Phage compound preparation as well as preparation method and application thereof

Abstract

The invention relates to the technical field of bacteriophages, in particular to a bacteriophage compound preparation as well as a preparation method and application thereof. The bacteriophage composite preparation comprises bacteriophage active particles with a multilayer structure, the bacteriophage active particles are bacteriophage particles, and the active ingredient in the bacteriophage active particles is Ralstonia solanacearum bacteriophage La1 with the preservation number of CCTCC NO: M 20242370. The bacteriophage compound preparation further comprises biocontrol microbial inoculum active particles, a first active layer of the biocontrol microbial inoculum active particles mainly comprises a biocontrol microbial inoculum and a filling agent, and a second active layer of the biocontrol microbial inoculum active particles is a bacteriophage perforin layer. The bacteriophage compound preparation is wide in antibacterial spectrum, has a broad-spectrum prevention and treatment effect on various tobacco diseases, can improve continuous cropping obstacles of tobaccos and remarkably promote growth of the tobaccos, is long in lasting period and is beneficial to improvement of the yield and the quality of the tobaccos.

Description

Technical Field

[0001] The present invention relates to the technical field of bacteriophage, and in particular to a bacteriophage compound preparation and a preparation method and application thereof. Background Art

[0002] As an important economic crop, tobacco has a wide planting area and distribution region. However, with the extension of tobacco planting years, the soil environment for tobacco planting deteriorates, the soil nutrient supply is unbalanced, tobacco diseases occur frequently, and the scope of infection expands, resulting in a decline in tobacco yield and quality.

[0003] Among various tobacco diseases, bacterial wilt is a more common and high-incidence disease, which has a serious impact on the quality and yield of tobacco. The pathogen of bacterial wilt is Ralstonia solanacearum, a soil-borne pathogen widely distributed in countries around the world, with more than 50 families and more than 200 genera of host plants. The typical characteristics of tobacco bacterial wilt are short onset and rapid spread. After the plant is infected by Ralstonia solanacearum, the tender tissues at the top of the plant, such as young leaves and new leaves, wilt. Before the leaves turn yellow and dry, the plant quickly dehydrates, withers, and wilts. The symptoms of bacterial wilt are: wilting at noon, returning to normal in the morning and at night, and repeated occurrences. The degree of wilting will gradually increase until the plant dies. After tobacco is infected with bacterial wilt, the duct structure of the stems and leaves turns black, and then the pathogen invades the cortex and pith, and typical black stripes appear on the surface.

[0004] At present, the prevention and control methods of tobacco bacterial wilt include chemical control and biological control. Among them, chemical control is the use of chemical fungicides to control bacterial wilt bacteria. However, there are problems such as environmental pollution and the easy production of drug-resistant pathogens. Therefore, biological control methods that are safer and conducive to sustainable development are receiving more and more attention.

[0005] Bacteriophages have been gradually developed and applied to the prevention and treatment of tobacco bacterial wilt due to their high specificity, safety and pollution-free properties. However, the current resources of tobacco bacterial wilt Ralstonia phages are few, and they have many problems, such as single functions, narrow lysis spectrum, short effective period in the field, and unsatisfactory control effect, which greatly affect the promotion and application of bacteriophage preparations in tobacco disease prevention and treatment.

[0006] Therefore, the prior art needs to be further improved. Summary of the invention

[0007] In view of this, the present invention provides a phage composite preparation, a preparation method and an application thereof. The phage composite preparation greatly improves the control effect of the phage composite preparation on tobacco bacterial wilt through the synergistic combination of Ralstonia solanacearum phage and biocontrol bacteria, and also improves tobacco continuous cropping obstacles.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a bacteriophage composite preparation, including bacteriophage active particles;

[0010] The bacteriophage active particles include Ralstonia pesudosoanacearum phage La1 with a deposit number of CCTCC NO: M 20242370.

[0011] In some specific embodiments of the present invention, the above-mentioned bacteriophage composite preparation further comprises active particles of biocontrol agents;

[0012] The biocontrol agent active granules are provided with at least two active layers, including a first active layer located in the core and a second active layer located in the outer layer;

[0013] The first active layer includes a biocontrol agent, and the second active layer is a bacteriophage perforin layer;

[0014] The biocontrol bacteria agent comprises Bacillus velez with a preservation number of CGMCC 1.7398 and Bacillus subtilis with a preservation number of CGMCC 1.7724.

[0015] In some specific embodiments of the present invention, the above-mentioned bacteriophage complex preparation further includes a guanine coating preparation;

[0016] The core of the guanine coating preparation is biochar particles adsorbed with guanine, and the outer layer is an ethyl cellulose coating layer.

[0017] In some specific embodiments of the present invention, the amino acid sequence of the bacteriophage perforin in the bacteriophage perforin layer of the above-mentioned bacteriophage composite preparation is SEQ ID NO: 2.

[0018] In some specific embodiments of the present invention, the nucleic acid encoding the bacteriophage perforin in the bacteriophage perforin layer of the bacteriophage complex preparation has the sequence of SEQ ID NO: 1.

[0019] In some specific embodiments of the present invention, the method for preparing the bacteriophage perforin in the bacteriophage perforin layer of the above bacteriophage composite preparation comprises the following steps:

[0020] Cloning of perforin: amplify the bacteriophage perforin gene, ligate it to the vector PET-28a after enzyme digestion, transform the ligation product into Escherichia coli, and identify and screen the positive clones;

[0021] Construction of recombinant perforin expression bacteria: extract the recombinant plasmid, transform it into Escherichia coli expression bacteria, and screen to obtain recombinant perforin expression bacteria;

[0022] Induced expression and purification of perforin: Induce the recombinant expression bacteria to express, extract the supernatant after centrifugal fermentation, and purify the protein using a His tag protein purification kit to obtain a crude extract of bacteriophage perforin.

[0023] The present invention also provides a method for preparing the above-mentioned bacteriophage composite preparation, comprising mixing the bacteriophage active particles, the biocontrol agent active particles and the guanine coating preparation in a ratio of (2~3):(2~3):1 to obtain the bacteriophage composite preparation.

[0024] In some specific embodiments of the present invention, the ratio of the bacteriophage active particles, the biocontrol agent active particles and the guanine coating preparation in the above preparation method is 2:2:1, 2:3:1, 3:2:1 or 3:3:1.

[0025] In some specific embodiments of the present invention, the preparation method of the bacteriophage active particles in the above preparation method comprises the following steps:

[0026] S1-1, mixing the phage culture solution with the protective agent to obtain a phage mixed solution;

[0027] S1-2, dropping the phage mixture into a CaCl2 solution for solidification to obtain phage microspheres, washing and then mixing with a chitosan solution, reacting for 15 min, 20 min, 25 min or 30 min, washing with water, and freeze-drying to obtain phage active particles.

[0028] In some specific embodiments of the present invention, the preparation method of the biocontrol agent active particles of the above preparation method comprises the following steps:

[0029] S2-1, using organic fertilizer as a carrier, adding 85 mL, 90 mL, 95 mL, 100 mL, 105 mL, 110 mL or 115 mL of the bacterial solution including the Bacillus Velez and the Bacillus subtilis per kilogram, adding a protective agent in an amount of 0.5%, 1%, 1.5% or 2%, fermenting, mixing with an auxiliary agent and a filler, adjusting the water content to 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24% or 25%, granulating, and low-temperature drying to obtain the second active layer;

[0030] S2-2, spraying a solution containing bacteriophage perforin protein uniformly on the surface of the second active layer, and then spraying a sodium alginate solution and a carboxymethyl chitosan solution simultaneously on the surface of the second active layer to obtain the biocontrol agent active particles.

[0031] In some specific embodiments of the present invention, the preparation method of the guanine coated preparation of the above preparation method comprises: mixing the guanine solution and adsorbent particles, drying to obtain guanine adsorbent particles, and coating with ethyl cellulose to obtain the guanine coated preparation.

[0032] The present invention also provides the use of the above-mentioned phage composite preparation or the phage composite preparation prepared by the above-mentioned preparation method in any of the following items:

[0033] (i) Prevention and treatment of tobacco diseases;

[0034] (ii) Improve the obstacles of continuous tobacco cropping;

[0035] (iii) promoting tobacco growth;

[0036] (iv) Improve tobacco stress resistance.

[0037] In some specific embodiments of the present invention, the tobacco diseases used above include: at least one of tobacco bacterial wilt, tobacco black shank, tobacco brown spot, tobacco root black rot, tobacco anthrax, and tobacco powdery mildew.

[0038] The phage composite preparation of the present invention and its preparation method and application have the following effects:

[0039] 1. The present invention provides a phage composite preparation and a preparation method thereof, wherein the phage composite preparation uses one or more of three active particles to cooperate with each other to play a synergistic role. Among them, the phage active particles use a new Ralstonia pesudosoanacearum phage La1 isolated by itself, which has a good specific lysis effect on Ralstonia pesudosoanacearum, good stability, long outdoor validity period, good compatibility with other ingredients, and can cooperate well with other effective ingredients to play an antibacterial effect.

[0040] The active particles of the biocontrol agent utilize the synergistic effect of the bacteriophage perforin on the outer layer and the biocontrol bacteria inside to exert a better antibacterial effect. The outer layer perforin is first released in the tobacco root environment carrying pathogens. The perforin first acts on the pathogens (such as Ralstonia solanacearum, etc.) in the environment. After forming holes on the pathogens, it is more conducive to the subsequent release of bacteriophages and / or biocontrol bacteria to further lyse the pathogens, thereby improving their lysis efficiency and helping to expand their lysis spectrum.

[0041] The guanine in the guanine coating preparation is released the fastest. It is first gradually released at the roots of tobacco. Guanine continues to act on tobacco, constantly stimulating the disease resistance of tobacco. Then, the active ingredients in the above-mentioned bacteriophage active particles and biocontrol agent active particles are also released and directly act on pathogens. The above-mentioned multiple active ingredients cooperate with each other and exert synergistic effects from different angles, thereby improving the prevention and control effect of tobacco against diseases, especially the effect on tobacco bacterial wilt is particularly significant.

[0042] 2. The above-mentioned phage compound preparation has excellent antibacterial effects on various tobacco disease pathogens, with a wide antibacterial spectrum, and can be widely used in the prevention and treatment of various tobacco diseases. It can also improve tobacco continuous cropping obstacles by degrading phenolic acid substances, significantly promote tobacco growth, and help improve tobacco yield and quality. In addition, the above-mentioned phage compound preparation has a long duration of action, up to 6 months, which greatly reduces the frequency of application.

[0043] Biological Deposit Description

[0044] Biological material: Ralstonia solanacearum phage La1, classification name: Ralstonia phage, deposited in China Center for Type Culture Collection on October 29, 2024, the address of the collection center is: Wuhan University, Wuhan, China; the collection number is CCTCC NO: M 20242370. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0046] Figure 1 shows the electron microscope photo of bacteriophage La1;

[0047] Figure 2 Shown are the results of the temperature stability test of bacteriophage La1;

[0048] Figure 3 Shown is the pH stability of bacteriophage La1. DETAILED DESCRIPTION

[0049] The present invention discloses a phage composite preparation and a preparation method and application thereof. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0050] In a first aspect, the present application provides a phage composite preparation, comprising: phage active particles, wherein the active ingredient in the phage active particles is Ralstonia pesudosoanacearum phage La1 with a deposit number of CCTCC NO: M 20242370.

[0051] Optionally, the preparation method of the bacteriophage active particles is:

[0052] (1) adding a protective agent to the phage culture solution, mixing evenly, and then preparing a freeze-dried powder; the protective agent is prepared from the following ingredients: resistant starch, calcium carbonate, and sodium alginate;

[0053] (2) The above phage mixture was then dropped into a CaCl2 solution for solidification to obtain phage microspheres; after washing with deionized water, the mixture was evenly mixed with a 5% chitosan solution and reacted for 20 min, washed with water again, and freeze-dried to obtain phage microcapsules.

[0054] The bacteriophage La1 was deposited in the China Center for Type Culture Collection, Wuhan University on October 29, 2024. The deposit address is Room 211, China Center for Type Culture Collection, Wuhan University, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC NO: M 20242370.

[0055] The phage was isolated from tobacco-growing soil in Weifang, Shandong Province. According to the classification method of the International Committee on Taxonomy of Viruses (ICTV), the phage's morphology was found to be consistent with the characteristics of the family Caudata, and it belongs to the short-tailed phage. The phage has good temperature stability and acid-base stability, and has excellent lysis performance against a variety of tobacco pathogens, especially Ralstonia solanacearum.

[0056] In other aspects, the present application also provides a biocontrol agent active particle, which is also provided with a first active layer located in the core and a second active layer located in the outer layer. The first active layer is mainly a biocontrol agent, and the second active layer is a bacteriophage perforin layer.

[0057] The microorganisms used in the biocontrol agent are a combination of Bacillus velez with a public preservation number of CGMCC 1.7398 and Bacillus subtilis with a preservation number of CGMCC 1.7724.

[0058] Optionally, in the bacteriophage active particles, the preparation method of the biocontrol agent is: using organic fertilizer as a carrier, adding 100 mL of bacterial solution per kilogram, adding a protective agent (maltodextrin) at an addition amount of 1%, and fermenting twice for 7 days to obtain the biocontrol agent.

[0059] Optionally, the bacterial solution is a combination of Bacillus velez with a deposit number of CGMCC 1.7398 and Bacillus subtilis with a deposit number of CGMCC 1.7724, preferably, the content ratio of the two is 1: 1. The setting of the bacteriophage perforin is the same as above.

[0060] Optionally, in the bacteriophage active particles, the protein sequence of the bacteriophage perforin is shown in SEQ ID NO: 2.

[0061] Perforin is a hydrophobic membrane protein with high charge and carboxyl terminal domains that is expressed by late transcription of bacteriophages and has a molecular weight of approximately 7.6 kDa. Perforin will assemble into oligomers within a specific period of time, forming nonspecific transmembrane channels in the cell membrane that damage the cell membrane in order to release intracellular lytic enzymes, thereby inducing bacterial death or even lysis. Perforin can aggregate on the cell membrane within 1 hour and initiate cell membrane damage. The integrity of the cell membrane is destroyed, leading to an imbalance in intracellular osmotic pressure and protein loss. This is why, when used in vitro, perforin can cause cell death without the use of lytic enzymes. The fatal cause of bacterial loss of vitality is the holes formed by perforin on the cell membrane. Perforin has an inhibitory effect on G + and G - All of them showed good antibacterial effect. Experiments have shown that bacteriophage perforin has a wider lysis spectrum based on its working principle.

[0062] In the above-mentioned active particles of biocontrol agents, perforin as the outer layer is first gradually released into the tobacco root environment carrying pathogens to be treated. Perforin first acts on pathogens in the environment (such as Ralstonia solanacearum). After forming holes on the pathogens, it is more conducive to the subsequent release of the biocontrol bacteria into the environment. The secretion of lytic enzymes enters the interior of the pathogens, thereby more efficiently achieving the lysis of the pathogens, improving their lysis efficiency, and helping to expand their lysis spectrum.

[0063] Optionally, the preparation method of the tobacco Ralstonia solanacearum perforin is:

[0064] (1) Cloning of the perforin gene: amplify the bacteriophage perforin gene, ligate it to the vector PET-28a after restriction digestion, transform the ligation product into Escherichia coli, and identify and screen the positive clones;

[0065] (2) Construction of recombinant perforin expression bacteria: extract the recombinant plasmid, transform it into Escherichia coli expression bacteria, and screen to obtain recombinant perforin expression bacteria;

[0066] (3) Induced expression and purification of perforin: Induce the recombinant expression bacteria to express, extract the supernatant after centrifugal fermentation, and purify the protein using a His tag protein purification kit to obtain a crude extract of bacteriophage perforin.

[0067] Furthermore, the phage composite preparation provided in the present application comprises: the aforementioned phage composite preparation and the aforementioned biocontrol agent active particles.

[0068] Still more preferably, the bacteriophage composite preparation includes, in addition to the aforementioned bacteriophage composite preparation and the aforementioned biocontrol agent active particles, a guanine coating preparation, the core of which is biochar particles adsorbed with guanine, and the outer layer is an ethyl cellulose coating layer.

[0069] Optionally, the preparation method of the guanine coating preparation is: mix the guanine solution and the adsorbent (biochar) particles, and obtain guanine adsorbed particles after drying; then put the guanine adsorbed particles into a coating machine, and then atomize ethyl cellulose to coat the guanine adsorbed particles to obtain third active particles.

[0070] The present application discloses that guanine does not have a direct antibacterial effect on pathogens (such as Ralstonia solanacearum), but it can inhibit the reproduction of pathogens in plants by stimulating plant immune activity, thereby exerting a tobacco disease prevention and control effect.

[0071] After the above-mentioned bacteriophage compound preparation is applied to the tobacco field, as guanine is gradually released at the roots of tobacco, guanine continues to act on the tobacco, constantly stimulating the disease resistance of tobacco. Then, the active ingredients in the above-mentioned bacteriophage active particles and biocontrol agent active particles are also released and directly act on pathogens. The above-mentioned multiple active ingredients cooperate with each other and exert synergistic effects from different angles, thereby improving the prevention and control effect of tobacco against diseases, especially the effect on tobacco bacterial wilt is particularly significant.

[0072] In a second aspect, the present application also provides a method for preparing the above-mentioned phage composite preparation, wherein the phage composite preparation comprises phage active particles, and the method for preparing the phage active particles comprises the following steps:

[0073] S1-1, adding a protective agent to the phage culture solution, mixing evenly, and then preparing a freeze-dried powder; the protective agent is prepared from the following ingredients: resistant starch, calcium carbonate, and sodium alginate;

[0074] S1-2. Then drop the above phage mixture into CaCl2 solution for solidification to obtain phage microspheres; wash with deionized water; then mix evenly with 5% chitosan solution and react for 20 minutes, wash again with water and freeze-dry to obtain phage microcapsules.

[0075] Preferably, in the method for preparing the bacteriophage composite preparation, the bacteriophage composite preparation is a mixture of bacteriophage active particles and biocontrol agent active particles, and the method for preparing the biocontrol agent active particles is:

[0076] S2-1, using organic fertilizer as a carrier, adding 100 mL of bacterial solution per kilogram, adding a protective agent at an addition amount of 1% for 7 days and fermenting twice to obtain a preliminary bacterial agent, mixing and crushing the preliminary bacterial agent with an auxiliary agent sodium carboxymethyl cellulose and a filler kaolin, adjusting the water content to 15-25%, and then adding the mixture into a centrifugal extrusion rounding three-in-one granulation equipment for granulation, and then low-temperature drying to prepare core layer particles;

[0077] S2-2, spray a layer of crude bacteriophage perforin protein extract solution evenly on the surface of the core layer particles, and dry them appropriately; then spray sodium alginate and carboxymethyl chitosan solution evenly on the surface of the core layer particles at the same time to obtain active biocontrol agent particles coated with a perforin protein layer.

[0078] Preferably, on the basis of the foregoing, the bacteriophage complex preparation also includes a guanine coated preparation, and its preparation method is: mixing the guanine solution and the adsorbent (biochar) particles, and obtaining guanine adsorbed particles after drying; then placing the guanine adsorbed particles into a coating machine, and then atomizing ethyl cellulose to coat the guanine adsorbed particles to obtain the guanine coated preparation.

[0079] In a third aspect, the present application also provides the use of the above-mentioned phage complex preparation in preventing and controlling tobacco diseases.

[0080] Optionally, the tobacco diseases include: tobacco bacterial wilt, tobacco black shank, tobacco brown spot, tobacco root black rot, tobacco anthracnose and tobacco powdery mildew.

[0081] Experimental results show that the above-mentioned phage complex preparation has excellent antibacterial effect on the pathogens of tobacco bacterial wilt, tobacco black shank, tobacco brown spot disease, tobacco root black rot, tobacco anthracnose and tobacco powdery mildew. The phage complex preparation can be used in the prevention and control of diseases caused by infection of these pathogens.

[0082] In a fourth aspect, the present application also provides the use of the above-mentioned phage composite preparation in improving tobacco continuous cropping obstacles. Experimental results show that the phage composite preparation can effectively degrade phenolic acid substances (such as ferulic acid, p-hydroxybenzoic acid, vanillic acid and syringic acid) in the soil, and the content of these phenolic acid substances in the soil increases after crop rotation and has a toxic effect on tobacco growth. Therefore, the degradation of phenolic acid substances can well improve tobacco continuous cropping obstacles and help improve tobacco planting yield and quality.

[0083] In the fifth aspect, the present application also provides the use of the above-mentioned phage compound preparation in promoting tobacco growth and improving tobacco stress resistance. Experimental results show that the fresh weight, plant height, stem thickness, leaf area, etc. of the regular and continuous tobaccos treated with the phage compound preparation are significantly improved, which shows that the phage compound preparation has a growth-promoting effect on tobacco, and its application can significantly increase tobacco yield.

[0084] The sequence information involved in the present invention is as follows:

[0085] Perforin gene:

[0086] ATGACAAATGCGCTGCACGACGTTGCAAATGAGGCCGCGAACGCCTCGCCACCGCTGGCGATGACAAATGCGCTGCACGACGTTGCAAATGAGGCCGCGAACGCCTCGCCACCGCTGGCGGTCTACACGCTGGTGCAGATCATCATCCTGGTGCGCGACCGCATCGTCCGGCCGCGCCGCGAGGCTCGCGATGCCGACCCCAGCGAATCCGCGTAA (SEQ ID NO: 1);

[0087] Perforin protein:

[0088] MTNALHDVANEAANASPPLAVVGLHFAGVTLNDVVLILTAVYTLVQIIILVRDRIVRPRREARDADPSESA (SEQ ID NO: 2).

[0089] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0090] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0091] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the application is still operable. In addition, two or more steps or actions can be performed simultaneously.

[0092] The use of any and all examples or exemplary language such as "for example" or "including" herein is intended only to better illustrate the present application and is not intended to limit the scope of the present application. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the present application.

[0093] In addition, the numerical ranges and parameters used to define the present application are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally refers to the actual value within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0094] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in the present invention are all common commercial products and can be purchased from the market.

[0095] The present invention will be further described below in conjunction with the embodiments.

[0096] Example 1: Isolation and purification of bacteriophage and determination of biological characteristics

[0097] 1. Isolation and purification of bacteriophage

[0098] The bacteriophage was sampled and separated from soil in a tobacco-growing area of ​​Weifang City, Shandong Province where bacterial wilt occurred.

[0099] Take a small amount of soil sample, add it to an appropriate amount of broth culture medium, add 12 strains of Ralstonia solanacearum, put the mixed solution into 28℃ 220 rpm / min shaking culture for 12 h, centrifuge at 11000 rpm for 5 min, and then filter it with a 0.22 μm sterile microporous filter membrane to obtain phage proliferation liquid; dilute the phage proliferation liquid at a 10-fold ratio, take appropriate gradient phage dilution liquid and mix it with 12 strains of Ralstonia solanacearum at a ratio of 1:1, incubate at 28℃ for 5 min, draw 200 μL of the mixed solution and place it in the upper agar, mix it and quickly pour it onto the lower agar plate, shake it and place it flat until the culture medium solidifies, place it in a 28℃ incubator and invert it for 4-6 h to obtain a double-layer plate with phage plaques.

[0100] Pick a single plaque from the double-layer agar medium where plaques are formed, and place it in 1 mL of NB broth and culture it in a constant temperature shaker at 28°C, 220 rpm / min for about 30 min to obtain a phage extract. Take the phage extract and mix it evenly with the corresponding plaque-forming Ralstonia solanacearum proliferation solution in a ratio of 1:1, incubate it at 28°C for 5 min, draw 200 μL and place it on the upper agar, mix it and quickly pour it on the lower agar plate, shake it evenly and place it flat until the culture medium solidifies, place it in a 37°C incubator and culture it upside down for 4-6 hours, and then obtain a double-layer plate with plaques formed again. Pick a single plaque from the double-layer culture medium where plaques are formed with sterilized tweezers and place it in 1 mL of NB broth, and culture it in a constant temperature shaker at 28°C, 220 rpm / min for about 30 min to obtain a phage extract. Repeat the above steps 3 times to obtain the purified phage extract.

[0101] The phage with the highest titer and high UV stability was selected from the isolated tobacco Ralstonia solanacearum phages. The phage formed clear plaques on double-layer agar plates without halos around them, with clearly visible edges and a diameter of about 1.2 mm.

[0102] The phage was observed under an electron microscope, and it was found that the phage had a polyhedral head structure and a non-contractile tail. The head diameter was 56~64 nm and the tail length was about 10 nm. According to the classification method of the International Committee on Taxonomy of Viruses (ICTV), the phage morphology of the present application conforms to the characteristics of the tailed bacteriophage family and belongs to a short-tailed phage, and it was named: Ralstonia pesudosoanacearum phage La1.

[0103] 2. Temperature and pH stability of Ralstonia solanacearum phage La1

[0104] (1) Experimental methods:

[0105] A. Temperature stability test: 3.00×10 10 PFU / mL Ralstonia solanacearum phage proliferation solution was placed at 40℃, 50℃, 60℃, 70℃, and 80℃, and three parallel samples were made at each temperature. After being placed for 20 min, 40 min, and 60 min, the samples were immediately cooled in an ice bath after the reaction ended, and then the phage titer at different temperatures was detected by the double-layer plate method. The thermal stability curve of the phage was drawn with temperature as the horizontal axis and the logarithm of the phage titer as the vertical axis.

[0106] B. pH stability determination: 4.5 mL of NB broth with different pH values ​​(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13) was added to three sterile test tubes. Then the test tubes were placed in a 37°C water bath. After the temperature stabilized, 500 µL of 3.00×10 10 PFU / mL phage proliferation solution, mix well and act in a 30℃ water bath for 1 h, 2 h, and 3 h. After the action is over, immediately add an appropriate amount of 1 mol / L HCl or NaOH to the mixture to make the pH value of the mixture about 7, dilute it 10 times, take the appropriate dilution gradient to determine the titer, and set 3 parallel samples for each pH value test tube. Draw the phage pH stability curve with pH as the horizontal axis and the logarithm of phage titer as the vertical axis.

[0107] (2) Experimental results and analysis

[0108] A. The results are as follows Figure 2 As shown in the figure, the titer of phage La1 was relatively stable after 60 min at a temperature between 40℃ and 70℃; it still remained active after 60 min at 80℃, with the titer maintained at 10 7 PFU / mL, and still maintains a high activity. It can be seen that the Ralstonia solanacearum phage La1 has strong heat resistance and can adapt to higher temperature environments.

[0109] B. The results are as follows Figure 3 As shown, the titer of bacteriophage La1 remained at 10 in the pH range of 2.0-12.0. 10 PFU / mL, the activity is stable; after 3 h at pH 3.0, the titer remains at 10 8 PFU / mL; after 1 h at pH 13.0, the titer of the phage was 10 8 PFU / mL, and still maintains a high activity; therefore, bacteriophage La1 has strong stability in a wide pH range and can adapt to a wide range of strong acid and strong alkaline environments.

[0110] Example 2: Preparation of tobacco Ralstonia solanacearum bacteriophage perforin

[0111] 1. Experimental methods

[0112] 1.1 Gene cloning and vector construction of Ralstonia solanacearum bacteriophage perforin

[0113] (1) Cloning of the perforin gene

[0114] The perforin gene with the gene bank number PP405626.1 was analyzed and selected on NCBI as the target gene, and the sequence is shown in SEQ ID NO: 1.

[0115] A pair of amplification primers were designed based on the above gene sequence, and the phage proliferation fluid was extracted as an amplification template. The target gene perforin gene sequence was amplified using the sequence, which was then enzymatically ligated to the vector PET-28a that underwent the same enzymatic ligation. The ligation product (recombinant plasmid) was transformed into DH5α competent Escherichia coli, and the positive clones were identified and screened by the PCR method.

[0116] (2) Expression of perforin by recombinant expression bacteria

[0117] The recombinant plasmid was extracted from the culture medium of the above positive clones, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) competent cells, and then the successfully transformed single colonies were selected.

[0118] Inoculate a single colony of the recombinant expression bacteria into LB medium containing Km and culture at 37°C with shaking until OD 600 About 0.6~0.8, add 10 μL IPTG, shake overnight at 26℃ to induce expression. The culture medium of the recombinant bacteria transformed with empty plasmid was used as a control.

[0119] All bacterial liquid was collected and centrifuged. After removing the supernatant, the bacteria were collected and resuspended with PBS. The bacteria were then ultrasonically disrupted. After centrifugation at 4°C, the supernatant was collected and analyzed by SDS-PAGE electrophoresis to detect whether the recombinant perforin protein was expressed.

[0120] (3) Purification of perforin

[0121] After ultrasonic lysis, the recombinant protein was centrifuged at 4°C, and the supernatant was taken and purified using a His tag protein purification kit. The specific method is referred to the instructions of the applicable existing kit. The purified protein was subjected to protein electrophoresis again for purity analysis.

[0122] 2. Experimental results and analysis

[0123] The experimental results showed that the recombinant perforin protein was successfully expressed in the recombinant E. coli. The purified perforin protein was freeze-dried and stored at low temperature for subsequent experiments.

[0124] Example 3: Preparation of a bacteriophage composite preparation

[0125] 1. The bacteriophage compound preparation includes the following components:

[0126] (1) Preparation of bacteriophage active particles:

[0127] S1-1, adding a protective agent to the phage culture solution, mixing evenly, and then preparing a freeze-dried powder; the protective agent is prepared from the following ingredients: resistant starch and calcium carbonate;

[0128] The specific preparation method is as follows: add phage fermentation liquid (10 8 PFU / ml) add resistant starch with a final concentration of 5-10 g / mL and calcium carbonate with a final concentration of 2-4 g / mL, stir evenly on a magnetic stirrer, then add sodium alginate with a final concentration of 3-4 g / mL to the mixture of phage and protective agent, stir evenly to obtain a phage mixture;

[0129] S1-2. Then drop the above phage mixture into CaCl2 solution for solidification to obtain phage microspheres; wash with deionized water; then mix evenly with 5% chitosan solution and react for 20 minutes, wash again with water and freeze-dry to obtain phage microcapsules.

[0130] In this embodiment, the bacteriophage used is bacteriophage La1.

[0131] (2) Preparation of active particles of biocontrol agents:

[0132] S2-1, using organic fertilizer as a carrier, adding 100 mL of bacterial solution per kilogram, adding a protective agent (maltodextrin) at a volume percentage of 1%, and fermenting twice for 7 days, stirring and introducing air every day and controlling the fermentation temperature to be below 50°C, and naturally air-drying to a moisture content of about 20% after the completion of the composting to obtain a preliminary bacterial agent, adding 2% of the auxiliary agent sodium carboxymethyl cellulose and 10% of the filler kaolin to the preliminary bacterial agent, mixing and crushing, adjusting the moisture content to 20%, and then adding the above mixture to a centrifugal extrusion rounding three-in-one granulation equipment for granulation, and then low-temperature drying to prepare core layer particles;

[0133] S2-2. Spray a 10% concentration of crude bacteriophage perforin protein solution evenly on the surface of the core layer particles, and dry them appropriately; then spray 6% sodium alginate and 10% carboxymethyl chitosan solutions evenly on the surface of the core layer particles at the same time to obtain active biocontrol agent particles coated with a perforin protein layer.

[0134] The contents of the above unspecified ingredients are expressed in mass percentage.

[0135] The organic fertilizer was purchased from Shandong Lilihui Biotechnology Co., Ltd.

[0136] The microorganisms used in the bacterial solution are a combination of Bacillus velez with a public preservation number of CGMCC 1.7398 and Bacillus subtilis with a preservation number of CGMCC 1.7724, with a content ratio of 1: 1. The above microorganisms are all purchased from China General Microbiological Culture Collection Center (CGMCC).

[0137] (3) Preparation of guanine-coated preparations

[0138] 1% (mass volume percentage) guanine solution and biochar particles as an adsorbent are mixed in a mass ratio of 1:10, and guanine adsorbed particles are obtained after drying; the guanine adsorbed particles are then placed in a coating machine, and ethyl cellulose is atomized and coated on the guanine adsorbed particles to obtain a guanine coated preparation.

[0139] The atomization coating method is as follows: add ethyl cellulose to 100 parts by weight of an ethanol solution (volume fraction of 80%), heat and stir at 70°C and a rotation speed of 500 r / min to dissolve, then spray at 80°C and a rotation speed of 12 r / min at a flow rate of 40 kg / min, heat and rotate until the spraying is completed and there is no ethanol.

[0140] Finally, the three active particles are mixed in a mass ratio of 2:2:1, immersed in molten microcrystalline wax and taken out immediately to avoid damage due to external influences.

[0141] Example 4: Growth of Ralstonia solanacearum on a medium containing guanine

[0142] 1. Experimental methods

[0143] Different concentrations of guanine were added to the NA medium to obtain NA medium with guanine concentrations of 10 ng / mL and 100 ng / mL. Ralstonia solanacearum was then inoculated into the medium and placed upside down in a 28°C incubator for 2 days.

[0144] 2. Experimental results and analysis

[0145] The results showed that the growth of Ralstonia solanacearum on the culture medium was not affected, indicating that guanine could not directly inhibit the growth of the pathogen. However, subsequent experiments proved that guanine inhibited the proliferation of the pathogen in tobacco.

[0146] Comparative Examples 1 to 6

[0147] The differences between the solutions of Comparative Examples 1 to 6 and Example 3 are shown in the following table. The parameters and preparation methods in the comparative examples other than those in the table are specifically referred to Example 3, and are specifically set as follows:

[0148] Table 1: Settings of bacteriophage complex preparations in various comparative examples (units in the table are: mass fractions)

[0149]

[0150] Effect Example 1: The control effect of bacteriophage compound preparation on various tobacco diseases

[0151] The potting method was used to determine the control effects of the phage composite preparation of Example 3 and the preparations of Comparative Examples 1 to 6 on the following five tobacco diseases:

[0152] Ralstonia solanacearum; Phytophthoranicotianae; Alternaria alternata (Fr.) Keissler; Thielaviopsis basicola; Colletotrichum micotianae Averna.

[0153] The details are as follows:

[0154] (1) Experimental methods

[0155] ①. Experiment on controlling tobacco solanacearum in potted plants

[0156] Select 5-7 leaf K326 tobacco seedlings and set up experimental group, positive control group and negative control group, with 50 tobacco seedlings of the same growth in each group. 600 =0.15 of pathogenic Ralstonia solanacearum solution was used for root irrigation, with 8 mL of solution per tobacco seedling, and the negative control group was irrigated with an equal amount of sterile water.

[0157] After 5 days, the experimental group continued to apply 10 g / plant of the bacteriophage compound preparation to the roots after root irrigation and applied appropriate amount of water, while the control group was irrigated with the same amount of sterile water. The disease was observed and recorded after 10 days of cultivation.

[0158] The investigation and classification standards of tobacco bacterial wilt are carried out in accordance with the national standard "Grading and Investigation Methods of Tobacco Pests and Diseases" (GB / T23222-2008), and the disease rate and disease index are investigated respectively. The symptom classification standards are:

[0159] Level 0: The whole plant is disease-free;

[0160] Level 1: There are occasional chlorotic spots on the stem, or less than 1 / 2 of the leaves on the diseased side wilt;

[0161] Level 3: There are black streaks on the stem, but not exceeding 1 / 2 of the stem height, or 1 / 2 to 2 / 3 of the leaves on the diseased side wilt;

[0162] Level 5: The black streaks on the stem exceed 1 / 2 of the stem height but do not reach the top of the stem or more than 2 / 3 of the leaves on the diseased side wilt;

[0163] Level 7: Black streaks on the stem reach the top of the stem, and all leaves of the diseased plant wilt;

[0164] Level 9: The diseased plants are basically dead;

[0165] Calculation formula:

[0166] Incidence rate = number of diseased plants / total number of plants investigated × 100%;

[0167] Disease index = ∑ (number of diseased plants at each level × representative value at each level) / total number of plants surveyed × highest representative value × 100;

[0168] Prevention and treatment effect (%) = (disease index of control group - disease index of treatment group) / disease index of control group × 100%.

[0169] At the same time, the soluble sugar and malondialdehyde content (a marker of cell senescence) of the tobacco seedlings of Example 3 were measured by spectrophotometer, and a control group (not using the bacteriophage composite preparation) was set up. Each group of experiments was repeated 3 times. The obtained data were analyzed for significant differences using SAS data processing software and plotted.

[0170] Soluble sugar can help plant cells maintain water balance, increase cell osmotic pressure and protect cell membranes. Plants will accumulate soluble sugars when they are in adversity. When the soluble sugar content is high, plants will attract small insects to gnaw on plant leaves, and may also transmit viral diseases. Therefore, the soluble sugar content is one of the important indicators that reflect the stress resistance of plants. When plant organs age or are damaged under adversity, membrane lipid peroxidation often occurs, and malondialdehyde is the final decomposition product of membrane lipid peroxidation. Therefore, the lower the malondialdehyde content, the better the state of the plant and the better the stress resistance. Therefore, soluble sugar and malondialdehyde can reflect the stress resistance of tobacco as markers of cell aging. Therefore, this effect example adopts the measurement of the above two indicators to reflect the changes in the stress resistance of tobacco.

[0171] ② Experiment on the prevention and treatment of tobacco black shank disease in potted plants

[0172] The experimental method is similar to that of ①. 600 = 0.12 of tobacco phytophthora liquid. Five days later, the experimental group continued to apply 10 g / plant of bacteriophage compound preparation to the roots and applied appropriate amount of water, while the control group irrigated the roots with the same amount of sterile water.

[0173] Tobacco black shank symptoms are graded as follows:

[0174] Level 0: no disease;

[0175] Level 1: The lesion area accounts for less than 5% of the entire leaf area;

[0176] Level 3: The lesion area accounts for 5% to 10% of the entire leaf area;

[0177] Level 5: The lesion area accounts for 11% to 25% of the entire leaf area;

[0178] Level 7: The lesion area accounts for 26% to 50% of the entire leaf area;

[0179] Level 9: The lesion area accounts for more than 50% of the total leaf area.

[0180] ③ Experiment on the prevention and treatment of tobacco root black rot in potted plants

[0181] The experimental method was based on method ①. The tobacco seedlings were inoculated with pathogens by irrigating the roots with tobacco root thallus liquid. After 5 days, the experimental group continued to apply 10 g / plant of the bacteriophage compound preparation to the roots and applied an appropriate amount of water, while the control group irrigated the roots with an equal amount of sterile water.

[0182] The incidence was investigated according to the standard GB / T23222-2008.

[0183] ④ Experiment on controlling tobacco anthracnose in potted plants

[0184] The experimental method was based on method ①. The tobacco seedlings were inoculated with the pathogen by irrigating the roots with the bacterial liquid of tobacco anthracnose. After 5 days, the experimental group continued to apply 10 g / plant of the bacteriophage compound preparation to the roots and applied an appropriate amount of water, while the control group irrigated the roots with an equal amount of sterile water.

[0185] The incidence was investigated according to the standard GB / T23222-2008.

[0186] ⑤ Experiment on the prevention and treatment of tobacco brown spot disease in potted plants

[0187] The experimental method was based on method ①. The tobacco seedlings were inoculated with pathogens by irrigating the roots with the Alternaria solution. Five days later, the experimental group continued to apply 10 g / plant of the bacteriophage compound preparation to the roots after root irrigation and applied an appropriate amount of water, while the control group irrigated the roots with an equal amount of sterile water.

[0188] The incidence was investigated according to the standard GB / T23222-2008.

[0189] (2) Experimental results and analysis

[0190] (a) The experimental results in Table 2 show that the phage compound preparation of the present application has good control effects on five tobacco diseases caused by five pathogenic bacteria, namely Ralstonia solanacearum, Phytophthora nicotianae, Alternaria alternata (Fr.) Keissler, Thielaviopsis basicola, and Colletotrichum micotianae Averna, among which the control effect on tobacco bacterial wilt is the highest, reaching 98%. This shows that the phage compound preparation has a wide antibacterial spectrum and has a good application prospect in the simultaneous control of multiple tobacco diseases.

[0191] Table 2: Control effect of each group on various tobacco diseases

[0192]

[0193] (b) As shown in Table 3, compared with the control group, the soluble sugar and malondialdehyde contents of the tobacco in Example 3 were significantly reduced, which can reduce the probability of tobacco being infected by pathogenic bacteria. This shows that the stress resistance of the experimental group treated with the phage composite preparation of the present application is significantly improved.

[0194] Table 3: Determination of soluble sugar and malondialdehyde content in tobacco of Example 3

[0195]

[0196] Effect Example 2: Effect of bacteriophage compound preparation on improvement of tobacco continuous cropping disorder

[0197] Determination of the ability to degrade phenolic acids: The content of phenolic acids (such as ferulic acid, p-hydroxybenzoic acid, vanillic acid and syringic acid) in the soil increases after crop rotation, which is toxic to the growth of tobacco. Therefore, this example analyzes whether the bacteriophage composite preparation provided in the present application has a degradation effect on phenolic acids.

[0198] (1) Experimental methods

[0199] Set up multiple processing groups as follows, and the processing methods for each treatment are as follows:

[0200] Experimental group 1: the phage complex prepared in Example 3 was added to the first crop soil that had not been planted with tobacco;

[0201] Control group 1: Add an equal amount of sterile water to the first crop soil that had not been planted with tobacco;

[0202] Experimental group 2: adding the bacteriophage composite preparation prepared in Example 3 to the soil of tobacco planted for 3 years;

[0203] Control group 2: Add an equal amount of sterile water as a blank control to the soil where tobacco had been planted for 3 years.

[0204] After each treatment group was treated according to the above method for 10 days, 50 g of the sample was mixed and extracted with 150 ml of ethyl acetate by ultrasonic. After standing overnight, the ethyl acetate was rotary evaporated and then dissolved in 700 μL of methanol. The changes in the content of phenolic acids in the soil were detected by HPLC under the same detection conditions as above.

[0205] (2) Experimental results:

[0206] Table 4: Degradation effect of phage complex preparation on phenolic acids in tobacco rhizosphere

[0207]

[0208] Effect Example 3: The growth-promoting effect of bacteriophage compound preparation on tobacco

[0209] (1) Experimental methods

[0210] This effect example uses the bacteriophage composite preparation prepared in Example 3. Four treatment groups are set in this experiment. The setting method is the same as that of effect example 2. The soil of each treatment group is placed in a potted flowerpot (25 cm in diameter, 28 cm in height, and 20 cm in ground diameter), and tobacco seedlings are planted. After the tobacco seedlings survive, 10 g of the bacteriophage composite preparation is applied to the roots of the tobacco seedlings of each treatment group, and a certain amount of water is poured; the treatment is repeated every 15 days according to this method, for a total of 3 times. During this period of growth of the tobacco seedlings, no additional fertilizers or pesticides are applied to them.

[0211] On the 10th day after all treatments were completed, the plant height, stem thickness, middle leaf area and maximum leaf length × width of the tobacco seedlings in each treatment group were observed and recorded.

[0212] (2) Experimental results and analysis

[0213] Table 5: Effect of phage compound preparation on tobacco growth promotion in regular and continuous cropping

[0214]

[0215] From the above results, it can be seen that compared with the control group, the tobacco treated with the phage compound preparation has been significantly improved in plant height, stem thickness, middle leaf area and maximum leaf length × width, whether it is regular cropping or continuous cropping. This shows that the phage compound preparation has a growth-promoting effect on tobacco seedlings and has a significant effect on improving tobacco continuous cropping problems.

[0216] Effect Example 4: Determination of the duration of efficacy of bacteriophage complex preparations

[0217] (1) Experimental methods

[0218] A tobacco base in Weifang was selected, which had moderate tobacco bacterial wilt. Two treatment groups were set up in the test field: experimental group, comparative example a and comparative example b, with 40 tobacco seedlings in each group. The experimental group used the bacteriophage composite preparation prepared in Example 3, and 10 g of the bacteriophage composite preparation was applied to the roots of each tobacco seedling. The comparative example a group used 10 mL of phage culture solution (concentration of 10 8 PFUs / mL, and comparative example b used the same amount of bacteriophage active particles (10 9 PFU), and other settings were the same as the experimental group. On the 30th, 60th, 90th and 180th days of observation, the control effect statistics were performed according to the investigation and classification standards of tobacco bacterial wilt in effect example 1.

[0219] (2) Experimental results and analysis

[0220] As shown in Table 6, root irrigation with a phage compound preparation in the tobacco base field can greatly reduce the incidence of tobacco bacterial wilt disease. The control effect reached 95% on the 30th day, and the phage compound preparation had a long lasting effect. On the 90th day, its control effect was still maintained at 90%. The control effect was significantly higher than that of comparison example b and much higher than that of comparison example a.

[0221] This shows that the phage compound preparation can play a long-term preventive and therapeutic role against tobacco bacterial wilt in the field.

[0222] Table 6: Determination of the protective efficacy of the phage compound preparation in the experimental group (%)

[0223]

[0224] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A bacteriophage complex preparation, characterized in that: including bacteriophage active particles; The bacteriophage active particles include a bacteriophage (Ralstoniaphage) with a deposit number of CCTCC NO: M 20242370.

2. The bacteriophage complex preparation according to claim 1, characterized in that: Also included are active particles of biocontrol agents; The biocontrol agent active granules are provided with at least two active layers, including a first active layer located in the core and a second active layer located in the outer layer; The first active layer includes a biocontrol agent, and the second active layer is a bacteriophage perforin layer; The biocontrol bacteria agent includes Bacillus velezensis with a preservation number of CGMCC 1.7398 and Bacillus subtilis with a preservation number of CGMCC 1.7724.

3. The bacteriophage complex preparation according to claim 1 or 2, characterized in that: Also included are guanine-coated preparations; The core of the guanine coating preparation is biochar particles adsorbed with guanine, and the outer layer is an ethyl cellulose coating layer.

4. The bacteriophage complex preparation according to claim 2 or 3, characterized in that: The amino acid sequence of the bacteriophage perforin in the bacteriophage perforin layer is SEQ ID NO:

2.

5. The method for preparing the bacteriophage complex preparation according to claim 3 or 4, characterized in that: The method comprises mixing the bacteriophage active particles, the biocontrol agent active particles and the guanine coating preparation in a ratio of (2-3):(2-3):1 to obtain the bacteriophage composite preparation.

6. The preparation method according to claim 5, characterized in that: The method for preparing the bacteriophage active particles comprises the following steps: S1-1, mixing the phage culture solution with the protective agent to obtain a phage mixed solution; S1-2, dropping the phage mixture into a CaCl2 solution for solidification to obtain phage microspheres, washing and then mixing with a chitosan solution, reacting, washing with water, and freeze-drying to obtain phage active particles.

7. The preparation method according to claim 5 or 6, characterized in that: The preparation method of the biocontrol agent active particles comprises the following steps: S2-1, mixing an organic fertilizer, a bacterial solution containing the Bacillus Velez and the Bacillus subtilis, and a protective agent, fermenting, mixing with an auxiliary agent and a filler, granulating, and low-temperature drying to obtain the second active layer; S2-2, spraying a solution containing bacteriophage perforin protein uniformly on the surface of the second active layer, and then spraying a sodium alginate solution and a carboxymethyl chitosan solution simultaneously on the surface of the second active layer to obtain the biocontrol agent active particles.

8. The preparation method according to any one of claims 5 to 7, characterized in that: The preparation method of the guanine coating preparation comprises: mixing guanine solution and adsorbent particles, drying to obtain guanine adsorbent particles, and coating with ethyl cellulose to obtain the guanine coating preparation.

9. Use of the bacteriophage complex preparation according to any one of claims 1 to 4 or the bacteriophage complex preparation prepared by the preparation method according to any one of claims 5 to 8 in any of the following items: (i) Prevention and treatment of tobacco diseases; (ii) Improve the obstacles of continuous tobacco cropping; (iii) promoting tobacco growth; (iv) Improve tobacco stress resistance.

10. The use according to claim 9, characterized in that The tobacco diseases include: at least one of tobacco bacterial wilt, tobacco black shank, tobacco brown spot, tobacco root black rot, tobacco anthrax, and tobacco powdery mildew.

Images