Phytobacterium pentosus for promoting cellular immunoregulation and application and product thereof

Abstract

The invention provides a plant lactobacillus pentosus for promoting cellular immunoregulation as well as application and a product thereof, and belongs to the field of microorganisms. The preservation number of the provided lactobacillus pentosus is CGMCC (China General Microbiological Culture Collection Center) No.32858, and the lactobacillus pentosus is preserved in the China General Microbiological Culture Collection Center on November 29, 2024. The strain provided by the invention can promote macrophages to secrete TNF-alpha, IL-10 and IL-1beta in a normal state and down-regulate the secretion of NO, and meanwhile, the thermally inactivated strain also has the effect of promoting the macrophages to secrete TNF-alpha, and can further intervene in the secretion of TNF-alpha, IL-10 and IL-1beta in a macrophage inflammation state; in a Caco-2 cell-macrophage co-culture system and a mouse primary epithelial cell-splenic lymphocyte co-culture system, a promotion effect is also shown.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms, and in particular relates to a strain of Lactobacillus pentosus for promoting cellular immune regulation, and applications and products thereof. Background Art

[0002] The immune system is a tissue system responsible for performing immune functions in the body. It is dedicated to defending the organism against pathogens, repairing tissue damage and serving as a barrier for continuous surveillance. It develops from birth and strengthens during childhood. Immune cells are the functional units of the immune system and can be divided into innate immune cells and adaptive immune cells. The former mainly include monocytes / macrophages, granulocytes, etc., while the latter are mainly T cells and B cells. Many immune cells play different functions in immune responses, and together with the cytokines they secrete, such as tumor necrosis factor (TNF-α), interleukin-10 (IL-10), IL-1β, etc., they maintain the health of the host body and achieve the effects of immune defense, immune homeostasis and immune surveillance.

[0003] Probiotics can promote the development and maturation of the host immune system and regulate the body's immunity. It has a regulatory effect on a variety of immune cells including epithelial cells, dendritic cells, monocytes / macrophages, B cells, T cells and NK cells. Breast milk is a newly discovered high-quality source for screening functional probiotics. Studies have shown that microorganisms in breast milk have the functions of promoting intestinal nutrient metabolism and absorption, building intestinal barriers, and enhancing immune development. In terms of regulating host immune development, lactic acid bacteria from breast milk have a natural advantage. Lactobacillus pentosus is generally considered a safe microorganism and has broad application prospects in food fermentation and production. Studies have shown that Lactobacillus pentosus can affect the body's immunity through various pathways, such as changing the structure and composition of the host's intestinal flora and regulating the level of short-chain fatty acids in feces. However, at this stage, no researchers have systematically focused on the effects of Lactobacillus pentosus from breast milk on various immune cells and their cytokines in vitro. Therefore, it is necessary to explore the stimulatory effects of breast milk-derived Lactobacillus pentosus on innate immune cells and adaptive immune cells, and to develop Lactobacillus pentosus that can immunoregulate macrophages and lymphocytes.

[0004] The prior art discloses some information about Lactobacillus pentosaceus as follows: The combination of live Lactobacillus pentosus and Spirulina platensis can maintain a good immune state in the hepatopancreas of shrimp (Liu Lei. Effects of combined use of Lactobacillus pentosus and Spirulina platensis on the growth, digestion, immunity, intestinal flora and disease resistance of Penaeus vannamei [D]. Hainan University, 2022. DOI: 10.27073 / d.cnki.ghadu.2022.000711.).

[0005] Treating RAW264.7 cells with different concentrations of Lactobacillus pentosus LZ-R-17 can significantly improve the cell's ability to phagocytize neutral red and its acid phosphatase activity. Lactobacillus pentosus LZ-R-17 can significantly increase the release of cytokines such as NO and TNF-α, IL-6, IL-1β and IL-10, indicating that it has a good immune-promoting effect (You Xiu, Zhao Xiaogan, Li Zhi, et al. Study on the immune regulation and intestinal probiotic functions of Lactobacillus helveticus LZ-R-5 and Lactobacillus pentosus LZ-R-17 from Tibetan mushrooms [C]. Chinese Society of Food Science and Technology. Abstracts of the 16th International Symposium on Probiotics and Health. College of Food Science and Technology, Nanjing Agricultural University, 2021: 2. DOI: 10.26914 / c.cnkihy.2021.004863.). Summary of the invention

[0006] In order to solve the above problems, the present invention provides breast milk-derived Lactobacillus pentosus that can immunomodulate cells (macrophages and lymphocytes).

[0007] Lactobacillus pentosus ( Lactiplantibacillus pentosus ) was formerly known as Lactobacillus pentosus, which can also be translated as Lactobacillus pentosus. The present invention uses Lactobacillus pentosus to refer to this species.

[0008] The present invention aims to provide a strain of Lactobacillus pentosus LIHUO 03 derived from breast milk that can perform immunomodulation on macrophages and lymphocytes. The strain can promote the secretion of TNF-α, IL-10 and IL-1β by macrophages under normal conditions and downregulate the secretion of NO. Meanwhile, the heat-killed strain also has the effect of promoting the secretion of TNF-α by macrophages; the heat-killed strain LIHUO03 can further intervene in the secretion of TNF-α, IL-10 and IL-1β by macrophages under inflammatory conditions; in the Caco-2 cell-macrophage co-culture system, the heat-killed strain LIHUO 03 can significantly increase the content of TNF-α secreted by macrophages under the system; in the mouse primary epithelial cell-spleen lymphocyte co-culture system, the heat-killed strain LIHUO 03 can promote the proliferation of lymphocytes.

[0009] In the present invention, a strain of Lactobacillus pentosus ( Lactiplantibacillus pentosus ) LIHUO03, was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on November 29, 2024, with the deposit number: CGMCC No.32858.

[0010] The Lactobacillus pentosus ( Lactiplantibacillus pentosus LIHUO 03 was derived from breast milk samples of healthy women in Jiangxi Province. The strain was sequenced and analyzed. pheSThe sequence fragment is shown as SEQ ID NO.1. The sequence obtained by sequencing was compared with the nucleic acid sequence in NCBI. The result showed that the strain was Lactobacillus pentosus and was named LIHUO 03.

[0011] SEQ ID NO.1: TTTCTAACACGTGAGGATGCACCATCCCAGCACCTAAAACTTCGATCCAACCCGTTTGCTTGCAGATGGCACAGCCCTTACCGTTACAGTTAAAGCAGGTCACATCAGCTTCAACGGACGGGTTCCGTGAATGGGAAGAAGCTTGGCCAGCCGCACGTCAAATTGGTCACCAAACAACGTTTTAGCAACTAAAATCAAGGTGCCCTTCAAGTC AGCCATCGTGATATGCTTATCGACTACTAGCCCTTCAATCTGATGGAATTGATGGGAATGGGTCGCATCATCCGTGTCACGCCGATAAACGCGGCCTGGTGAGAGCACTTTTAATGGGCCCTTTGAGAAATCATGATTTTCAAGTGAACGTGGTTGGTCCGCAGAAGTTTGCGTCCGTAAGAGCACGTCCTTGGTAATGTAAAAGGTATCCTGC.

[0012] The Lactobacillus pentosus LIHUO 03 has the following biological characteristics: (1) The colonies of the Lactobacillus pentosus LIHUO 03 on the MRS solid culture medium are milky white, with semicircular protrusions, a smooth and moist surface, and neat edges.

[0013] (2) Live bacteria can promote the secretion of TNF-α, IL-10, and IL-1β by macrophages under normal conditions and downregulate the secretion of NO. Heat-killed strains also have the effect of promoting the secretion of TNF-α by macrophages.

[0014] (3) Heat-killed strains can further interfere with the secretion of TNF-α, IL-10, and IL-1β in macrophages under inflammatory conditions.

[0015] (4) In the Caco-2 cell-macrophage co-culture system, the heat-killed strain can significantly increase the level of TNF-α secreted by macrophages in this system.

[0016] (5) In the mouse primary epithelial cell-spleen lymphocyte co-culture system, the heat-killed strain LIHUO 03 can promote the proliferation of lymphocytes.

[0017] The present invention also provides a method for culturing the aforementioned Lactobacillus pentosus, comprising inoculating the Lactobacillus pentosus into a culture medium.

[0018] The culture medium includes, but is not limited to, MRS culture medium and MRS-cysteine ​​hydrochloride culture medium.

[0019] As an example, the culture medium may include: 8-12 g of peptone, 8-12 g of beef extract, 3-8 g of yeast powder, 15-25 g of glucose, 1-3 g of K2HPO4, 1-3 g of diammonium citrate, 1-3 g of sodium acetate, 0.5-2 mL of Tween 80, 0.5 g of MgSO4·7H2O, and 0.25 g of MnSO4·4H2O. The pH of the culture medium is preferably 7.2-7.4.

[0020] The present invention also provides a culture of the aforementioned Lactobacillus pentosaceus.

[0021] The culture is obtained by inoculating the Lactobacillus pentosus into any one or more of a solid culture medium, a semi-solid culture medium or a liquid culture medium and then culturing the culture medium.

[0022] The culture may be a fermentation broth under some conditions.

[0023] The present invention also provides a bacterial agent, comprising any one or more of the live bacteria, dead bacteria or culture of the aforementioned Lactobacillus pentosus.

[0024] The dead bacteria are preferably heat-killed bacteria.

[0025] The present invention also provides the use of the aforementioned Lactobacillus pentosus or culture or bacterial agent in the preparation of an immunomodulatory product.

[0026] The immunomodulatory product can be used for immunomodulating macrophages or lymphocytes.

[0027] Preferably, the immunomodulatory product is used to promote the proliferation of macrophages or lymphocytes.

[0028] Preferably, the immunomodulatory product is used to promote the expression or secretion of TNF-α, IL-10 and IL-1β.

[0029] Preferably, the immunomodulatory product is used to downregulate NO secretion.

[0030] In one embodiment of the present invention, the enhancement and regulation of immunity includes at least one of the following functions: (1) Promote the secretion of TNF-α, IL-10 and IL-1β by macrophages under normal conditions and downregulate the secretion of NO.

[0031] (2) Heat-killed strains can further interfere with the secretion of TNF-α, IL-10, and IL-1β in the inflammatory state of macrophages.

[0032] (3) In the Caco-2 cell-macrophage co-culture system, it can significantly stimulate the secretion of TNF-α by macrophages in this system.

[0033] (4) In the mouse primary epithelial cell-spleen lymphocyte co-culture system, it can promote the proliferation of lymphocytes.

[0034] The present invention also provides a product comprising the aforementioned Lactobacillus pentosaceus or culture or bacterial agent.

[0035] The products include but are not limited to food, medicine or health products.

[0036] The Lactobacillus pentosus in the product may be live bacteria or dead bacteria, preferably heat-killed bacteria.

[0037] Specifically, the product may include any one or more of the fermentation broth, fermentation broth precipitate, and freeze-dried powder of Lactobacillus pentosaceus.

[0038] In some specific embodiments, the product can be a food, as known to those skilled in the art, and can also include food additives or food raw materials, wherein the food additives include any one or more of flavoring agents, colorants, fillers, disintegrants, sweeteners, lubricants, binders, and pH adjusters.

[0039] In some specific embodiments, the product can be a medicine, as known to those skilled in the art, and can also include other pharmaceutical raw materials or pharmaceutical excipients, including but not limited to any one or more of excipients, buffers, emulsifiers, stabilizers, diluents, adhesives, preservatives, and lubricants.

[0040] Based on the specific implementation of the present invention, the present invention also provides a method for preparing a postbiotic of Lactobacillus pentosus, and the preparation method at least comprises: heat-inactivating the Lactobacillus pentosus.

[0041] In some specific embodiments, the preparation method may include: (1) fermenting with the aforementioned Lactobacillus pentosaceus to obtain a fermentation liquid; (2) After centrifuging the fermentation broth in step (1), resuspending the bacterial cells to obtain a bacterial suspension; (3) The bacterial suspension in step (2) is heat-inactivated at 90-121°C for 15-30 min and tested for confirmation.

[0042] Beneficial effects of the present invention: The present invention screened out a strain of Lactobacillus pentosus LIHUO03 with good in vitro immune regulation and probiotic properties, which has the probiotic effect of regulating immunity, which is specifically embodied in: (1) LIHUO 03 can increase the secretion of TNF-α by 1381.04%, IL-10 by 464.70%, and IL-1β by 287.09% under normal conditions, and reduce the secretion of NO by 47.72%. Heat-inactivated LIHUO 03 can increase the secretion of TNF-α by 1056.72% under normal conditions.

[0043] (2) Heat-inactivated LIHUO 03 could further increase the secretion of TNF-α by 830.71%, IL-10 by 1207.40%, and decrease the secretion of IL-1β by 36.55% in macrophages under inflammatory state.

[0044] (3) In the Caco-2 cell-macrophage co-culture system, heat-inactivated LIHUO 03 could increase the secretion of TNF-α by 23.25% in macrophages in this system.

[0045] (4) In the mouse primary epithelial cell-spleen lymphocyte co-culture system, heat-inactivated LIHUO 03 can promote the proliferation of lymphocytes by 2.30%.

[0046] (5) The strain of the present invention is safe in source, extracted from breast milk of healthy women; and both the live bacteria and dead bacteria of the strain have the ability of in vitro immune regulation, and have good practical application prospects.

[0047] Collection Instructions A strain of Lactobacillus pentosus, taxonomically named Lactobacillus pentosus Lactiplantibacillus pentosus , was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on November 29, 2024, with the deposit number CGMCC No.32858, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 This is the colony morphology of Lactobacillus pentosus LIHUO 03.

[0049] Figure 2 The effect of Lactobacillus pentosus LIHUO 03 on TNF-α in normal macrophages. “****” indicates that compared with the blank group, p <0.0001, which is a very significant difference.

[0050] Figure 3The effect of Lactobacillus pentosus LIHUO 03 on IL-10 in normal macrophages. "***" indicates that compared with the blank group, p <0.001, which is a strong significant difference.

[0051] Figure 4 The effect of Lactobacillus pentosus LIHUO 03 on IL-1β in normal macrophages. "**" indicates that compared with the blank group, p <0.01, which is significantly different.

[0052] Figure 5 is the effect of Lactobacillus pentosus LIHUO 03 on NO in normal macrophages, "**" indicates that compared with the blank group, p <0.01, which is significantly different.

[0053] Figure 6 The effect of heat-killed Lactobacillus pentosus LIHUO 03 on TNF-α in normal macrophages. “****” indicates that compared with the blank group, p <0.0001, which is a very significant difference.

[0054] Figure 7 The effect of heat-killed Lactobacillus pentosus LIHUO 03 on TNF-α of inflammatory macrophages induced by LPS. “####” indicates that compared with the model group, p <0.0001, which is a very significant difference.

[0055] Figure 8 is the effect of heat-killed Lactobacillus pentosus LIHUO 03 on LPS-induced inflammatory macrophage IL-10, "####" indicates that compared with the model group, p <0.0001, with extremely significant difference; “##” means compared with the model group, p <0.01, which is significantly different.

[0056] Fig. 9 is the effect of heat-killed Lactobacillus pentosus LIHUO 03 on LPS-induced inflammatory macrophage IL-1β. “####” indicates that compared with the model group, p <0.0001, which is a very significant difference.

[0057] Fig.10 The effect of Lactobacillus pentosus LIHUO 03 on macrophage TNF-α in the Caco-2 cell-macrophage co-culture system. “**” indicates the difference between the control group and the blank group. p <0.01, which is significantly different.

[0058] Fig.11The effect of heat-killed Lactobacillus pentosus LIHUO 03 on the proliferation of lymphocytes in the mouse primary epithelial cell-spleen lymphocyte co-culture system. "**" indicates that the proliferation of lymphocytes was significantly different from that of the blank group. p <0.01, which is significantly different. DETAILED DESCRIPTION

[0059] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0060] As an example, the culture medium involved in the following embodiments is as follows: MRS medium formula (1L): peptone 10g, beef extract 10g, yeast powder 5g, glucose 20g, K2HPO42g, diammonium citrate 2g, sodium acetate 2g, Tween 80 1mL, MgSO4·7H2O 0.5g, MnSO4·4H2O 0.25g, pH 7.2-7.4; sterilize at 121℃ for 15 min.

[0061] MRS solid culture medium formula (1L): peptone 10g, beef extract 10g, yeast powder 5g, glucose 20g, K2HPO42g, diammonium citrate 2g, sodium acetate 2g, Tween 80 1mL, MgSO4·7H2O 0.5g, MnSO4·4H2O 0.25g, agar 20g, pH 7.2-7.4; sterilize at 121℃ for 15 min.

[0062] The human colorectal adenocarcinoma Caco-2 cells and mouse mononuclear macrophage RAW 264.7 cells involved in the following examples were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences.

[0063] The mouse primary small intestinal mucosal epithelial cells and mouse primary spleen lymphocytes involved in the following examples were purchased from Wuhan Pronocell Life Science Technology Co., Ltd.

[0064] The macrophage RAW 264.7 culture method involved in the following examples is as follows: After the macrophages are revived, observe the cell adhesion. If the cell growth is good and the density reaches about 80%, subculture. Aspirate the culture medium in the culture bottle, add 5mL PBS to rinse 1-2 times, and remove the residual culture medium; after aspirating the PBS for rinsing, add 1mL pancreatin, shake to make the pancreatin evenly cover the bottom of the bottle, and place it in the incubator at 37℃ for digestion; during digestion, take it out and observe it every 3-5 minutes until the edges of some cells begin to fall off, absorb the digesting pancreatin and blow the cells into a centrifuge tube containing 3-4mL complete culture medium, gently blow the cell suspension in the centrifuge tube to disperse the cells; 1000rpm, 3min centrifugation to collect cells; gently resuspend the cells with fresh DMEM culture medium, evenly inoculate the cell suspension into the culture dish, mix it by cross method or 8-shaped method, and then place it in the incubator to continue culturing and observe the cell status. Subculture 2-3 times for subsequent experiments.

[0065] The Caco-2 cell culture method involved in the following examples is as follows: The recovery, passage and culture steps are the same as those for macrophages. After the cells have grown to 80%-90% of the bottom of the bottle, use 0.25% trypsin to digest at 37°C for 2-3 minutes, then stop digestion, centrifuge, resuspend and count for later use. Caco-2 cells were inoculated into a cell migration culture chamber (also known as an insert cell culture dish), and 100 μL of cell suspension (cell number 1.0×10 5 500 μL of DMEM high-glucose medium without cells was added to the bottom side of the cell migration filter and cultured for 21 days.

[0066] The method for culturing primary mouse small intestinal epithelial cells involved in the following examples is as follows: Aspirate the culture medium in the culture flask and wash the cells once with PBS. Add 1 mL of 0.25% trypsin digestion solution to the T25 culture flask, gently rotate the culture flask until the digestion solution covers the entire bottom of the culture flask, aspirate the excess trypsin, and incubate at 37°C for 1-3 minutes; observe under an inverted microscope, and add 5 mL of complete culture medium to terminate digestion after the cells shrink. Use a pipette to gently blow and mix, inoculate into a T25 culture flask for subculture according to the subculture ratio, and then add fresh complete culture medium to 5 mL, and place it in a cell culture incubator at 37°C, 5% CO2, and saturated with appropriate temperature for static culture. After the cells are completely attached to the wall, culture and observe, and use them for experiments. After that, replace the fresh complete culture medium according to the frequency of fluid change. After the cells have grown 80%-90% of the bottom of the flask, use 0.25% trypsin to digest at 37°C for 2-3 minutes, then terminate the digestion, centrifuge, resuspend and count, and set aside. Mouse primary small intestinal epithelial cells were inoculated into the cell migration culture chamber, and 100 μL of cell suspension (cell number 1.0×10 5500 μL of cell-free small intestinal mucosal epithelial cell culture medium (Prunosai) was added to the bottom side of the cell migration filter and cultured for 21 days.

[0067] The mouse spleen lymphocyte culture method involved in the following embodiments is as follows: Collect the cells in the culture flask into a 15mL centrifuge tube, centrifuge at 1200 rpm for 3 minutes, discard the supernatant, and collect the cell pellet. Add 5mL of fresh lymphocyte-specific culture medium (Pnosai), gently blow with a pipette to mix and disperse the cells; adjust the dispersed cells to a suitable density and inoculate them into a culture vessel, place them in a 37°C, 5% CO2, and saturated cell culture incubator for static culture. After the cell state is stable, culture and observe, and use it for experiments. After that, replace the fresh complete culture medium according to the frequency of medium change.

[0068] The preparation method of the Lactobacillus pentosaceus suspension involved in the following examples is as follows: The cells were streaked on MRS solid culture medium and cultured at 37°C for 48 hours to obtain a single colony; a single colony was selected and inoculated into MRS liquid culture medium, and cultured at 37°C for 13-18 hours for activation, and activated for two generations to obtain an activation solution; the activation solution was inoculated into MRS liquid culture medium at an inoculum volume of 2% (v / v), and cultured at 37°C for 13-18 hours to obtain a bacterial solution; the bacterial solution was centrifuged at 4°C and 6000g for 5 minutes to obtain Lactobacillus pentosus cells; the Lactobacillus pentosus cells were washed with 0.01M PBS and then resuspended in 0.01M PBS to a bacterial concentration of 1×10 8 CFU / mL to obtain bacterial suspension.

[0069] The preparation method of the heat-inactivated Lactobacillus pentosaceus suspension involved in the following examples is as follows: The cells were streaked on MRS solid culture medium and cultured at 37°C for 48 hours to obtain a single colony; a single colony was selected and inoculated into MRS liquid culture medium, and cultured at 37°C for 13-18 hours for activation, and activated for two generations to obtain an activation solution; the activation solution was inoculated into MRS liquid culture medium at an inoculum volume of 2% (v / v), and cultured at 37°C for 13-18 hours to obtain a bacterial solution; the bacterial solution was centrifuged at 4°C and 6000g for 5 minutes to obtain Lactobacillus pentosus cells; the Lactobacillus pentosus cells were washed with 0.01M PBS and then resuspended in 0.01M PBS to a bacterial concentration of 1×10 8 CFU / mL, and obtain bacterial suspension. The bacterial suspension is inactivated at 90-121℃ for 15-30min, and a small amount of bacterial liquid is spread on the MRS solid plate, and cultured in a constant temperature incubator at 37℃ for 24-48h. Test and observe whether colonies are formed. No colony formation indicates that heat inactivation is completed.

[0070] Example 1 Screening, Isolation and Identification of Lactobacillus pentosus Strains The strain involved in the present invention is a lactobacillus selected from the breast milk of healthy people, and is identified as Lactobacillus pentosaceus based on molecular biology. Figure 1 1 is a colony morphology diagram of the Lactobacillus pentosus strain in the embodiment of the present invention.

[0071] The specific steps are as follows: (1) Dilution coating Aseptically pipette 1 mL of sample (healthy human breast milk) into 9 mL of sterile water to make a 1:10 dilution. Repeat the above dilution steps to obtain a dilution factor of 10. -2 , 10 -3 , 10 -4 , 10 -5 and 10 -6 Use a sterile pipette tip to draw 100 μL of the above dilution factor of 10. -4 , 10 -5 and 10 -6 The dilution was spread onto MRS solid culture medium using a spreading rod and cultured at 37°C for 48 h to obtain a dilution plate.

[0072] (2) Purification and culture Take the dilution plate with colony counts between 30 and 300, randomly select 10 to 20 milky white or white single colonies of different sizes for each sample, streak them on MRS solid culture medium in three areas, and culture them at 37°C for 48 hours to obtain single colonies. Take the single colonies on the streaked plate and inoculate them in MRS liquid culture medium respectively, culture them at 37°C for 12 hours to obtain secondary purified culture fluid.

[0073] (3) Strain preservation and identification Mix the secondary purified culture medium, take the bacteria into 2mL clean strain storage tubes, centrifuge and discard the supernatant, take the bacteria, add 1mL 30% glycerol to resuspend, and put it in a -80℃ refrigerator. At the same time, send the strain to the Chinese Institute of Microbiology for strain identification. pheS The sequence fragment is shown in SEQ ID NO. 1, and was identified as Lactobacillus pentosus, named LIHUO 03, and the preservation work was completed. The strain Lactobacillus pentosus JZ959 screened in the same period was used for comparison.

[0074] Example 2 Effects of Lactobacillus pentosus on the secretion of inflammatory factors TNF-α, IL-10, IL-1β and NO by macrophages under normal conditions 1. Experimental steps Macrophages were cultured in DMEM supplemented with 10% (v / v) fetal bovine serum at 37°C and 5% CO2.5 Cells were inoculated at the number of cells / well, and fresh culture medium was replaced after overnight culture to start experimental treatment. The experimental groups were as follows: LIHUO 03 group: 100μL LIHUO 03 bacterial suspension was added to each well; JZ959 group: 100μL JZ959 bacterial suspension was added to each well; blank group: 100μL PBS was added to each well. Three parallels were set up in each group. After treatment, the well plate was placed in a CO2 incubator at 37℃ for 2h. After incubation, the supernatant of each well was aspirated into a 1.5mL EP tube, centrifuged at 6000g for 5min, and the incubation culture supernatant was obtained, which was stored in a -80℃ refrigerator. TNF-α (Mouse TNF-alpha Quantikine Elisa kit / Mouse TNF-α ELISA kit, R&D), IL-10 (Mouse IL-1beta DuoSet Elisa kit / Mouse IL-1β ELISA kit, R&D), IL-1β (Mouse IL-10 DuoSetElisa kit / Mouse IL-10 ELISA kit, R&D) and NO (Mouse NO Elisa kit / Mouse NO ELISA kit, Elabscience) in the culture supernatant were incubated. ® ) content, and shall be tested according to the steps in its instructions.

[0075] 2. Experimental Results like Figure 2 As shown, LIHUO 03 (898.40±6.90pg / mL) can increase the content of TNF-α secreted by macrophages in the blank group (60.66±22.46pg / mL) by 1381.04%, and the promoting effect is significantly better than that of JZ959 (376.6±55.65pg / mL).

[0076] like Figure 3 As shown, LIHUO 03 (2025.00±315.90pg / mL) can increase the IL-10 secretion content of macrophages in the blank group (358.60±166.90pg / mL) by 464.70%, and the promoting effect is significantly better than that of JZ959 (606.50±161.20pg / mL).

[0077] like Figure 4 As shown, LIHUO 03 (14.40±3.46pg / mL) can increase the IL-1β secretion of macrophages in the blank group (3.72±0.28pg / mL) by 287.09%, and the promoting effect is significantly better than that of JZ959 (8.05±1.19pg / mL).

[0078] like Figure 5As shown, LIHUO 03 (8.50±2.03pg / mL) can reduce the content of NO secreted by macrophages in the blank group (16.26±2.86pg / mL) by 47.72%, and the inhibitory effect is significantly better than that of JZ959 (11.87±1.10pg / mL).

[0079] Example 3 Effect of heat-killed Lactobacillus pentosus on the secretion of inflammatory factor TNF-α by macrophages under normal conditions 1. Experimental steps Macrophages were cultured in DMEM supplemented with 10% (v / v) fetal bovine serum at 37°C and 5% CO2. 5 Cells were inoculated at the number of 100 μL / well, and fresh culture medium was replaced after overnight culture to start experimental treatment. The experimental groups were as follows: LIHUO 03 group: 100 μL LIHUO 03 heat-killed bacterial suspension was added to each well; JZ959 group: 100 μL JZ959 heat-killed bacterial suspension was added to each well; blank group: 100 μL PBS was added to each well. Three parallels were set for each group. After treatment, the well plate was placed in a CO2 incubator at 37°C for 2 hours. After incubation, the supernatant of each well was respectively aspirated into a 1.5 mL EP tube, centrifuged at 6000 g for 5 minutes, and the incubation culture supernatant was obtained, which was stored in a -80°C refrigerator. The content of TNF-α (Mouse TNF-alpha Quantikine Elisa kit / mouse TNF-α enzyme-linked immunosorbent assay kit, R&D) in the incubation culture supernatant was detected according to the steps in its instructions.

[0080] 2. Experimental Results like Figure 6 As shown, LIHUO 03 (961.70±19.73pg / mL) can increase the content of TNF-α secreted by macrophages in the blank group (83.14±2.39pg / mL) by 1056.72%, and the promoting effect is significantly better than that of JZ959 (245.70±14.72pg / mL).

[0081] Example 4 Effect of heat-killed Lactobacillus pentosus intervention on the secretion of inflammatory factors TNF-α, IL-10, and IL-1β by LPS-induced inflammatory macrophages 1. Experimental steps Macrophages were cultured in DMEM supplemented with 10% (v / v) fetal bovine serum at 37°C and 5% CO2. 5Cells were inoculated at the number of cells / well, and fresh culture medium was replaced after overnight culture to start experimental treatment. The experimental groups were as follows: LIHUO 03 group: 100μL LIHUO 03 heat-killed bacterial suspension was added to each well; JZ959 group: 100μL JZ959 heat-killed bacterial suspension was added to each well; blank group: 100μL PBS was added to each well. Three parallels were set for each group. After treatment, the well plate was placed in a 37℃ CO2 incubator for 2h. After incubation, the supernatant was aspirated. Wash each well 2-3 times with sterile PBS, add 900μL DMEM culture medium and 100μL LPS solution (10μg / mL) to each well, and the blank group was 1000μL DMEM culture medium. Each group was repeated 3 times and incubated in a 37℃, 5% CO2 incubator for 1h. After the incubation, the supernatant was aspirated and centrifuged at 6000g for 5 minutes to obtain the incubation culture supernatant, which was stored in a -80°C refrigerator. The content of TNF-α (MouseTNF-alpha Quantikine Elisa kit / Mouse TNF-α ELISA kit, R&D), IL-1β (Mouse IL-1beta DuoSet Elisa kit, Mouse IL-1β ELISA kit, R&D), and IL-10 (Mouse IL-10 DuoSetElisa kit / Mouse IL-10 ELISA kit, R&D) in the incubation culture supernatant was detected according to the instructions.

[0082] 2. Experimental Results like Figure 7 As shown, LIHUO 03 (1303.00±43.72pg / mL) can increase the content of TNF-α secreted by macrophages in the blank group (140.00±4.53pg / mL) by 830.71%, and the promoting effect is significantly better than that of JZ959 (670.00±15.39pg / mL).

[0083] like Figure 8 As shown, LIHUO 03 (690.7±13.14 pg / mL) can increase the IL-10 secretion of macrophages in the blank group (52.83±4.400 pg / mL) by 1207.40%, and the promoting effect is significantly better than that of JZ959 (98.59±4.46 pg / mL).

[0084] like Fig. 9As shown in the results, LIHUO 03 (0.92±0.024pg / mL) can reduce the secretion of IL-1β by 36.55% in macrophages of the blank group (1.45±0.084pg / mL), and the inhibitory effect is significantly better than that of JZ959 (0.075±0.0063pg / mL). Compared with the model group (0.019±0.0030pg / mL), LIHUO 03 can alleviate the reduction of IL-1β secretion of macrophages caused by LPS, which is nearly 47 times higher.

[0085] Example 5 Effect of heat-killed Lactobacillus pentosus LIHUO 03 on macrophage TNF-α in a Caco-2 cell-macrophage co-culture system 1. Experimental steps The culture method of Caco-2 cells and macrophages was as described above. After Caco-2 cells were cultured to form a dense monolayer, they were inoculated in the cell migration chamber for 10 5 macrophages, and add 500 μL of DMEM medium. After the cells adhere to the wall and grow, they are moved into the upper chamber of Caco-2 cells that form a barrier, and fresh complete medium is replaced.

[0086] The experimental groups are as follows: LIHUO 03 group: 200 μL DMEM culture medium and 100 μL LIHUO 03 heat-killed bacteria suspension were added to each well; JZ959 group: 200 μL DMEM culture medium and 100 μL JZ959 heat-killed bacterial suspension were added to each well; Blank group: 200 μL DMEM culture medium and 100 μL PBS were added to each well.

[0087] Each group was repeated three times and incubated in a 37°C, 5% CO2 incubator for 2 hours. After the incubation was completed, the supernatant of the lower chamber was aspirated and centrifuged at 6000g for 5 minutes to obtain the incubation culture supernatant, which was stored in a -80°C refrigerator. The content of TNF-α (MouseTNF-alpha Quantikine Elisa kit / mouse TNF-α enzyme-linked immunosorbent assay kit, R&D) in the incubation culture supernatant was detected according to the instructions.

[0088] 2. Experimental Results like Fig.10 As shown, LIHUO 03 (749.50±27.99pg / mL) can increase the content of TNF-α secreted by macrophages in the blank group (608.10±7.38pg / mL) by 23.25%, and the promoting effect is significantly better than that of JZ959 (641.60±36.80pg / mL).

[0089] Example 6 Effect of heat-killed Lactobacillus pentosus LIHUO 03 on lymphocyte proliferation in a mouse primary intestinal epithelial cell-spleen lymphocyte co-culture system 1. Experimental steps The culture method of mouse primary small intestinal epithelial cells and spleen lymphocytes was as described above. After the mucosal epithelial cells were cultured to form a dense monolayer, they were inoculated in the cell migration chamber for 10 5 splenic lymphocytes, and add 500 μL of splenic lymphocyte-specific culture medium. After the cells adhere to the wall and grow, they are moved into the upper chamber of mucosal epithelial cells that form a barrier, and fresh complete culture medium is replaced respectively.

[0090] The experimental groups are as follows: LIHUO 03 group: 200 μL of mucosal epithelial cell culture medium and 100 μL of LIHUO 03 heat-killed bacteria suspension were added to each well; JZ959 group: 200 μL of mucosal epithelial cell culture medium and 100 μL of JZ959 heat-killed bacterial suspension were added to each well; Blank group: 200 μL of mucosal epithelial cell culture medium and 100 μL of PBS were added to each well.

[0091] Each group was repeated 3 times and incubated in a 37°C, 5% CO2 incubator for 2 hours. After the incubation was completed, the upper chamber was removed, and 50 μL of CCK-8 solution was added to the lower chamber. The cells were incubated in a 37°C, 5% CO2 incubator for 4 hours, and the OD450nm was detected. The lymphocyte proliferation rate was calculated using the following formula: Proliferation rate = (OD 实验组 -OD 空白组 ) / OD 空白组 ×100%.

[0092] 2. Experimental Results like Fig.11 As shown in the results, LIHUO 03 (2.30%±0.50%) can promote the proliferation of spleen lymphocytes by 2.30%, and the promoting effect is significantly better than JZ959 (0.50%±0.6%).

[0093] Comparative Example The comparison with other Lactobacillus pentosus with immunomodulatory function in the prior art is as follows:

[0094] The above embodiments are only used to illustrate the present invention, not to limit the present invention. Technical solutions obtained by those skilled in the art through further improvements based on the technology of the present invention are all within the protection scope of the present invention.

Claims

1. A strain of Lactobacillus pentosus ( Lactiplantibacillus pentosus ), characterized in that, The Lactobacillus pentosus is Lactobacillus pentosus LIHUO 03, with a preservation number of CGMCC No.32858, and was deposited in the General Microbiology Center of the China National Microbiological Culture Collection Administration on November 29, 2024.

2. The culture of Lactobacillus pentosus according to claim 1, characterized in that The lactobacillus pentosus is inoculated into any one or more of a solid culture medium, a semi-solid culture medium or a liquid culture medium and then cultured.

3. A bacterial agent, characterized in that: The method comprises any one or more of the live bacteria or dead bacteria of Lactobacillus pentosus according to claim 1 or the culture according to claim 2.

4. Use of the Lactobacillus pentosus according to claim 1, the culture according to claim 2, or the bacterial agent according to claim 3 in the preparation of an immunomodulatory product.

5. The use according to claim 4, characterized in that: The immunomodulatory product is used for immunomodulating macrophages or lymphocytes.

6. The use according to claim 5, characterized in that: The immunomodulatory product is used to promote the proliferation of macrophages or lymphocytes, promote the expression or secretion of TNF-α, IL-10 and IL-1β, and down-regulate the secretion of NO.

7. A product comprising the Lactobacillus pentosus according to claim 1, the culture according to claim 2, or the bacterial agent according to claim 3.

8. The product according to claim 7, characterized in that The product comprises any one or more of the fermentation liquid, fermentation liquid precipitation and freeze-dried powder of Lactobacillus pentosaceus; the product is food, medicine or health product.

9. A method for preparing a postbiotic of Lactobacillus pentosus, characterized in that: The preparation method comprises: heat-inactivating the Lactobacillus pentosus described in claim 1.

10. The preparation method according to claim 9, characterized in that: The preparation method comprises: (1) fermenting the Lactobacillus pentosaceus described in claim 1 to obtain a fermentation liquid; (2) After centrifuging the fermentation broth in step (1), resuspending the bacterial cells to obtain a bacterial suspension; (3) The bacterial suspension in step (2) is heat-inactivated at 90-121°C for 15-30 min and tested for confirmation.

Images