8. The method of claim 6, wherein the lymphoma is Hodgkin lymphoma, Burkitt lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, splenic marginal zone lymphoma, or follicular lymphoma.

9. The method of claim 1, wherein the subject is a non-human mammal or a human.

10. The method of claim 1, wherein the disease is metastatic cancer.

11. A method for screening a drug for treating Notch signaling-dependent diseases using FBXO42 as a target, the method comprising: The effect of the candidate drug on the expression or activity level of FBXO42 is observed. If the candidate drug can inhibit the expression or activity level of FBXO42, it indicates that the candidate drug is a potential drug for treating Notch signaling-dependent diseases. Preferably, the Notch signaling-dependent diseases include activating mutations and / or enhancements of the Notch gene and / or Notch pathway activity.

12. The method according to claim 11, wherein the Notch signaling-dependent disease is selected from leukemia, myeloma, lymphoma, breast cancer, liver cancer, head and neck squamous cell carcinoma (HNSCC), lung cancer and other cancers carrying activating mutations and / or enhanced activity of the Notch gene and / or Notch pathway; more preferably, the Notch signaling-dependent disease is selected from leukemia, myeloma, lymphoma, breast cancer, liver cancer, head and neck squamous cell carcinoma (HNSCC) and lung cancer with Notch-related mutations, and more preferably, the Notch-related mutations include Notch1, Notch2 and / or Notch3 mutations.

13. The method of claim 12, wherein the leukemia is acute T-lymphocytic leukemia or chronic lymphocytic leukemia.

14. The method of claim 12, wherein the lymphoma is Hodgkin lymphoma, Burkitt lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, splenic marginal zone lymphoma, or follicular lymphoma.

Images