A molecular characteristic detection method and application of gene-edited disease-resistant pigs

Abstract

The present invention discloses a method for detecting molecular characteristics of gene-edited disease-resistant pigs and its application. The present invention provides a CRISPR / Cas12a nucleic acid detection system, which includes a nucleic acid detection system 1; the nucleic acid detection system 1 includes crRNA1; the nucleotide sequence of the crRNA1 is SEQ ID NO.11. The present invention provides a detection method for AE26-CAAS gene-edited disease-resistant pigs based on the CRISPR / Cas12a system, which has high sensitivity, strong specificity, simplicity and ease of use, is convenient for rapid on-site detection, and is economical, simple, efficient and rapid, laying the foundation for the commercial production of gene-edited disease-resistant pigs.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a method for detecting molecular characteristics of gene-edited disease-resistant pigs and its application. Background Art

[0002] Gene editing is a future direction for animal breeding. The United States, Japan, and other countries have approved the marketing of a variety of gene-edited animals, including GalSafe gene-edited pigs, Madai red snapper, 22-seiki fugu tiger pufferfish, and PRLR-SLICK gene-edited cattle. The porcine pAPN protein is a key receptor for transmissible gastroenteritis virus (TGEV) entry into cells. Knocking out or editing the pAPN gene can render pigs completely resistant to TGEV. Currently, multiple teams domestically and internationally have successfully produced pAPN gene-edited pigs, and challenge experiments have confirmed that pAPN gene editing completely protects against TGEV infection.

[0003] The AE26-CAAS gene-edited pig was obtained through gene editing technology. After genetic modification, the second exon of the pAPN gene of this pig was deleted by 26 bp bases, which caused the pAPN gene to terminate prematurely during translation and could not produce functional APN protein, thereby achieving resistance to porcine transmissible gastroenteritis TGEV virus.

[0004] Nucleic acid testing of gene-edited animals is a prerequisite for the supervision, management and industrialization of gene-edited animals and their products. Therefore, it is necessary to find a rapid method for detecting AE26-CAAS gene-edited disease-resistant pigs. Summary of the Invention

[0005] The technical problem solved by the present invention is how to quickly and accurately detect AE26-CAAS gene-edited disease-resistant pigs.

[0006] In order to solve the above technical problems, the first aspect of the present invention provides a crRNA group, which includes crRNA1,

[0007] The nucleotide sequence of the crRNA1 binding target is SEQ ID NO.2.

[0008] The above crRNA group targets the pAPN gene.

[0009] In the crRNA group described above, the crRNA1 is transcribed in vitro from transcription template 1;

[0010] The transcription template 1 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO. 5 and the single-stranded DNA molecule shown in SEQ ID NO. 8.

[0011] In the crRNA group described above, the nucleotide sequence of crRNA1 is SEQ ID NO.11.

[0012] In the crRNA group described above, the crRNA also includes crRNA2,

[0013] The nucleotide sequence of the crRNA2 binding target is SEQ ID NO.3.

[0014] In the crRNA group described above, the crRNA2 is transcribed in vitro from transcription template 2;

[0015] The transcription template 2 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO. 6 and the single-stranded DNA molecule shown in SEQ ID NO. 9.

[0016] In the crRNA group described above, the nucleotide sequence of crRNA2 is SEQ ID NO.12.

[0017] In a second aspect, the present invention provides a product comprising the crRNA1, Cas12a protein, a primer pair for specifically amplifying each binding target, and a single-stranded DNA probe described in the first aspect;

[0018] Or, the product includes the crRNA1 and crRNA2 described in the first aspect, Cas12a protein, a primer pair for specifically amplifying each binding target, and a single-stranded DNA probe;

[0019] And / or, the two ends of the single-stranded DNA probe are respectively labeled with different groups;

[0020] And / or, the group is a fluorescent group, a quenching group and / or biotin.

[0021] The single-stranded DNA probe is a single-stranded DNA rich in AT bases with a length of 10-50 nt.

[0022] The above-mentioned single-stranded DNA probe can be specifically as follows:

[0023] The single-stranded DNA probe used for fluorescence detection is labeled with a fluorescent group and a quenching group at both ends respectively;

[0024] The single-stranded DNA probe used for test strip detection is labeled with a fluorescent group and biotin at both ends.

[0025] In the above-mentioned product, the primer pair consists of a single-stranded DNA molecule represented by SEQ ID NO.13 and a single-stranded DNA molecule represented by SEQ ID NO.14;

[0026] The products mentioned above are test kits, test strips or fluorescence detection systems.

[0027] The product has any of the following functions:

[0028] B1) Identify or assist in identifying AE26-CAAS gene-edited pigs;

[0029] B2) Identify or assist in identifying whether the sample to be tested contains the AE26-CAAS gene editing sequence;

[0030] B3) Identify or assist in identifying the genotype of AE26-CAAS gene-edited pigs.

[0031] In a third aspect, the present invention provides any of the following substances:

[0032] A1) the Cas12a protein and the crRNA described in the second aspect, or a complex formed by the two;

[0033] A2) the Cas12a protein, the crRNA1, and the crRNA2 described in the second aspect, or a complex group formed by each of them and the Cas12a protein;

[0034] A2) The primer pair described in the second aspect.

[0035] In a fourth aspect, the present invention provides the use of the crRNA described in the first aspect or the product described in the second aspect in any of the following:

[0036] B1) Identify or assist in identifying AE26-CAAS gene-edited pigs;

[0037] B2) Identify or assist in identifying whether the sample to be tested contains the AE26-CAAS gene editing sequence;

[0038] B3) Identify or assist in identifying the genotype of AE26-CAAS gene-edited pigs;

[0039] B4) Prepare products to identify or assist in the identification of AE26-CAAS gene-edited pigs;

[0040] B5) Prepare products to identify or assist in identifying whether a sample contains the AE26-CAAS gene editing sequence;

[0041] B6) Prepare products for identifying or assisting in identifying the genotype of AE26-CAAS gene-edited pigs.

[0042] In a fifth aspect, the present invention provides a method for identifying or assisting in identifying AE26-CAAS gene-edited pigs, comprising the following steps:

[0043] C1) using the nucleic acid of the sample to be tested as a template, performing RPA amplification with the primer pair described in the second aspect to obtain an RPA amplification product;

[0044] C2) preparing a CRISPR-Cas12a detection system comprising the following components: the PCR product, the Cas12a protein described in the second aspect, crRNA1 in the crRNA described in the second aspect, and the single-stranded DNA probe described in the second aspect;

[0045] C3) reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying or assisting in identifying the AE26-CAAS gene-edited pig;

[0046] In an embodiment of the present invention,

[0047] In the above, the detection reaction product is used to identify or assist in identifying the AE26-CAAS gene-edited pig as E or F as follows:

[0048] E. Detect the fluorescence intensity of each reaction product using a fluorescence detection instrument such as a microplate reader or a fluorescence quantitative PCR instrument:

[0049] If the fluorescence intensity of the reaction product of the detection system is extremely significant ( P <0.01) is higher than the reaction product of the negative control system, then the sample to be tested is derived from or is a candidate for being derived from the AE26-CAAS gene-edited pig; if the fluorescence intensity of the reaction product of the detection system 1 is not significant ( P >0.05) is higher than the reaction product of the negative control system, then the sample to be tested is not derived from or the candidate is not derived from the AE26-CAAS gene-edited pig; the negative control system differs from the detection system only in that crRNA1 is not added;

[0050] F. Each reaction product is tested using colloidal gold test strips (Cas12 / 13 special nucleic acid colloidal gold test strips (JY0301), Beijing Libo Taiye Technology Co., Ltd.):

[0051] If both the T and C lines detected by the reaction product of the detection system are colored or only the T line is colored (positive), then the sample to be tested is derived from or may be derived from the AE26-CAAS gene-edited pig; if the C line detected by the reaction product of the detection system 1 is colored and the T line is not colored (negative), then the sample to be tested is not derived from or may be derived from the AE26-CAAS gene-edited pig.

[0052] In a sixth aspect, the present invention provides a method for identifying or assisting in identifying the genotype of an AE26-CAAS gene-edited pig, comprising the following steps:

[0053] D1) using the nucleic acid of the sample to be tested as a template, performing RPA amplification with the primer pair described in the second aspect to obtain an RPA amplification product;

[0054] D2) preparing CRISPR-Cas12a detection system 1 and CRISPR-Cas12a detection system 2 containing the following components;

[0055] The CRISPR-Cas12a detection system 1 includes the PCR product, the Cas12a protein described in the second aspect, the crRNA1 in the crRNA described in the second aspect, and the single-stranded DNA probe in the second aspect;

[0056] The CRISPR-Cas12a detection system 2 includes the PCR product, the Cas12a protein described in the second aspect, the crRNA2 in the crRNA described in the second aspect, and the single-stranded DNA probe in the second aspect;

[0057] D3) reacting the CRISPR-Cas12a detection system 1 and the CRISPR-Cas12a detection system 2 separately, detecting the reaction products of the two systems to identify or assist in identifying the genotype of the AE26-CAAS gene-edited pig.

[0058] In the above, the reaction products of the two systems can be detected to identify or assist in identifying the genotype of the AE26-CAAS gene-edited pigs using colloidal gold test strips (Cas12 / 13-specific nucleic acid colloidal gold test strips (JY0301) Beijing Libotai Technology Co., Ltd.) as follows:

[0059] If the reaction product of the detection system 1 detects that both the T and C lines are colored or only the T line is colored (positive), and the reaction product of the detection system 2 detects that the C line is colored and the T line is not colored (negative), then the sample to be tested is derived from or is a candidate for being derived from a homozygous AE26-CAAS gene-edited pig;

[0060] If the reaction product of the detection system 1 detects that both the T and C lines are colored or only the T line is colored (positive), and the reaction product of the detection system 2 detects that both the T and C lines are colored or only the T line is colored (positive), then the sample to be tested is derived from or can be derived from the AE26-CAAS gene-edited pig heterozygote.

[0061] In the above, the sample to be tested is the ear or other tissue of the pig to be tested.

[0062] The method is not for the purpose of disease diagnosis or treatment.

[0063] Experiments in the present invention have proved that the present invention provides a detection method for AE26-CAAS gene-edited disease-resistant pigs based on the CRISPR / Cas12a system, which is highly sensitive, specific, simple and easy to use, convenient for rapid on-site detection, and economical, simple, efficient and fast, laying the foundation for the commercial production of gene-edited disease-resistant pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 The standard plasmid sequencing results for AE26-CAAS gene-edited pigs and pAPN gene wild-type pigs.

[0065] Figure 2 The results of RPA primer amplification are shown.

[0066] Figure 3 Results of crRNA activity testing targeting the AE26-CAAS gene to edit the porcine pAPN gene sequence. ** indicates a highly significant difference compared to the negative control group ( P <0.01), ns indicates no significant difference compared with the negative control group ( P >0.05).

[0067] Figure 4 The results of crRNA activity detection targeting the WT pig pAPN gene sequence. ** indicates a very significant difference compared with the negative control group ( P <0.01), ns indicates no significant difference compared with the negative control group ( P >0.05).

[0068] Figure 5 RPA amplification sensitivity results for targeting AE26-CAAS gene editing of porcine pAPN gene sequence.

[0069] Figure 6 The sensitivity results of RPA amplification targeting the WT pig pAPN gene sequence.

[0070] Figure 7 This is the fluorescence detection sensitivity result of targeting pAE26-CAAS gene editing of porcine pAPN gene sequence. ** indicates a very significant difference compared with the negative control group ( P <0.01), ns indicates no significant difference compared with the negative control group ( P >0.05).

[0071] Figure 8 The fluorescence detection sensitivity results targeting the WT pig pAPN gene sequence. ** indicates a very significant difference compared with the negative control group ( P <0.01), ns indicates no significant difference compared with the negative control group ( P >0.05).

[0072] Figure 9 AE26crRNA system is used to detect pig nucleic acid samples.

[0073] Figure 10 Detect pig nucleic acid samples for the WT crRNA system.

[0074] Figure 11 This is the analysis result of the combined detection of pig nucleic acid samples using the AE26crRNA system and the WTcrRNA system. DETAILED DESCRIPTION

[0075] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0076] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0077] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0078] The present invention is described below with reference to specific examples. These examples are intended to be illustrative only and are not intended to limit the scope of the invention. Unless otherwise specified, the examples were performed according to conventional experimental conditions, such as those in Sambrook et al. (Sambrook J & Russell DW, Molecular Cloning: A Laboratory Manual, 2001), or according to the conditions recommended in the manufacturer's instructions.

[0079] The main reagents used in the following examples are:

[0080] LbCas12a protein (EDE0005-2000) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; 10× LbCas12a Cleavage Buffer (EDE0005-B) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; tissue DNA extraction kit (DP304-03) was purchased from Tiangen Biochemical Technology Co., Ltd.; EX Taq enzyme (RR001Q) was purchased from Takara; CloneSmarter The TOPO cloning vector kit (C5865-50) was purchased from Sino-US Taihe Biotechnology (Beijing) Co., Ltd.; Escherichia coli DH5α competent cells (B528413-0100) were purchased from Sangon Biotech (Shanghai) Co., Ltd.; primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.; the T7 in vitro transcription kit (AM1354) was produced by Invitrogen; the single-stranded DNA fluorescent probe was synthesized by Sangon Biotech (Shanghai) Co., Ltd.; the single-stranded DNA colloidal gold test paper probe (EDN-THD02) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; the Cas12 / 13-specific nucleic acid detection strip (JY0301) was purchased from Beijing Libo Taiye Technology Co., Ltd.; and the TWistAmp Basic kit (TABS03KIT) was purchased from Beijing Libo Taiye Technology Co., Ltd.

[0081] The main instruments are as follows: PCR instrument (C1000 TouchTM, BIO-RAD); desktop high-speed refrigerated centrifuge (Heraeus Multifuge X1R, Thermo); bacterial incubator (MIR-254, SANYO); vortex shaker (SA8, Stuart-equipment); electronic weighing balance (Sartorius SQP, Sartorius Scientific Instrument Co., Ltd.); gel imaging system (BIO-RID, Universal Hood II); constant temperature water bath (HHS-21-4, Changzhou Noki Instrument Co., Ltd.); fluorescence quantitative PCR instrument (QuantStudio™5, Thermo Scientific).

[0082] The AE26-CAAS gene-edited pigs in the following examples were prepared as follows:

[0083] DKO pigs were bred with wild-type Large White pigs (from the Ninghe original breeding pig farm in Tianjin, hereinafter referred to as pAPN gene wild-type pigs (WT)) to produce offspring pigs. Genotype testing was performed on the offspring pigs, and offspring pigs with only the 26bp deletion of the pAPN gene were selected, namely AE26-CAAS pigs.

[0084] The method for the above genotype detection is as follows:

[0085] The genomic DNA of the ear edge skin or tail skin tissue of the offspring pigs was extracted, and PCR amplification was performed using primers pAPN-PCR-F (5`-TACCCAGTTCAGTGACCTTCGTC-3`) and pAPN-PCR-R (5`-TGCTCGGCATTCTTGTTCTTCT-3`), and the amplified fragments were detected by gel electrophoresis.

[0086] Electrophoresis detection showed that the sample with a single band of 260 bp in length was a genotype with single pAPN gene editing on two homologous chromosomes and a 26 bp deletion, and was named AE26-CAAS gene-edited pig homozygote.

[0087] Electrophoresis detection showed that the sample with two bands of 286 bp and 260 bp in length was a genotype with a single pAPN gene edited on one homologous chromosome and a 26 bp deletion, and the other was a wild-type pAPN gene, named AE26-CAAS gene-edited pig heterozygote.

[0088] Electrophoresis detection showed that the sample with a single band of 286 bp in length had wild-type pAPN gene on two homologous chromosomes, and was named pAPN gene wild-type pig or wild-type pig.

[0089] Compared with wild-type pigs carrying the pAPN gene, the homozygous AE26-CAAS gene-edited pigs have only the 82nd to 107th positions of the second exon of the pAPN gene (genbank number: NM_214277, submitted on 2024-6-2) (positions 82nd to 107 of the nucleotide sequence of the pAPN gene shown in genbank number NM_214277) deleted (26 bp bases) in the two homologous chromosomes, while other genes remain unchanged.

[0090] Compared with wild-type pigs with the pAPN gene, the AE26-CAAS gene-edited heterozygotes have only a deletion (26 bp bases) in the second exon of the pAPN gene (genbank number: NM_214277, submitted on 2024-6-2) (positions 82-107 of the nucleotide sequence of the pAPN gene shown in genbank number: NM_214277) on one homologous chromosome, while other genes remain unchanged; the other homologous chromosome is the same as the wild-type pig with the pAPN gene.

[0091] The above-mentioned DKO pigs are gene-edited pigs in which both the CD163 and pAPN genes are knocked out simultaneously. The pAPN gene has two genotypes: a 5bp deletion and a 26bp deletion. After genetic modification, the second exon of the pAPN gene is deleted by 26 bp, causing the pAPN gene to terminate translation prematurely and unable to produce functional APN protein, thereby achieving resistance to transmissible gastroenteritis of swine virus (TGEV).

[0092] Double-gene knockout (DKO) pigs are described in the following literature: Xu K, Zhou Y, Mu Y, Liu Z, Hou S, Xiong Y, Fang L, Ge C, Wei Y, Zhang X, Xu C, Che J, Fan Z, Xiang G, Guo J, Shang H, Li H, Xiao S, Li J, LiK. CD163 and pAPN double-knockout pigs are resistant to PRRSV and TGEV and exhibit decreased susceptibility to PDCoV while maintaining normal production performance. Elife. 2020 Sep 2;9:e57132. doi: 10.7554 / eLife.57132.

[0093] Example 1: RPA-CRISPR / Cas12a nucleic acid detection system for detecting AE26-CAAS gene-edited pigs

[0094] 1. Acquisition of crRNA

[0095] 1. Standard plasmid construction

[0096] A tissue DNA extraction kit was used to extract DNA from the ear tissues of homozygous AE26-CAAS gene-edited pigs and wild-type pigs carrying the pAPN gene (wild type, WT). The primers shown in Table 1 below were used to amplify the upstream and downstream sequences of the target site of the second exon of the pAPN gene to obtain PCR products.

[0097] Table 1 shows the primers for amplifying the pAPN gene

[0098]

[0099] The PCR reaction system is as shown in Table 2:

[0100] Table 2 shows the PCR reaction system.

[0101]

[0102] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 1 min, 36 cycles; and incubation at 72°C for 5 min.

[0103] The PCR products were gel-recovered and purified, and the purified products were ligated into the pClone-EZ-TOPO vector (China-US Taihe Biotechnology (Beijing) Co., Ltd., C5865-50). After sequencing verification, the gene-edited pig pAPN gene standard plasmid pClone-EZ-TOPO-AE26 and the wild-type pig pAPN gene standard plasmid pClone-EZ-TOPO-WT were obtained.

[0104] pClone-EZ-TOPO-AE26 is a vector obtained by replacing the TOPO I site of the pClone-EZ-TOPO vector with the AE26-CAAS gene editing sequence (SEQ ID NO. 16).

[0105] pClone-EZ-TOPO-WT is a vector obtained by replacing the TOPO I site of the pClone-EZ-TOPO vector with the wild-type sequence (SEQ ID NO. 17).

[0106] Compared with the wild-type sequence, the above-mentioned gene editing sequence is a sequence obtained by deleting positions 487-512 of the wild-type sequence.

[0107] The sequencing results of the two plasmids are as follows Figure 1 As shown, Figure 1 A is the sequencing result of the AE26-CAAS gene-edited pig pAPN gene standard plasmid, Figure 1 B is the sequencing result of the wild-type pig pAPN gene standard plasmid.

[0108] 2. crRNA target design

[0109] Based on the DNA sequences within 40 bp upstream and downstream of the target site of the second exon of the pAPN gene in AE26-CAAS gene-edited pigs and pAPN gene wild-type pigs, sequences that meet the recognition requirements of LbCas12a were searched, and then three candidate target sites were screened according to the rules of sequence GC content, sequence complementarity, etc. Among them, AE26crRNA-T1 to AE26crRNA-T2 are candidate target sites screened for gene-edited disease-resistant pigs AE26-CAAS, and WTcrRNA-T1 is a candidate target site screened for wild-type pigs (wildtype, WT) of the pAPN gene, as shown in Table 3.

[0110] Table 3 shows the crRNA of candidate target sites

[0111]

[0112] 3. Preparation of specific crRNA in vitro transcription template

[0113] According to the candidate target site sequence, the T7 promoter sequence (TAATACGACTCACTATAGGG) (Chen JS et al. Science, 2018, 360(6387):436-439.) and the crRNA repeat region template sequence (TAATTTCTACTAAGTGTAGAT) were added to form the specific crRNA in vitro transcription template positive-strand DNA sequence (SEQ ID NO.4-6) shown in Table 4, and the negative-strand DNA sequence (SEQ ID NO.7-9) was formed according to the complementary pairing of the positive-strand DNA sequence.

[0114] Table 4 shows the positive and negative strands of the specific crRNA in vitro transcription templates.

[0115]

[0116] Synthesize positive and negative strand DNA single strands and prepare specific crRNA in vitro transcription templates by annealing. Prepare the following annealing reaction system in a PCR tube as shown in Table 5:

[0117] Table 5 shows the annealing reaction system

[0118]

[0119] Place the PCR tube in a PCR instrument and incubate at 95°C for 10 minutes. Immediately turn off the PCR instrument and allow the double-stranded DNA to slowly cool at room temperature. After 90 minutes, incubate on ice for 5 minutes. The annealed product is the crRNA in vitro transcription template and can be used for in vitro crRNA transcription.

[0120] 4. Specific crRNA in vitro transcription

[0121] The T7 in vitro transcription kit (AM1354) produced by Invitrogen was used to prepare the transcription system in a PCR tube as shown in Table 6:

[0122] Table 6 is a specific crRNA in vitro transcription system

[0123]

[0124] The transcription system was placed in a 37°C incubator and incubated overnight. The crRNA was recovered using an RNA purification kit produced by NEB.

[0125] The recovered crRNA sequences are shown in Table 7 below:

[0126] Table 7 is the crRNA sequence

[0127] name Sequence (5′-3′) length AE26crRNA-F1 (SEQ ID NO.10) UAAUUUCUACUAAGUGUAGAUUACAUUUCCAAGGCCCUGGGCGGC 45 bp AE26crRNA-F2 (SEQ ID NO.11) UAAUUUCUACUAAGUGUAGAUCAAGGCCCUGGGCGGCCGUGG 42 bp WT crRNA-F1 (SEQ ID NO. 12) UAAUUUCUACUAAGUGUAGAUAAGGCCCUGGGCAUCCUGGG 41 bp

[0128] 2. Design and Screening of RPA Primers

[0129] Based on the upstream and downstream sequences of the target site of the second exon of the porcine pAPN gene, RPA amplification primers were designed. The candidate RPA primer sequences are shown in Table 8 below:

[0130] Table 8 shows the RPA amplification primers

[0131]

[0132] The RPA reaction system is as shown in Table 9:

[0133] Table 9 shows the RPA reaction system

[0134]

[0135] The RPA reaction conditions are as follows:

[0136] The reaction was kept at 37°C for 30 min.

[0137] 3.2×10 10 The AE26-CAAS gene-edited pig pAPN gene standard plasmid pClone-EZ-TOPO-AE26 with a concentration of 10 copies / μL was used as a template, and RPA amplification was performed using the primer pairs (F and R) shown in Table 8, the system and RPA reaction conditions shown in Table 9 to obtain RPA amplification products.

[0138] The RPA amplification products of each primer pair were subjected to agarose gel electrophoresis. Figure 2As shown in the figure, Papn-PRA-1 represents pAPN-RPA-1F / pAPN-RPA-1R, and so on. It can be seen that pAPN-RPA-4F / R has a good amplification effect.

[0139] Primers pAPN-RPA-4F (SEQ ID NO. 13) and pAPN-RPA-4R (SEQ ID NO. 14) with better amplification effects were selected as RPA amplification primers.

[0140] 3. Establishment of RPA-CRISPR / Cas12a nucleic acid detection system and screening of crRNA

[0141] The DNA probe in Table 10 is a single-stranded DNA fluorescent probe double-labeled with a 6-FAM group and a BHQ1 group, and the sequence is 6-FAM-TTATT-BHQ1. The CRISPR / Cas12a fluorescence detection system was prepared according to the components shown in Table 10 below:

[0142] Table 10 is the CRISPR / Cas12a fluorescence detection system

[0143]

[0144] RPA products were amplified using the standard plasmids pClone-EZ-TOPO-AE26 and pClone-EZ-TOPO-WT as DNA templates. AE26 crRNA-F1, AE26 crRNA-F2, and WT crRNA-F1 assay systems were prepared according to the above system. Three technical replicates were set up for each assay system, and a negative control (NC) without crRNA was also established. The prepared assay systems were reacted at 37°C for 60 minutes in a Q5 quantitative PCR instrument, with fluorescence intensity measured every 30 seconds.

[0145] The results are as follows Figure 3 As shown, AE26crRNA-F1 cleaves both the AE26-CAAS sequence and the WT sequence, stimulating trans-cleavage activity and producing fluorescence that is significantly different from that in the NC group (p<0.01). However, AE26crRNA-F1 cannot specifically recognize the AE26-CAAS sequence, and therefore cannot be used to distinguish between AE26-CAAS and WT samples. However, AE26crRNA-F2 specifically targets and cleaves only the AE26-CAAS sequence, producing fluorescence that is significantly different from that in the NC group (p<0.01), and can specifically recognize the AE26-CAAS sequence. Therefore, AE26crRNA-F2 can be used to distinguish between AE26-CAAS and WT samples.

[0146] Figure 4This indicates that WT crRNA-F1 specifically cleaves the WT sequence, stimulating trans-cleavage activity and producing fluorescence that is significantly different from that of the NC group (p<0.01). However, it fails to cleave the AE26-CAAS sequence. Therefore, WT crRNA-F1 can specifically recognize the WT sequence and can be used to distinguish AE26-CAAS from WT samples.

[0147] IV. Establishment of the RPA-CRISPR / Cas12a Nucleic Acid Detection System for AE26-CAAS Gene-Edited Pigs

[0148] 1. RPA amplification

[0149] The DNA of the sample to be tested was extracted as a template, and RPA amplification was performed using the pAPN-RPA-4F / R primer according to the system and RPA reaction conditions shown in Table 9 to obtain an RPA amplification product.

[0150] 2. CRISPR / Cas12a detection of AE26-CAAS gene-edited pigs

[0151] 1) CRISPR / Cas12a fluorescence detection

[0152] The above RPA amplification product and AE26crRNA-F2 were configured into a CRISPR / Cas12a fluorescence detection system according to the system shown in Table 10 to obtain an AE26crRNA-F2 fluorescence detection system;

[0153] The above RPA amplification product and WT crRNA-F1 were configured with the CRISPR / Cas12a fluorescence detection system according to the system shown in Table 10 to obtain the WT crRNA-F1 fluorescence detection system.

[0154] Each of the above detection systems was set up with 3 technical replicates, and a negative control (NC) without crRNA was set up.

[0155] The prepared detection system was reacted in a Q5 quantitative PCR instrument at 37°C for 60 minutes.

[0156] The reaction products of each of the above fluorescence detection systems were detected for fluorescence intensity in real time using a Q5 quantitative PCR instrument.

[0157] If the fluorescence intensity of the reaction product of the AE26crRNA-F2 detection system is extremely significant ( P If the fluorescence intensity of the reaction product of the AE26crRNA-F2 detection system is not significant ( P>0.05) is higher than the reaction product of the negative control system, then the sample to be tested does not contain or is not a candidate for containing the AE26-CAAS gene editing sequence, or the sample to be tested does not originate from or is not a candidate for originating from the AE26-CAAS gene-edited pig.

[0158] The above negative control system differs from the AE26crRNA-F2 detection system only in that no crRNA is added.

[0159] The above-mentioned AE26-CAAS gene-edited pigs are homozygous AE26-CAAS gene-edited pigs or heterozygous AE26-CAAS gene-edited pigs.

[0160] 2) CRISPR / Cas12a test strip detection

[0161] The above RPA amplification product and AE26crRNA-F2 were configured into the CRISPR / Cas12a test strip detection system according to the system shown in Table 11 to obtain the AE26crRNA-F2 test strip detection system;

[0162] The above RPA amplification product and WTcrRNA-F1 were configured with the CRISPR / Cas12a fluorescence detection system according to the system shown in Table 11 to obtain the WTcrRNA-F1 test strip detection system.

[0163] The DNA probe in Table 11 is a single-stranded DNA test strip probe dual-labeled with a Biotin group and a 6-FAM group, and the sequence is 6-FAM-TTTTTTTATTTTTTT (SEQ ID NO. 15)-C6Biotin.

[0164] Table 11 shows the CRISPR / Cas12a test strip detection system

[0165]

[0166] The AE26crRNA-F2 and WTcrRNA-F1 test strip detection systems were prepared according to the above system, and a negative control (NC) without crRNA was set up.

[0167] Each of the above detection systems was set up with 3 technical replicates, and a negative control (NC) without crRNA was set up.

[0168] The prepared detection system was reacted in a PCR instrument at 37°C for 30 minutes to obtain a reaction product (reaction solution).

[0169] The reaction products of each of the above test strip detection systems were detected using Cas12 / 13 dedicated nucleic acid detection test strips.

[0170] Open the tube cap and insert the conjugate pad end of the test strip into the reaction solution. The liquid level should not exceed the top of the conjugate pad. Wait until the reading area is completely soaked (approximately 1-2 minutes. Low ambient temperatures, such as in winter, will slow water absorption and prolong the soaking time). Read the test result directly based on the color development on the test strip.

[0171] If the T line of the reaction product of the AE26crRNA-F2 detection system is colored or the C line and T line are displayed (positive), the sample to be tested contains or is candidate to contain the AE26-CAAS gene editing sequence, or the sample to be tested is derived from or is candidate to be derived from the AE26-CAAS gene-edited pig; if the C line of the reaction product of the AE26crRNA-F2 detection system is colored and the T line is not colored (negative), the sample to be tested does not contain or is candidate not to contain the AE26-CAAS gene editing sequence, or the sample to be tested does not originate from or is candidate not to originate from the AE26-CAAS gene-edited pig.

[0172] 3. CRISPR / Cas12a detection of AE26-CAAS gene-edited pig genotype

[0173] The reaction products of each test strip system in 2) above are detected using a Cas12 / 13 dedicated nucleic acid detection test strip.

[0174] Read the test results directly according to the color of the test strip.

[0175] If the reaction product of the AE26crRNA-F2 detection system tests positive (the T line of the product of the AE26crRNA-F2 reaction system is colored or the C line and T line are displayed), and the reaction product of the WTcrRNA-F1 detection system tests negative (the C line of the product of the WTcrRNA-F1 reaction system is colored and the T line is not colored), then the sample to be tested is derived from or is a candidate for being derived from the AE26-CAAS gene-edited pig homozygote;

[0176] If the reaction product of the AE26crRNA-F2 detection system tests positive (the product of the AE26crRNA-F2 reaction system displays T line color or C line and T line are displayed), and the reaction product of the WTcrRNA-F1 detection system also tests positive (the product of the WTcrRNA-F1 reaction system displays T line color or C line and T line are displayed), then the sample to be tested is derived from or can be derived from the AE26-CAAS gene-edited pig heterozygote.

[0177] The above-mentioned AE26-CAAS gene-edited pig RPA-CRISPR / Cas12 detection system includes: AE26crRNA-F2 and / or WT26crRNA-F1, pAPN-RPA-4F primer, pAPN-RPA-4R primer, LbCas12a protein, and single-stranded DNA probe.

[0178] Example 2: Sensitivity analysis of the CRISPR / Cas12a nucleic acid detection system in AE26-CAAS gene-edited pigs

[0179] Dilute the AE26-CAAS gene-edited pig pAPN gene standard plasmid pClone-EZ-TOPO-AE26 and the pAPN gene wild-type pig pAPN gene standard plasmid pClone-EZ-TOPO-WT to 3.2×10 10 , 3.2×10 9 , 3.2×10 8 , 3.2×10 7 , 3.2×10 6 , 3.2×10 5 , 3.2×10 4 , 3.2×10 3 , 3.2×10 2 , 3.2×10 1 , 3.2×10 0 copies / μL concentration.

[0180] RPA amplification was performed using gradient concentrations of pClone-EZ-TOPO-AE26 plasmid and pClone-EZ-TOPO-WT plasmid as templates, using the aforementioned RPA primers (pAPN-RPA-4F / R) and conditions, and the RPA products were detected by electrophoresis.

[0181] The results of RPA amplification of AE26-CAAS standard plasmid pClone-EZ-TOPO-AE26 plasmid are shown in Figure 5 At a plasmid concentration of 3.2×10 2 When the concentration of plasmid is 200 copies / μL, the brightness of the electrophoresis band is already relatively weak. When the concentration of plasmid is even lower, the result is not visible.

[0182] The results of RPA amplification of WT standard plasmid pClone-EZ-TOPO-WT plasmid are shown in Figure 6 At a plasmid concentration of 3.2×10 2 When the plasmid concentration is 200 copies / μL, the brightness of the electrophoresis band is very faint. When the plasmid concentration is even lower, the result is not visible.

[0183] The above-mentioned RPA product was used as the detection template, and CRISPR / Cas12a fluorescence detection was performed using the AE26crRNA-F2 fluorescence detection system and the WTcrRNA-F1 fluorescence detection system.

[0184] The detection system and reaction conditions are shown in Example 1 (IV).

[0185] The fluorescence intensity detection results of AE26crRNA-F2 fluorescence detection system and WTcrRNA-F1 fluorescence detection system are shown in Figure 2. Figure 7 and Figure 8 When the standard plasmid concentration is 3.2×10 2 When the detection results were less than 100 copies / μL, there was still an order of magnitude difference between the detection results and the negative control, and there was a very significant difference in fluorescence intensity ( P <0.01). This indicates that the detection sensitivity of the AE26crRNA-F2 system and the WTcrRNA-F1 system is 3.2×10 2 copies / μL, with high sensitivity.

[0186] Example 3: Detection of pig nucleic acid samples using the AE26-CAAS gene-edited pig RPA-Cas12a nucleic acid detection system

[0187] The AE26-CAAS gene-edited pig nucleic acid detection system provided by the present invention was used to classify pAPN gene wild-type pigs, AE26-CAAS gene-edited pigs, and other gene-edited pigs (MSTN gene-edited pigs) to test whether the system can accurately identify AE26-CAAS gene-edited pig samples.

[0188] The above nucleic acid samples were all extracted from the genomic DNA of each pig.

[0189] The RPA amplification system was prepared according to the composition in Table 9, and the prepared amplification system was reacted in a thermostat at 37° C. for 30 minutes.

[0190] A single-stranded DNA test strip probe dual-labeled with a biotin group and a 6-FAM group was synthesized; the sequence was 6-FAM-TTTTTTTATTTTTTT (SEQ ID NO. 15)-C6Biotin. A CRISPR / Cas12a detection system was prepared according to the following composition in Table 11. The AE26crRNA-F2 test strip detection system and the WTcrRNA-F1 test strip detection system were also prepared using the above system. A negative control (NC) without crRNA was also established.

[0191] The prepared test strip detection system was reacted in a thermostat at 37° C. for 60 minutes to obtain a reaction product (reaction solution).

[0192] The reaction solution is tested using a Cas12 / 13-specific nucleic acid detection test strip, and the test results are directly read according to the color development of the test strip.

[0193] The results are as follows Figure 9 and Figure 10 As shown, Figure 9The number above each test strip indicates the sample number. When the RPA-Cas12a detection system, using AE26crRNA-F2 as the crRNA, tested nucleic acid samples from homozygous and heterozygous AE26-CAAS gene-edited pigs, wild-type pAPN pigs (wild pigs), and other gene-edited pigs, the results for nucleic acid samples not containing the AE26-CAAS gene-edited sequence (wild pigs and other gene-edited pigs) were consistent with the negative control, with color development on the C line and no color development on the T line, indicating a negative result. Nucleic acid samples containing the AE26-CAAS gene-edited sequence (homozygous and heterozygous pigs) showed color development on both the C and T lines, indicating a positive result. This demonstrates that the AE26crRNA-F2 system combined with colloidal gold test strips can accurately detect nucleic acid samples containing the AE26-CAAS gene-edited sequence.

[0194] Figure 10 In the RPA-Cas12a detection system using WT crRNA-F1 as the crRNA, the results were consistent with the negative control for nucleic acid samples from AE26-CAAS gene-edited homozygous pigs, AE26-CAAS gene-edited heterozygous pigs, wild boars, and other gene-edited pigs. Samples without the WT sequence (AE26-CAAS gene-edited homozygous pigs) showed color development on the C line but no color development on the T line, indicating a negative result. Samples containing the WT sequence (AE26-CAAS gene-edited heterozygous pigs, wild boars, and other gene-edited pigs) showed color development on both the C and T lines, indicating a positive result. This demonstrates that the WT crRNA-F1 system combined with colloidal gold test paper can accurately detect nucleic acid samples containing the WT sequence.

[0195] The combined use of AE26crRNA-F2 and WTcrRNA-F1 detection systems can accurately determine the genotype of pig nucleic acid samples. Figure 11 As shown, when the test result of the AE26crRNA-F2 system is positive and the test result of the WTcrRNA-F1 system is negative, it indicates that the nucleic acid sample is a sample of the AE26-CAAS gene-edited pig homozygote; when the test result of the AE26crRNA-F2 system is positive and the test result of the WTcrRNA-F1 system is also positive, it indicates that the nucleic acid sample is a sample of the AE26-CAAS gene-edited pig heterozygote; when the test result of the AE26crRNA-F2 system is negative and the test result of the WTcrRNA-F1 system is positive, it indicates that the nucleic acid sample is a wild-type sample.

[0196] Therefore, using the crRNAs such as AE26crRNA-F2 and WTcrRNA-F1 and the detection method provided by the present invention, the genotype of AE26-CAAS gene-edited pigs can be determined quickly, with high sensitivity and high specificity, and can be applied to the detection, breeding, production, and supervision of AE26-CAAS gene-edited pigs.

[0197] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. crRNA group, which includes crRNA1, The nucleotide sequence of the crRNA1 is SEQ ID NO.

11.

2. The crRNA group according to claim 1, characterized in that: The crRNA group also includes crRNA2; the nucleotide sequence of crRNA2 is SEQ ID NO.

12.

3. A product comprising the crRNA1, Cas12a protein, a primer pair for specific amplification of the binding target and a single-stranded DNA probe described in claim 1; Or, the product includes crRNA1 and crRNA2, Cas12a protein, primer pairs for specific amplification of each binding target and single-stranded DNA probes as described in claim 2; and, the two ends of the single-stranded DNA probe are respectively labeled with different groups; And, the group is a fluorescent group, a quenching group and / or biotin.

4. The product according to claim 3, characterized in that: The primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO.13 and a single-stranded DNA molecule shown in SEQ ID NO.

14.

5. The product according to claim 3, characterized in that: The product is a test kit, a test strip or a fluorescence detection system.

6. Any of the following substances: A1) the Cas12a protein and the crRNA1 described in claim 3, or a complex formed by the two; A2) The Cas12a protein, the crRNA1 and the crRNA2 described in claim 3, or a complex group formed with each of the Cas12a proteins.

7. Use of the crRNA according to any one of claims 1-2 or the product according to any one of claims 3-5 in any of the following: B1) Identify or assist in identifying AE26-CAAS gene-edited pigs; B2) Identify or assist in identifying whether the sample to be tested contains the AE26-CAAS gene editing sequence; B3) Identify or assist in identifying the genotype of AE26-CAAS gene-edited pigs; B4) Prepare products to identify or assist in the identification of AE26-CAAS gene-edited pigs; B5) Prepare products to identify or assist in identifying whether a sample contains the AE26-CAAS gene editing sequence; B6) Prepare products for identifying or assisting in identifying the genotype of AE26-CAAS gene-edited pigs.

8. A method for identifying or assisting in identifying AE26-CAAS gene-edited pigs, comprising the following steps: C1) using the nucleic acid of the sample to be tested as a template, performing RPA amplification with the primer pair of claim 3 or 4 to obtain an RPA amplification product; C2) preparing a CRISPR-Cas12a detection system comprising the following components: the PCR product, the Cas12a protein described in claim 6, crRNA1 in the crRNA described in claim 6, and the single-stranded DNA probe described in claim 3; C3) reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying or assisting in identifying the AE26-CAAS gene-edited pig.

9. A method for identifying or assisting in identifying the genotype of an AE26-CAAS gene-edited pig, comprising the following steps: D1) using the nucleic acid of the sample to be tested as a template, performing RPA amplification with the primer pair of claim 4 to obtain an RPA amplification product; D2) preparing CRISPR-Cas12a detection system 1 and CRISPR-Cas12a detection system 2 containing the following components; The CRISPR-Cas12a detection system 1 includes the PCR product, the Cas12a protein described in claim 6, the crRNA1 in the crRNA described in claim 6, and the single-stranded DNA probe in claim 3; The CRISPR-Cas12a detection system 2 includes the PCR product, the Cas12a protein described in claim 6, the crRNA2 in the crRNA described in claim 6, and the single-stranded DNA probe in claim 3; D3) reacting the CRISPR-Cas12a detection system 1 and the CRISPR-Cas12a detection system 2 separately, detecting the reaction products of the two systems to identify or assist in identifying the genotype of the AE26-CAAS gene-edited pig.

Images