Application of tomato HB52 gene in regulation of tomato salt stress resistance

Abstract

The invention discloses application of a tomato HB52 gene to regulation of tomato salt stress resistance, particularly relates to application of the tomato HB52 gene to mediation of sodium and potassium ion balance and regulation of tomato salt stress resistance, and belongs to the technical field of plant genetic engineering. Through transcriptome data analysis, a tomato HB52 gene is positioned, and through construction of an over-expression and mutant plant of HB52, a salt stress treatment experiment proves that HB52 has the functions of reducing the sodium ion content and increasing the potassium ion content. Compared with WT and a mutant, an overexpression plant of HB52 has higher salt stress tolerance, and the function and application of the gene are proved.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of tomato HB52 in regulating tomato salt stress tolerance. Background Art

[0002] Soil salinization seriously affects crop yield and quality. Every year, 1 billion hectares of land in the world suffer from salinization damage to varying degrees. In order to ensure the year-round production of greenhouse vegetables, producers usually use excessive fertilizers. In addition, the unique semi-closed microclimate environment of the facility has led to increasingly obvious secondary salinization of the facility soil, which has seriously inhibited the normal growth and development of vegetable crops, resulting in a significant decrease in vegetable yield, quality and economic benefits. Therefore, salt stress has seriously restricted the high-quality development of greenhouse vegetable production.

[0003] Tomatoes are often subjected to a variety of abiotic stresses throughout their growth cycle, among which salt stress is one of the most adverse abiotic stresses that leads to a decrease in tomato yield and quality. More importantly, the current area of ​​greenhouse tomato cultivation ranks first among all types of greenhouse vegetable cultivation areas in the country. The damage caused by secondary soil salinization to the growth and production of greenhouse tomatoes has seriously restricted the sustainable and high-quality development of the greenhouse vegetable industry. Therefore, it is of great theoretical and practical significance to explore the response of tomatoes to salt stress and its molecular mechanism, and to find key genes that improve tomato salt stress resistance. Summary of the invention

[0004] The present invention analyzes the transcriptome data to obtain a salt stress response gene HB52. The nucleotide sequence of the coding region (CDS) of the HB52 gene is shown in SEQ ID No. 1, and the sequence length is 540 bp. The protein sequence encoded by the gene is shown in SEQ ID No. 2, encoding 179 amino acids.

[0005] The present invention uses PCR technology to amplify the HB52 gene from the cDNA obtained by reverse transcription of tomato genome mRNA, and constructs this sequence into a gene overexpression vector such as pFGC1008-HA. The tomato plant is transformed by Agrobacterium-mediated transformation to obtain a tomato plant with enhanced salt stress resistance. The specific technical scheme is as follows:

[0006] The first object of the present invention is to provide a tomato HB52 gene, the nucleotide sequence of which is shown in SEQ ID No.1.

[0007] The amino acid sequence of the protein encoded by the tomato HB52 gene is shown in SEQ ID No.2.

[0008] The second object of the present invention is to provide an overexpression vector of tomato HB52 gene, wherein the overexpression vector is constructed by connecting the tomato HB52 gene to the AscI and KpnI restriction enzyme sites of the pFGC1008-HA vector.

[0009] The third object of the present invention is to provide the use of the aforementioned tomato HB52 gene or the aforementioned overexpression vector in regulating the sodium ion and potassium ion absorption capacity of tomatoes.

[0010] Furthermore, overexpression of the HB52 gene in tomatoes enhances the absorption of potassium ions, reduces the absorption of sodium ions, and increases the potassium / sodium ratio in tomatoes.

[0011] The fourth object of the present invention is to provide the use of the aforementioned tomato HB52 gene or the aforementioned overexpression vector in regulating the tolerance of tomato to salt stress.

[0012] Furthermore, overexpression of the HB52 gene in tomatoes enhanced the tolerance of tomato plants to salt stress.

[0013] Furthermore, the application approach is to overexpress the HB52 gene in tomatoes, thereby enhancing the absorption of potassium ions by tomatoes and reducing the absorption of sodium ions, so as to increase the potassium / sodium ratio in the body, thereby enhancing the tolerance of tomatoes to salt stress.

[0014] A fifth object of the present invention is to provide a method for improving the tolerance of tomatoes to salt stress, the method comprising the following steps:

[0015] S1. Total RNA was extracted from tomato leaves, and reverse transcribed to obtain cDNA. Using the cDNA as a template, PCR amplification was performed to obtain the tomato HB52 gene shown in SEQ ID No. 1;

[0016] S2. The PCR product obtained by S1 amplification was connected to the basic vector by double restriction digestion, positive clones were screened and sequenced to confirm, and the overexpression vector of tomato HB52 gene was constructed;

[0017] S3. The overexpression vector of the tomato HB52 gene constructed in S2 is introduced into tomato plants through the Agrobacterium-mediated tomato genetic transformation system.

[0018] Further, S1 was amplified by PCR using primers HB52-F and HB52-R, and the sequences of the primers HB52-F and HB52-R are as follows:

[0019] HB52-F: 5'-ATGGATTTCTTGAGTTGTCA-3' (SEQ ID No. 3);

[0020] HB52-R: 5'-TCAAGACAAAGATGAAGCAAA-3' (SEQ ID No. 4).

[0021] Furthermore, the basic vector in S2 is pFGC1008-HA, and the overexpression vector of the tomato HB52 gene is pFGC1008-HA-OE.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The transcriptome data of the present invention locates the transcription factor HB52, and the salt stress resistance experiment shows that HB52 can regulate the absorption of sodium ions and potassium ions by plants; the salt stress tolerance of HB52 overexpressing plants is enhanced, while the function-deficient mutant of HB52 is sensitive to salt stress.

[0024] The present invention discovered for the first time that the HB52 gene is overexpressed in tomatoes, which regulates the sodium-potassium balance of the plants, increases the potassium ion content in the body, and reduces the sodium ion content, thereby enhancing the resistance of tomatoes to salt stress and promoting the high-quality development of tomato production. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 :Construction of HB52 gene overexpression plants and mutants;

[0026] Figure 2 :Analysis of salt stress phenotypes of HB52 gene overexpression plants and mutants;

[0027] Figure 3 :Analysis of salt stress resistance of HB52 gene overexpressing plants and mutants, wherein:

[0028] Figure 3 A is the Fv / Fm value,

[0029] Figure 3 B is the sodium ion content of xylem sap,

[0030] Figure 3 C is the potassium ion content of xylem sap,

[0031] Figure 3 D is the sodium-potassium ratio of xylem sap. DETAILED DESCRIPTION

[0032] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0033] Example 1: Isolation and cloning of HB52 gene

[0034] Based on the results of the preliminary experimental analysis, the basic sequence of the HB52 gene transcript was obtained. In order to clone the HB52 gene, the applicant used wild-type tomatoes (Ailsa Craig) and TRIZOL reagent (Invitrogen) to extract total RNA from tomato leaves (the extraction method was based on the TRIZOL reagent instructions). ReverTra Ace qPCR RT Kit (Toyobo) was used to reverse transcribe 1 μg of tomato total RNA into cDNA.

[0035] According to the coding sequence of HB52 gene, PCR amplification was performed with primers HB52-F: 5'-ATGGATTTCTTGAGTTGTCA-3' (SEQ ID No. 3); HB52-R: 5'-TCAAGACAAAGATGAAGCAAA-3' (SEQ ID No. 4) to obtain the full-length coding sequence of HB52 gene.

[0036] Then the vector was digested with enzymes and connected to pFGC1008-HA to obtain the overexpression vector pFGC1008-HB52-HA-OE, which was sequenced by Hangzhou Qingke Zixi Biotechnology Co., Ltd. The sequencing result is shown in SEQ ID NO: 1, and the encoded protein sequence is shown in SEQ ID NO: 2. The results showed that the cloned sequence was consistent with the sequence published in solgenomics (Solyc02g077590.1).

[0037] The PCR reaction system is as follows:

[0038]

[0039]

[0040] PCR reaction conditions:

[0041]

[0042] Example 2: Vector construction of HB52 gene mutant

[0043] The construction of the mutant material of HB52 is based on the CRISPR-Cas9 system. The gene sequence of HB52 is imported into the online website CRISPR-GE (http: / / skl.scau.edu.cn / targetdesign / ), and then a suitable target site is selected, namely 5'-AAGAACTAGGGTTGCCACCT-3' (SEQ ID No.5), and a PCR product containing the target site is obtained by PCR amplification by adding a linker sequence before and after the target site. The purified product is then connected to the PTX41 vector (purchased from Beijing Huayueyang Biological Co., Ltd.) by simultaneous enzyme digestion and ligation of BsaI-HF endonuclease and T4 ligase, and the successfully constructed mutant vector PTX41-HB 52 is obtained after sequencing.

[0044] Example 3: Construction of HB52 mutant plants and overexpression plants

[0045] 1. The methods for constructing mutant plants and overexpression plants are as follows:

[0046] First, the positive clones pFGC1008-HB52-HA-OE and PTX41-HB52 vectors obtained in Example 1 and Example 2 were sequenced correctly and used for transformation. That is, they were introduced into the tomato variety Ailsa Craig through the Agrobacterium-mediated tomato genetic transformation system, and transgenic plants were obtained after pre-culture, infection, co-cultivation, screening of resistant calli, differentiation, rooting, transplanting, and identification. After transformation of the pAC004-HB52-HA vector, two independent overexpression tomato plants were obtained, numbered HB52-OE-1 and HB52-OE-2, and after transformation of the PTX41-HB 52 vector, two independent mutant plants were obtained, numbered hb52-1 and hb52-2. At the same time, wild-type Ailsa Craig plants were set as controls.

[0047] The specific steps are as follows:

[0048] (1) Sowing: Soak several seeds of the tomato variety Ailsa Craig in water for 3-4 hours in advance, then pour out the water and add 75% alcohol to disinfect for 45 seconds, rinse twice with sterile water, add 10% NaClO to disinfect for 12 minutes (protect from light), and wash the seeds five times with sterile water after disinfection. After soaking for about two minutes each time, pour out the sterile water, slightly dry the water, and transfer to germination medium 1 / 2MS for dark culture;

[0049] (2) Cutting seedlings for pre-culture: When the seeds germinate and grow to two mature cotyledons, cut off the leaf tips and bases with scissors, spread the cotyledons on the pre-culture medium, and pre-culture in the dark for about 1-2 days;

[0050] (3) Agrobacterium culture: Agrobacterium LBA4404 (from Shanghai Weidi Biotechnology, commercial strain) was pre-cultured on YEB solid medium with corresponding resistance selection for two days at a culture temperature of 28°C; the Agrobacterium containing the pFGC1008-HB52-HA-OE and PTX41-HB52 plasmids were transferred to YEB liquid medium and cultured on a shaker at 28°C for 12 hours;

[0051] (4) Agrobacterium infection and co-cultivation: Liquid MS medium was used to adjust the suspension of Agrobacterium containing pFGC1008-HB52-HA-OE and PTX41-HB52 plasmids to an OD of 600 0.2-0.3, culture the cotyledons in the Agrobacterium suspension with gentle shaking for 12-15 min, then transfer to sterilized filter paper, blot dry, and place on co-cultivation medium for 2 days;

[0052] (5) Screening culture: transfer the cotyledons on the co-culture medium to the screening medium and replace the medium every two weeks until adventitious buds grow from the callus tissue;

[0053] (6) Rooting: Cut off the grown adventitious buds, remove all surrounding callus tissue, keep them as intact as possible, and transfer them to rooting medium (insert medium) for rooting culture;

[0054] (7) Transplantation: Select healthy plants with roots and transplant them into nutrient soil. After the plants grow normally, conduct an assessment.

[0055] 2. The identification steps of overexpression and mutant plants are as follows:

[0056] (1) DNA extraction: Cut leaves of about 1 cm in size and extract DNA using the CTAB method (see recipe below). First, heat and extract with 1.5× CTAB extracting solution, then add chloroform and isoamyl alcohol to separate the organic phase, then precipitate DNA with anhydrous ethanol and wash with 75% ethanol to obtain a DNA solution.

[0057] (2) Vector transformation identification: In order to verify whether the pFGC1008-HB52-HA-OE overexpression vector was transformed into the plant, qRT-PCR amplification and identification were performed using the HB52 qRT-PCR specific primers HB52-F: 5'-ATGGATTTCTTGAGTTGTCA-3' (SEQ ID No. 3); HB52-R: 5'-TCAAGACAAAGATGAAGCAAA-3' (SEQ ID No. 4). The PCR reaction conditions were: 94℃ pre-denaturation for 5 min; 94℃ for 30 sec, 60℃ for 30 sec, 72℃ for 1 min, 35 cycles; 72℃ extension for 5 min. The tomato ACTIN2 gene was used as an internal reference, and the relative expression of the gene was calculated according to the method of (Livak and Schmittgen., 2001). Figure 1 A);

[0058] (1) In order to verify whether the mutant vector PTX41-HB was transformed into the plant, a primer sgRNAhb52-F: 5'-ATGGATTTCTTGAGTTGTCAAA-3' (SEQ ID No. 6) was designed before and after the sgRNA;

[0059] sgRNAhb52-R:5'-AGGTGGCAACCCTAGTTCTT-3'(SEQ ID No.7), PCR amplification, PCR products were sequenced by Hangzhou Qingke Zixi Biotechnology Co., Ltd., and sequence alignment was performed using BioXM software (V2.7), and two independent hb52 mutants were screened for experiments ( Figure 1 B).

[0060] Example 4 Salt stress tolerance experiment

[0061] The steps of salt stress treatment are:

[0062] When the HB52 gene overexpression plants, hb52 mutant plants and wild-type plants grew to five leaves and one heart, each seedling was irrigated with 200 ml ddH2O containing 200 mM NaCl every other day until the end of the treatment. The stress treatment lasted for 7 days.

[0063] HB52 gene overexpression plants, hb52 mutant plants and wild-type tomato plants were used as blank controls. After the salt stress treatment, the plants were compared with the control group without salt stress treatment under the same planting conditions to observe the differences in various properties between HB52 gene transgenic plants, hb52 mutant plants, wild-type plants and plants without stress treatment. The results are as follows Figure 2 shown.

[0064] Take photos after the experiment ends and the phenotype appears, such as Figure 2As shown in the figure, after salt stress treatment, WT leaves began to chlorosis, on the contrary, the leaves of transgenic plants OE-1# and OE-2# overexpressing the tomato HB52 gene remained green, and their growth status was significantly better than that of WT plants. The hb52 knockout mutant was significantly worse than the wild type.

[0065] To confirm the observed phenotypes, we measured the Fv / Fm of WT, overexpression plants, and knockout plants, the potassium and sodium ion contents in the xylem sap, and the sodium-potassium ratio of the xylem sap. Figure 3 As shown in the figure, there was no significant difference in the Fv / Fm values ​​of WT, overexpression plants, and knockout plants before salt stress treatment. After salt stress treatment, although the Fv / Fm values ​​of all plants decreased, the Fv / Fm value of OE plants was significantly higher than that of WT plants, and that of knockout plants was significantly lower than that of WT plants ( Figure 3 A).

[0066] In addition, under control conditions, there were no significant differences in the sodium, potassium ion and sodium-potassium ratio in the xylem sap of WT, overexpression and knockout plants. After salt stress treatment, the sodium ion content in the xylem sap of the knockout plants was significantly higher than that of the WT, while that of the overexpression plants was significantly lower than that of the WT, while the potassium ion content was just the opposite. In addition, the sodium-potassium ratio in the xylem sap of the knockout plants was significantly higher than that of the wild type, while that of the overexpression plants was significantly lower than that of the wild type ( Figure 3 B. Figure 3 C. Figure 3 D).

[0067] In summary, it can be seen that the tomato HB52 gene can regulate the plant's absorption of sodium and potassium ions; overexpression of the HB52 gene in tomatoes enhances the absorption of potassium ions, reduces the absorption of sodium ions, and increases the potassium / sodium ratio in tomatoes. HB52 overexpressing plants have enhanced salt stress tolerance, while HB52 loss-of-function mutants are sensitive to salt stress.

[0068] SEQ ID No.1 Nucleotide sequence of tomato HB52 gene

[0069] ATGGATTTCTTGAGTTGTCAAACTCAAAAAATTCATTTAAAATGTCACAAGAAAAGACTCAACCAAGATCAAATGAGGCTCTTAGAGATTAGCTTCAGTCTCGAATAACAAGCTTGATTCCGATAGAAAATTTCAA CTTGCCCAAGAACTAGGGTTGCCACCTAGGCAAATCGCAATATGGTATCAAAACAAGCGAGCACGATGGAAAAGTCAAAGCCTTGAGGTTGACTATAAGACCTTGCAACAAAGACTAGATAATGCCCTTGAGGAT AATGAGAAGTTGAAATTGGAAGTTGAGAGGCTAAGAAAAGAGCTAAACAAAAATCAAGAAGTGTTGTTGGGATTCAACACCACAACTACTAATAATTATTCATCAATTTCAAGTTCTTGTGATGAAGTTGGGAGT ACTTCATGTTTGCAACTTCATGATCAATCCAAGCATAATCATCTTGATAAGGATTTTTATGCTTGTTTAATTGGTGATGAAGGTCACTTTGGGACACATGATGGGCATAATTTCTTTGCTTCATCTTTGTCTTGA

[0070] SEQ ID No.2 Amino acid sequence encoded by tomato HB52 gene

[0071] MDFLSCQTQKIHLKCHKKRLNQDQMRLLEISFSSNNKLDSDRKFQLAQELGLPPRQIAIWYQNKRARWKSQSLEVDYKTLQQRLDNALEDNEKLKLEVERLRKELNKNQEVLLGFNTTTTNNYSSISSSCDEVGSTSCLQLHDQSKHNHLDKDFYACLIGDEGHFGTHDGHNFFASSLS

[0072] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Tomato HB52 gene, characterized in that The nucleotide sequence of the tomato HB52 gene is shown in SEQ ID No.

1.

2. An overexpression vector of tomato HB52 gene, characterized in that: The overexpression vector is constructed by connecting the tomato HB52 gene to the AscI and KpnI restriction enzyme sites of the pFGC1008-HA vector.

3. Use of the tomato HB52 gene according to claim 1 or the overexpression vector according to claim 2 in regulating the sodium ion and potassium ion absorption capacity of tomatoes.

4. The use according to claim 4, characterized in that: Overexpression of the HB52 gene in tomatoes enhances the absorption of potassium ions, reduces the absorption of sodium ions, and increases the potassium / sodium ratio in tomatoes.

5. Use of the tomato HB52 gene according to claim 1 or the overexpression vector according to claim 2 in regulating the tolerance of tomato to salt stress.

6. The use according to claim 5, characterized in that: Overexpression of the HB52 gene in tomatoes enhances the tolerance of tomato plants to salt stress.

7. The use according to claim 5, characterized in that: By overexpressing the HB52 gene in tomatoes, the absorption of potassium ions by tomatoes is enhanced, while the absorption of sodium ions is reduced, thereby increasing the potassium / sodium ratio in tomatoes and enhancing the tolerance of tomatoes to salt stress.

8. A method for improving tomato tolerance to salt stress, characterized in that: The method comprises the following steps: S1. Extracting total RNA from tomato leaves, reverse transcription to obtain cDNA, using cDNA as a template, PCR amplification to obtain the tomato HB52 gene according to claim 1; S2. The PCR product obtained by S1 amplification was connected to the basic vector by double restriction digestion, positive clones were screened and sequenced to confirm, and the overexpression vector of tomato HB52 gene was constructed; S3. The overexpression vector of the tomato HB52 gene constructed in S2 is introduced into tomato plants through the Agrobacterium-mediated tomato genetic transformation system.

9. The method according to claim 8, characterized in that S1 was amplified by PCR using primers HB52-F and HB52-R. The sequences of the primers HB52-F and HB52-R are as follows: HB52-F: 5'-ATGGATTTCTTGAGTTGTCA-3' (SEQ ID No. 3); HB52-R: 5'-TCAAGACAAAGATGAAGCAAA-3' (SEQ ID No. 4).

10. The method according to claim 8, characterized in that S2 The basic vector is pFGC1008-HA, and the overexpression vector of the tomato HB52 gene is pFGC1008-HA-OE.

Images