A DcaWRKY2 gene regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions and its application

Abstract

The present invention relates to the field of genetic engineering and molecular breeding technology, and in particular to a DcaWRKY2 gene for regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions and its application. The DcaWRKY2 gene provided by the present invention is a WRKY gene that inhibits anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions. In a specific embodiment of the present invention, the function of the DcaWRKY2 gene was verified by virus-induced gene silencing (VIGS) technology, and the results showed that: the presence of the gene inhibits starch synthesis and anthocyanin accumulation in Dendrobium officinale leaves; in Dendrobium officinale, by targeted silencing of the target gene (DcaWRKY2 gene), the content of starch and anthocyanin in the leaves of Dendrobium officinale can be significantly increased; at the same time, due to the large amount of accumulation of starch and anthocyanin in the leaves of Dendrobium officinale, the starch content of the leaves can be significantly increased and the leaf color becomes red.

Description

Technical Field

[0001] The present invention relates to the technical fields of genetic engineering and molecular breeding, and in particular to a DcaWRKY2 gene for regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions, and applications thereof. Background Art

[0002] In gravity-enhanced landscapes and bonsai, leaf and flower color are intertwined, holding equal importance. Leaf color, to some extent, even holds greater ornamental value. Cultivating new varieties with distinctive leaf colors is gaining increasing attention. Dendrobium species in the Orchidaceae family possess exceptionally high ornamental value, and their leaf and flower color, as key ornamental traits, are highly sought after in both domestic and international markets.

[0003] Dendrobium catenatum is a perennial herbaceous plant of the genus Dendrobium in the Orchidaceae family, known as the "gold of medicine". Starch is the main photosynthetic product of Dendrobium officinale leaves, and the regulation of its metabolic process plays an important role in the yield and quality of Dendrobium officinale.

[0004] As the space industry enters the deep space exploration phase, astronauts will spend extended periods away from Earth in microgravity. The scientific challenge of establishing a space life support system is pressing, and the growth and development of higher plants plays a crucial role. Numerous experiments in space environments have demonstrated that microgravity affects plant growth and development, and thus plant productivity, in space. Plants are affected by the microgravity environment at both the individual and cellular levels. The "starch-statolith" hypothesis of plant gravity perception proposes that starch in plants can sense gravity under gravity conditions. This physical phenomenon has recently been explained at the molecular level. However, the molecular mechanism by which starch in plants senses gravity under microgravity has remained largely unexplored. As we all know, starch is fundamental to plant growth and development. Dendrobium officinale can provide astronauts with a source of food and medicine, making research on its starch in microgravity of significant importance. Furthermore, Dendrobium officinale is a facultative CAM plant. In the absence of light, it can fix carbon dioxide in the space station through malic acid metabolism. In the presence of light, it can produce oxygen for astronauts, eliminating competition for oxygen. This is economical and energy-efficient, making it more compatible with the unique environment of simulated microgravity. Furthermore, space for plant growth equipment is at a premium on the space station, and the small size of Dendrobium officinale makes it easier to study within the limited space station. Furthermore, its flowers and leaves are also ornamental and can improve astronauts' physical and mental well-being. This makes Dendrobium officinale a prime candidate for studying scientific questions in microgravity. Therefore, studying the molecular mechanisms underlying the formation and regulation of starch and leaf color in Dendrobium officinale under simulated microgravity is crucial. The research results on starch and leaf color of Dendrobium officinale under simulated microgravity can also be applied to research under gravity conditions in the future, providing theoretical support and genetic resources for the breeding of new varieties of Dendrobium officinale with diverse leaf colors, high yield and high quality under simulated microgravity and gravity.

[0005] Anthocyanins, the most important chromogenic compounds among flavonoids, are stable compounds formed by a series of modifications to anthocyanidins, including hydroxylation, methoxylation, glycosylation, and acylation. They control leaf color and give plants a vibrant array of colors. The anthocyanin synthesis pathway is well-characterized and highly conserved, and its regulatory mechanisms have been reported in numerous model and non-model plants. Furthermore, starch synthesis is achieved through the coordinated action of numerous plastid-localized enzymes, and the starch synthesis pathway has been described in numerous model and non-model plants.

[0006] Under gravity, although anthocyanin and starch synthesis pathways have been shown to be involved in the accumulation of anthocyanins and the synthesis of starch in many plants, most studies have focused on model plants or crops. There is a relative lack of research on ornamental medicinal and edible flowers, especially in Dendrobium officinale.

[0007] For a long time, the breeding model for Dendrobium officinale has primarily relied on inter-cultivar hybridization, a process characterized by high randomness and blindness. It often takes considerable time and effort, and multiple generations of selection, to achieve the desired variety. In recent years, with the rapid advancement of science and technology, targeted molecular breeding techniques using transgenic technology have gained widespread application in crops and horticultural flowers. Molecular breeding uses transgenic technology to knock out genes controlling relevant phenotypic traits in target plants, thereby eliminating the corresponding phenotype and ultimately obtaining the desired variety. Therefore, screening for key genes controlling relevant phenotypic traits is a prerequisite and a vital resource for molecular breeding. Currently, basic research on starch metabolism in Dendrobium officinale is relatively underdeveloped. The starch metabolism-related genes in its genome have not yet been identified, and the expression of these starch metabolism genes is synergistic, as well as their transcriptional regulation, remains unknown. Furthermore, research on the anthocyanin biosynthesis pathway and starch biosynthesis pathway in plants under microgravity conditions remains elusive. Summary of the Invention

[0008] The present invention aims to provide a DcaWRKY2 gene for regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions, and its application, to address the problems of the above-mentioned prior art. The present invention provides a DcaWRKY2 gene for regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions. Inhibiting the expression of this gene can significantly increase the anthocyanin and starch content in Dendrobium officinale.

[0009] To achieve the above object, the present invention provides the following solutions:

[0010]

[0011] This study, by targeting and silencing the DcaWRKY2 gene under gravity and microgravity conditions, significantly promoted anthocyanin synthesis and starch accumulation in Dendrobium officinale. The discovery of this gene enriches the genetic material library for molecular breeding of transgenic Dendrobium officinale and provides strong support for future molecular breeding of high-quality Dendrobium officinale and red-leaf Dendrobium officinale under gravity and microgravity.

[0012] The present invention provides a biological material containing the DcaWRKY2 gene. The biological material comprises a recombinant vector and a recombinant bacterium.

[0013] Further preferably, the base vector of the recombinant vector is pTRV2-GFP.

[0014] More preferably, the basic bacteria of the recombinant bacteria is Agrobacterium.

[0015] The present invention provides the use of the above-mentioned DcaWRKY2 gene or the above-mentioned biological material in regulating the anthocyanin synthesis and / or starch accumulation in Dendrobium officinale, and promotes the anthocyanin synthesis and / or starch accumulation in the Dendrobium officinale by inhibiting the expression of the DcaWRKY2 gene.

[0016] The present invention provides a method for promoting anthocyanin synthesis and / or starch accumulation in Dendrobium officinale, comprising the step of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.1, and the specific nucleotide sequence is as shown above.

[0017] The present invention provides the use of the above-mentioned DcaWRKY2 gene or the above-mentioned biological material in cultivating transgenic Dendrobium officinale with high anthocyanin content and / or high starch content, and obtains the transgenic Dendrobium officinale with high anthocyanin content and / or high starch content by inhibiting the expression of the DcaWRKY2 gene.

[0018] The present invention provides a method for cultivating transgenic Dendrobium officinale with high anthocyanin content and / or high starch content, comprising the steps of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale to obtain the transgenic Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.1, and the specific nucleotide sequence is as shown above.

[0019] The present invention provides the use of the DcaWRKY2 gene or the biological material in regulating the color of Dendrobium officinale leaves. Dendrobium officinale with red leaves is obtained by controlling the expression of the DcaWRKY2 gene.

[0020] The present invention provides a method for changing the color of Dendrobium officinale leaves, comprising the step of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.1, and the specific nucleotide sequence is as shown above.

[0021] The present invention provides the use of the DcaWRKY2 gene or the biological material in cultivating transgenic Dendrobium officinale with red leaves. By inhibiting the expression of the DcaWRKY2 gene, transgenic Dendrobium officinale with red leaves is obtained.

[0022] The present invention also provides a method for cultivating transgenic Dendrobium officinale with red leaves, comprising the steps of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale to obtain the transgenic Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.1, and the specific nucleotide sequence is as shown above.

[0023] The present invention discloses the following technical effects:

[0024] The present invention isolates and identifies a WRKY gene from Dendrobium officinale that inhibits anthocyanin synthesis and starch accumulation under both gravity and microgravity. The gene is named DcaWRKY2 (005780), or simply DcaWRKY2, and its nucleotide sequence is shown in SEQ ID NO. 1. The DcaWRKY2 gene provided by the present invention is a WRKY gene that inhibits anthocyanin synthesis and starch accumulation in Dendrobium officinale under both microgravity and gravity conditions. The discovery of this gene improves the integrity of the pathway that controls starch accumulation and anthocyanin synthesis in leaves of Dendrobium officinale. In a specific embodiment of the present invention, the function of the DcaWRKY2 gene was verified by virus-induced gene silencing (VIGS) technology, and the results showed that the presence of this gene inhibits starch synthesis and anthocyanin accumulation in the leaves of Dendrobium officinale; in Dendrobium officinale, by targeted silencing of the target gene (DcaWRKY2 gene), the content of starch and anthocyanins in the leaves of Dendrobium officinale can be significantly increased; at the same time, due to the large accumulation of starch and anthocyanins in the leaves of Dendrobium officinale, the starch content of the leaves can be significantly increased and the leaf color can be reddish. The DcaWRKY2 gene provided by the present invention can enrich and improve the transgenic material library of Dendrobium officinale with high starch content and red leaf traits under gravity and microgravity, providing strong support for the future molecular breeding of high-quality Dendrobium officinale and red leaf traits under gravity and microgravity. It can be seen that the present invention supplements the role of the DcaWRKY2 gene in regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions, and is an important basis and prerequisite for future molecular improvement breeding of Dendrobium officinale leaf color, yield and quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 The phenotype of Dendrobium officinale leaves after silencing the DcaWRKY2 gene; wherein, the blank control is the Dendrobium officinale leaves without any treatment, the injection empty control is the Dendrobium officinale leaves injected with pTRV2-GFP, and the DcaWRKY2 silenced control is the Dendrobium officinale leaves injected with pTRV2-GFP-DcaWRKY2(005780);

[0027] Figure 2 The anthocyanin content in the leaves of Dendrobium officinale after silencing the DcaWRKY2 gene; wherein, the blank control is the leaves of Dendrobium officinale without any treatment, the injection control is the leaves of Dendrobium officinale injected with pTRV2-GFP, and the DcaWRKY2 silenced control is the leaves of Dendrobium officinale injected with pTRV2-GFP-DcaWRKY2(005780);

[0028] Figure 3 The starch content in the leaves of Dendrobium officinale after silencing the DcaWRKY2 gene; among them, the blank control is the Dendrobium officinale leaves without any treatment, the injection empty control is the Dendrobium officinale leaves injected with pTRV2-GFP, and the DcaWRKY2 silenced control is the Dendrobium officinale leaves injected with pTRV2-GFP-DcaWRKY2(005780). DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Example 1

[0035]

[0036] Example 2 Silencing the DcaWRKY2 (005780) gene in Dendrobium officinale leaves using virus-induced gene silencing (VIGS) technology

[0037] 1) Total RNA was extracted from leaves of Dendrobium officinale and reverse transcribed into cDNA. A 123-bp base sequence of the DcaWRKY2 (005780) gene was selected (in orchids, constructing the 123-bp CDS sequence of the target gene into a vector can prove the function of the gene. Reference: Hou T, Huang M, Liao Y, et al. Virus-induced gene silencing (vigs) for functional analysis of genes involved in the regulation of anthocyanin biosynthesis in the perianth of phalaenopsis-type dendrobium hybrids [J]. Scientia Horticulturae, 2023, 307: 111485.) Upstream and downstream specific primers were designed. The upstream specific primer is shown in SEQ ID NO. 2, specifically: ATGGCCGGGATAGATGACAGT, and the downstream specific primer is shown in SEQ ID NO. 3, specifically: TAGGTCAGGAAATGGTCTTGAGCAA. The target sequence was cloned and sequenced to ensure the accuracy of the sequence.

[0038] 2) The 123 bp base sequence of the DcaWRKY2 (005780) gene was constructed by seamless cloning between two restriction enzyme sites (BamHI and PSTI) of the plant expression vector pTRV2-GFP and sequenced to obtain the correct pTRV2-GFP-DcaWRKY2 (005780);

[0039] 3) Transform the constructed expression vector (pTRV2-GFP-DcaWRKY2 (005780) or pTRV2-GFP) into competent Agrobacterium tumefaciens GV3101 cells, spread onto LB plates (kanamycin 50 μg / mL, rifampicin 25 μg / mL), and incubate upside down in a 28°C incubator for 2-3 days. Perform colony PCR on randomly selected single colonies, identify the correct Agrobacterium clone, and mark it for future use.

[0040] 4) Select a correct Agrobacterium colony and inoculate it into 5 mL of LB liquid medium containing kanamycin. Incubate the culture at 28°C and 200 rpm for 16-20 hours until the culture becomes turbid but not whitish. This is how the Agrobacterium culture is obtained.

[0041] 5) The Agrobacterium culture obtained in step 4) was inoculated into 100 mL of LB liquid medium (kanamycin 100 μg / mL, rifampicin 25 μg / mL, MES 10 mM, AS (acetosyringone) 200 μM) at a ratio of 1%, and shaken at 28°C and 200 rpm overnight. 600 =1.8, and centrifuged at 5000 rpm for 10 min to collect the cells.

[0042] 6) Suspend the bacteria in Agrobacterium infection buffer (MES 10 mM; AS 100 μM; MgC12 10 mM; sterile water as solvent) and adjust the OD 600 = about 1.0; pTRV1 was mixed with equal volumes of Agrobacterium infection buffer containing pTRV2-GFP (control) and pTRV2-GFP-DcaWRKY2 (005780), and allowed to stand at room temperature (24°C) for 4 hours in the dark to obtain the bacterial solution to be injected for later use;

[0043] 7) The specific infection procedure is as follows: select one-year-old Dendrobium officinale leaves and use a syringe to inject the bacterial solution to be injected on the back of the leaf. The amount of bacterial solution to be injected is about 1 mL per leaf. Detailed information such as the treatment group is marked on the label. At the same time, an untreated Dendrobium officinale leaf is used as a blank control.

[0044] 8) After the injection is completed, wrap it in a black plastic bag and shade it from the sun. Remove the shade bag after 24 hours and allow it to grow in a normal environment.

[0045] 9) After about 7 days, the phenotype will appear. Take pictures and check the anthocyanin content. The results are as follows: Figure 1 and Figure 2 The results showed that the DcaWRKY2(005780) gene affects the synthesis of anthocyanins. Silencing the DcaWRKY2(005780) gene promotes the synthesis of anthocyanins in Dendrobium officinale, thereby affecting the color of Dendrobium officinale and ultimately obtaining red Dendrobium officinale leaves.

[0046] 10) After 7 days, the starch content in the leaves was investigated. Figure 3 As shown, the results showed that the DcaWRKY2(005780) gene affects starch accumulation, and silencing the DcaWRKY2(005780) gene promotes the accumulation of starch in Dendrobium officinale.

[0047] It can be seen from the above implementation scheme that the present invention can enrich the transgenic material library for regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale leaves under gravity and microgravity. The present invention can be used to target and regulate the starch content and red trait of Dendrobium officinale leaves through transgenic technology.

[0048] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of the DcaWRKY2 gene in regulating anthocyanin synthesis and / or starch accumulation in Dendrobium officinale, characterized in that: By inhibiting the expression of the DcaWRKY2 gene, anthocyanin synthesis and / or starch accumulation in the Dendrobium officinale are promoted; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.

1.

2. A method for promoting anthocyanin synthesis and / or starch accumulation in Dendrobium officinale, characterized in that: The method comprises the step of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.

1.

3. Application of the DcaWRKY2 gene in cultivating transgenic Dendrobium officinale with high anthocyanin content and / or high starch content, characterized in that: The transgenic Dendrobium officinale with high anthocyanin content and / or high starch content is obtained by inhibiting the expression of the DcaWRKY2 gene; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.

1.

4. A method for cultivating transgenic Dendrobium officinale with high anthocyanin content and / or high starch content, characterized in that: The method comprises the steps of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale to obtain the transgenic Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.

1.

5. Application of the DcaWRKY2 gene in regulating the leaf color of Dendrobium officinale, characterized in that: Dendrobium officinale with red leaves is obtained by inhibiting the expression of the DcaWRKY2 gene; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.

1.

6. A method for changing the color of Dendrobium officinale leaves, characterized in that: The method comprises the steps of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale to obtain Dendrobium officinale with red leaves; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.

1.

7. Application of the DcaWRKY2 gene in cultivating transgenic Dendrobium officinale with red leaves, characterized in that: By inhibiting the expression of the DcaWRKY2 gene, a transgenic Dendrobium officinale with red leaves is obtained; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.

1.

8. A method for cultivating transgenic Dendrobium officinale with red leaves, characterized in that: The method comprises the steps of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale to obtain the transgenic Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.1.

Images